Combining Fluorescence and Bioluminescence Microscopy to Study the Series of Events from Cellular Signal Transduction to Gene Expression

Kazuhito Goda1, Takeo Takahashi1, Hirobumi Suzuki1

1 Evaluation Technology Department 1, Olympus Corporation, Tokyo
Publication Name:  Current Protocols in Cell Biology
Unit Number:  Unit 4.35
DOI:  10.1002/cpcb.35
Online Posting Date:  December, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The molecular interactions and translocation of signal transduction factors in individual cells can be imaged by fluorescence microscopy. Alternatively, downstream promoter activity in single cells can be imaged by bioluminescence microscopy. However, the same stimuli can lead to different gene expression responses in individual cells. For this reason, it is desirable to simultaneously image signal transduction and gene expression events in the same cells. Here, we describe a method that combines fluorescence and bioluminescence microscopy to image protein kinase C (PKC) translocation from the cytosol to the plasma membrane and the expression of nuclear factor kappa‐light polypeptide B (NF‐κB)‐regulated genes. © 2017 by John Wiley & Sons, Inc.

Keywords: bioluminescence; fluorescence; imaging; gene expression; signal transduction; single‐cell analysis

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Combination of Bioluminescence and Fluorescence Microscopy
  • Basic Protocol 2: Construction of PKCα‐RFP and Luciferase Co‐Expression Vector
  • Basic Protocol 3: Time‐Lapse Imaging from PKCα Translocation to Gene Expression Activated by NF‐κB
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Combination of Bioluminescence and Fluorescence Microscopy

  Materials
  • Inverted bioluminescence microscope system (LV200, Olympus)
  • Phase‐contrast objective lens (UPLFLN 100X O2PH, NA 1.3, Olympus)
  • Shutter plate
  • Ring slit for phase‐contrast observation (IX‐PH3, Olympus)
  • 1% ND filter
  • Excitation filter (BP545‐580, Olympus)
  • Emission filter (610 ALP, Omega, Brattleboro, VT)
  • EM‐CCD camera (ImagEM C9100‐13, Hamamatsu Photonics)
  • Imaging acquisition and analysis software (Aqua cosmos, Hamamatsu Photonics)

Basic Protocol 2: Construction of PKCα‐RFP and Luciferase Co‐Expression Vector

  Materials
  • Plasmid and template DNA:
  • pNF‐κB(1)‐Luc TransLucent vector (Panomics)
  • pGL4.14‐Luc2 luciferase reporter vector (Promega)
  • pBudCE4.1 mammalian co‐expression vector (Thermo Fisher Scientific)
  • pmKate2‐N RFP Vector (Evrogen)
  • Mouse brain cDNA library (Takara Bio)
  • Restriction enzymes: HindIII, KpnI, NheI, PstI, XbaI, and XhoI (Takara Bio)
  • Restriction enzyme buffers: H, M, and L (Takara Bio)
  • TAE buffer (see recipe)
  • Ethidium bromide (see recipe)
  • Wizard SV Gel and PCR Clean‐up System (Promega)
  • Wizard Plus SV Miniprep DNA Purification System (Promega)
  • DNA ligation kit (Takara Bio)
  • Escherichia coli competent cells, DH5α (Takara Bio)
  • Luria Bertani (LB) agar plates containing 100 μg/ml ampicillin, 25 μg/ml zeocin, or 50 μg/ml kanamycin (see recipe)
  • LB medium (see recipe)
  • 100 mg/ml ampicillin (see recipe)
  • 100 mg/ml zeocin (see recipe)
  • 50 mg/ml kanamycin (see recipe)
  • Pfu turbo DNA polymerase (Agilent Technologies)
  • PCR primer set 1: region of luminescence cassette with the NheI site at the 3′ end of forward primer and KpnI at the 5′‐end of reverse primer (forward primer: 5′–GGTACCGAGCTCTTACGCGTGCTAGC–3′; reverse primer: 5′–ATGCGGTACCTTACACGGCGATCTTGCCGCCCT–3′)
  • PCR primer set 2: synthetic poly(A) site of pGL4.14 with the NheI site at the 5′ ends of forward and reverse primers (forward primer: 5′–TCCGCTAGCAATAAAATATCTTTATTTTCATT–3′; reverse primer: 5′–TCCGCTAGCAGAGAAATGTTCTGGCACCTGCAC–3′)
  • PCR primer set 3: PKCα with XhoI at the 5′‐end of forward primer and KpnI at the 5′ end of reverse primer (forward primer: 5′–AAACTCGAGATGGCTGACGTTTACCCGGCCAAC–3′, reverse primer: 5′–CCCGGTACCTACTGCACTTTGCAAGATTGGGTG–3′)
  • PCR primer set 4: for homologous recombination between PKCα‐mKate2 coding region and pBudCE4.1‐pANF vector (forward primer: 5′–TCACTATAGGGAGACCCAAGCTTGTAATGGCTGACGTTTACCCGGCCAAC–3′, reverse primer: 5′–CTTCTGAGATGAGTTTTTGTTCGGATCCTTATCTGTGCCCCAGTTTGCTAGGGAG–3′)
  • Calf intestinal alkaline phosphatase (CIAP; Takara Bio)
  • Gene ART Seamless Cloning and Assembly Kit (Thermo Fisher Scientific)
  • BigDye terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific)
  • UV transilluminator
  • Applied Biosystems 3130 XL Genetic Analyzer (Thermo Fisher Scientific)

Basic Protocol 3: Time‐Lapse Imaging from PKCα Translocation to Gene Expression Activated by NF‐κB

  Materials
  • HeLa cells
  • Dulbecco's Modified Eagle's Medium (DMEM; Thermo Fisher Scientific)
  • Fetal bovine serum (FBS)
  • pBudCE4.1‐pANF‐PαK ( protocol 2)
  • FuGene HD transfection reagent (Roche)
  • OptiMEM (Thermo Fisher Scientific)
  • FluoroBright DMEM (Thermo Fisher Scientific)
  • Immersion oil
  • 100 mM D‐Luciferin (Promega)
  • 100 μg/ml phorbol‐12‐myristate‐13‐acetate (PMA; see recipe)
  • 35‐mm glass‐bottomed dish
  • Inverted LV200 bioluminescence microscope, set up as in protocol 1
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Goda, K., Hatta‐Ohashi, Y., Akiyoshi, R., Sugiyama, T., Sakai, I., Takahashi, T., & Suzuki, H. (2015). Combining fluorescence and bioluminescence microscopy. Microscopy Research and Technique, 78, 715–722. doi: 10.1002/jemt.22529.
  Itzkovitz, S., & van Oudenaarden, A. (2011). Validating transcripts with probes and imaging technology. Nature Methods, 8, S12–S19. doi: 10.1038/nmeth.1573.
  Kennedy, H. J., Viollet, B., Rafiq, I., Khan, A., & Rutter, G. A. (1997). Upstream stimulatory factor‐2 (USF2) activity is required for glucose stimulation of L‐pyruvate kinase promoter activity in single living islet β‐cells. Journal of Biological Chemistry, 272, 20636–20640. doi: 10.1074/jbc.272.33.20636.
  Ogoh, K., Akiyoshi, R., May‐Maw‐Thet, Sugiyama, T., Dosaka, S., Hatta‐Ohashi, Y., & Suzuki, H. (2014). Bioluminescence microscopy using a short focal‐length imaging lens. Journal of Microscopy, 253, 191–197. doi: 10.1111/jmi.12109.
  Sambrook, J., & Russell, D.W. (2001) Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. ISBN: 0‐87969‐577‐3.
  Schroeder, T. (2011). Long‐term single‐cell imaging of mammalian stem cells. Nature Methods, 8, S30–S35. doi: 10.1038/nmeth.1577.
  Shin, Y. H., Yoon, S. H., Choe, E. Y., Cho, S. H., Woo, C. H., Rho, J. Y., & Kim, J. H. (2007). PMA‐induced up‐regulation of MMP‐9 is regulated by a PKCα‐NF‐κB cascade in human lung epithelial cells. Experimental & Molecular Medicine, 39, 97–105. doi: 10.1038/emm.2007.11.
  Suzuki, H., May‐Maw‐Thet, Hatta‐Ohashi, Y., Akiyoshi, R., & Hayashi, T. (2016). Bioluminescence microscopy: Design and applications. In J. Thirumalai (Ed.), Luminescence: An outlook on the phenomena and their applications (pp. 333–349). Rijeka: InTech. doi: 10.5772/65048.
  Suzuki, H., Akiyoshi, R., & Ogoh, K. (2017). Bioluminescence microscopy in live cells: Consideration of experimental factors and practical recommendations. In L. V. Berhardt (Ed.), Advances in medicine and biology (Vol. 108, pp. 101–115). Hauppauge, NY: Nova Science Publishers. ISBN: 978‐1‐53610‐135‐5.
  Takasuka, N., White, M. R. H., Wood, C. D., Robertson, W. R., & Davis, J. R. E. (1998). Dynamic changes in prolactin promoter activation in individual living lactotrophic cells. Endocrinology, 139, 1361–1368. doi: 10.1210/endo.139.3.5826.
  Tang, F., Lao, K., & Surani, M. A. (2011). Development and applications of single‐cell transcriptome analysis. Nature Methods, 8, S6–S11. doi: 10.1038/nmeth.1557.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library