Analysis of Eukaryotic Translation in Purified and Semipurified Systems

William C. Merrick1, Jack O. Hensold1

1 Case Western Reserve University School of Medicine, Cleveland, Ohio
Publication Name:  Current Protocols in Cell Biology
Unit Number:  Unit 11.9
DOI:  10.1002/0471143030.cb1109s08
Online Posting Date:  May, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Much of the current understanding of the sequential steps involved in translation initiation has been obtained using sucrose gradients to isolate ribosomes and ribosomal subunits, as described here. These purified components are combined with purified translation factors to analyze the formation of intermediates in translation initiation and the roles of the translation factors in vitro.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Identifying Intermediates in the Formation of Protein Synthesis Initiation Complexes
  • Alternate Protocol 1: Formation of 48S Preinitiation Complexes
  • Alternate Protocol 2: Formation of 80S Initiation Complexes
  • Support Protocol 1: Isolation of Ribosomal Subunits Using Preparative Sucrose Gradients
  • Alternate Protocol 3: Monitoring the Position of the Ribosome on Globin mRNA
  • Support Protocol 2: Determination of Relative Sedimentation Coefficients Using Analytical Sucrose Gradients
  • Basic Protocol 2: Analysis of Translation in Cultured Cells
  • Alternate Protocol 4: Purification of Ribosomal Complexes from Cultured Cells for Biochemical Assays
  • Support Protocol 3: Preparation of Yeast Lysates
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Identifying Intermediates in the Formation of Protein Synthesis Initiation Complexes

  Materials
  • 10% and 40% (w/v) sucrose gradient solutions (see recipe)
  • 1 M Tris⋅Cl, pH 7.5 ( appendix 2A)
  • 1 M KCl
  • 100 mM MgCl 2 (see recipe)
  • 100 mM dithiothreitol
  • 100 A 260 units/ml AUG
  • 100 mM GTP (see recipe)
  • 150 mM phosphoenolpyruvate
  • 3000 IU/ml pyruvate kinase
  • 10 µM [3H]Met‐tRNA i (15 Ci/mmol)
  • 16 µM 40S subunits (see protocol 4)
  • 8 µM eucaryotic initiation factor 2 (eIF2)
  • 15 µM eIF3
  • Aqueous scintillation solution (e.g., Ecoscint, National Diagnostics)
  • 10% (w/v) trichloroacetic acid (TCA) solution, ice cold
  • Acetone
  • SDS sample buffer (see recipe)
  • Gradient maker
  • Refrigerated high‐speed centrifuge (e.g., Beckman L7‐55)
  • Swinging bucket rotor and appropriate tubes (e.g., Beckman SW56 rotor with 5‐ml tubes)
  • UV absorbance detector and chart recorder
  • Syringe or peristaltic pump
  • Fraction collector (e.g., ISCO model 640 gradient fractionator)
  • 90°C oven or heating block
  • Additional reagents and equipment for SDS‐PAGE (unit 6.1)

Alternate Protocol 1: Formation of 48S Preinitiation Complexes

  • 1 M KCl
  • 1 M Tris⋅Cl, pH 7.5 ( appendix 2A)
  • 100 mM dithiothreitol

Alternate Protocol 2: Formation of 80S Initiation Complexes

  • 16 µM 60S subunits (see protocol 4)
  • 70 µM eucaryotic initiation factor 1A (eIF1A)
  • 70 µM eIF5A
  • 20 µM eIF5
  • 1 M Tris⋅Cl, pH 7.5 ( appendix 2A)
  • 1 M KCl
  • 100 mM dithiothreitol
  • 100 mM KPO 4, pH 8.0
  • Ethyl acetate
  • Scintillation solution (e.g., Econofluor)
  • 13 × 100–mm test tubes
  • Scintillation vials

Support Protocol 1: Isolation of Ribosomal Subunits Using Preparative Sucrose Gradients

  Materials
  • Rabbit reticulocyte lysate (Green Hectares)
  • Standard sucrose solution (see recipe)
  • KCl
  • Subunit buffer (see recipe)
  • 5% and 20% (w/v) sucrose gradient solutions (see recipe)
  • 0.25 M sucrose solution (see recipe)
  • Refrigerated high‐speed centrifuge (e.g., Beckman L7‐55)
  • Type 35 rotor and 70‐ml polycarbonate centrifuge tubes (Beckman)
  • Ti60 or Ti70 rotor and 26‐ml polycarbonate centrifuge tubes (Beckman)
  • Gradient maker
  • SW27 rotor and 32‐ml polyallomer or cellulose nitrate centrifuge tubes (Beckman)

Alternate Protocol 3: Monitoring the Position of the Ribosome on Globin mRNA

  • mRNA for globin or other gene of interest
  • 32P‐end‐labeled oligonucleotide primer: e.g., 5′‐TCACCACCAACTTCTTCCAC‐3′ for globin (5000 Ci/mmol), or primer appropriate to gene of interest
  • Micrococcal nuclease–treated rabbit reticulocyte lysate (Promega)
  • 1 M HEPES⋅KOH, pH 7.5
  • 100 and 500 mM Mg(CH 3COOH) 2
  • 100 mM dithiothreitol
  • 10 mM anisomycin
  • 10% and 35% (w/v) sucrose gradient solutions (see recipe)
  • 100 mM each dATP, dGTP, dCTP, dTTP
  • AMV reverse transcriptase
  • 1:1 (v/v) phenol/chloroform ( appendix 3A)
  • Ethanol
  • 3 M potassium acetate, pH 5.0
  • SW56 rotor and 5‐ml polyallomer centrifuge tubes (Beckman)
  • Additional reagents and equipment for DNA sequencing gels ( appendix 3A)

Support Protocol 2: Determination of Relative Sedimentation Coefficients Using Analytical Sucrose Gradients

  • 5% and 20% (w/v) sucrose gradient solutions in suitable buffer (e.g., 20 mM Tris⋅Cl, pH 7.5/100 mM KCl/1 mM dithiothreitol)
  • Protein standards in same buffer:
  •  10 mg/ml ovalbumin (3.55S)
  •  10 mg/ml alddase (7.8S)
  •  10 mg/ml catalase (11.2S)
  •  10 mg/ml β‐galactosidase (16.1S)
  • Unknown protein

Basic Protocol 2: Analysis of Translation in Cultured Cells

  Materials
  • 10% and 50% (w/v) sucrose gradient solutions (see recipe)
  • Cultured cells or yeast lysate (see protocol 9)
  • PBS ( appendix 2A) or other neutral, buffered isotonic solution
  • TMK 100 lysis buffer (see recipe), ice cold
  • Tris‐buffered, water‐saturated phenol: for buffering, use recipe 1 M Tris⋅Cl, pH 7.5 ( appendix 2A)
  • Chloroform
  • Ethanol
  • RNA‐loading buffer (see recipe)
  • Gradient maker
  • Refrigerated high‐speed centrifuge (e.g., Beckman L7‐55)
  • Swinging bucket rotor and appropriate tubes (e.g., Beckman SW28.1 rotor and 17‐ml tubes)
  • 15‐ml polyethylene tubes with caps
  • UV absorbance detector and chart recorder
  • Syringe or peristaltic pump
  • Fraction collector (e.g., ISCO model 640 gradient fractionator)
  • Water bath or heating block at 65°C
  • Additional reagents and equipment for analyzing RNA on agarose or acrylamide gels and for northern blotting ( appendix 3A)
NOTE: Experiments involving RNA require careful precautions to prevent contamination and RNA degradation (see appendix 2A).NOTE: All procedures are carried out on ice with solutions that have been precooled to 4°C.

Alternate Protocol 4: Purification of Ribosomal Complexes from Cultured Cells for Biochemical Assays

  • Cultured cell lysate ( protocol 7) or yeast lysate ( protocol 9)
  • 25% sucrose gradient solution (buffered as for 10% and 50% solutions in protocol 7)
  • TMK 100 lysis buffer (see recipe) without detergent
  • 22% (w/v) sucrose solution (see recipe)
  • Swinging bucket rotor and tubes (e.g., Beckman SW50.1 rotor and 5‐ml tubes)

Support Protocol 3: Preparation of Yeast Lysates

  Materials
  • Yeast culture
  • Breaking buffer (see recipe)
  • Dry acid‐washed glass beads (425‐ to 600‐µm; Sigma)
  • 1 mg/ml cyclohexamide
  • Spectrophotometer
  • Additional reagents and equipment for growing yeast (unit 1.6)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Anthony, D.D. and Merrick, W.C. 1992. Analysis of 40S and 80S complexes with mRNA as measured by sucrose density gradients and primer extension inhibition. J. Biol. Chem. 267:1623‐1632.
   Baim, S., Pietras, D., Eustice, D., and Sherman, F. 1985. A mutation allowing an mRNA secondary structure diminishes translation of Saccharomyces cerevisiae iso‐1‐cytochrome C. Mol. Cell. Biol. 5:839‐1846.
   Beckman Instruments. Rotors and Tubes for Preparative Ultracentrifuges. Beckman Instruments, Palo Alto, Calif.
   Benne, R. and Hershey, J.W.B. 1978. The mechanism of action of protein synthesis initiation factors from rabbit reticulocytes. J. Biol. Chem. 253:3078‐3087.
   Caruccio, N. and Ross, J. 1994. Purification of a human polyribosome‐associated 3′ to 5′ exoribonuclease. J. Biol. Chem. 269:31814‐31821.
   Grifo, J.A., Tahara, S.M., Morgan, M.A., Shatkin, A.J. and Merrick, W. C. 1983. New initiation factor activity required for globin mRNA translation. J. Biol. Chem. 258:5804‐5810.
   Hensold, J., Barth‐Baus, D. and Stratton, C. 1996. Inducers of erythroleukemic differentiation cause mRNAs that lack poly(A)‐binding protein to accumulate in translationally inactive, salt‐labile 80S ribosomal complexes. J. Biol. Chem. 271:23246‐23254.
   Hershey, J. 1991. Translational control in mammalian cells. Annu. Rev. Biochem. 60:717‐755.
   Jefferies, H., Reinhard, C., Kozma, S., Thomas, G. and 1994. Rapamycin selectively represses translation of the “polypyrimidine tract” mRNA family. Proc. Natl. Acad. Sci. U.S.A. 91:4441‐4445.
   Joshi, B., Yan, R. and Rhoads, R. 1994. In vitro synthesis of human protein synthesis initiation factor 4g and its localization on 43 and 48S initiation complexes. J. Biol. Chem. 269:2048‐2055.
   Kaspar, R. and Gehrke, L. 1994. Peripheral blood mononuclear cells stimulated with C5a or lipopolysaccharide to synthesize equivalent levels of IL‐1β mRNA show unequal IL‐1β protein accumulation but similar polyribosome profiles. J. Immunol 153:277‐286.
   Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680‐685.
   Martin, T. 1973. A simple general method to determine the proportion of active ribosomes in eukaryotic cells. Exp. Cell. Res. 80:496‐498.
   Martin, T. and Hartwell, L. 1970. Resistance of active yeast ribosomes to dissociation by KCl. J. Biol. Chem. 245:1504‐1508.
   McEwen, C.R. 1967. Tables for estimating sedimentation through linear concentration gradients of sucrose solution. Anal. Biochem. 20:114‐149.
   Merrick, W.C. 1979a. Purification of protein synthesis initiation factors from rabbit reticulocytes. Methods Enzymol. 60:101‐108.
   Merrick, W.C. 1979b. Assays for eukaryotic protein synthesis. Methods Enzymol. 60:108‐123.
   Merrick, W. 1992. Mechanism and regulation of eukaryotic protein synthesis. Microbiol. Rev. 56:291‐315.
   Merrick, W.C. Anderson, W.F. and 1975. Purification and characterization of homogeneous protein synthesis initiation factor M1 from rabbit reticulocytes. J. Biol. Chem. 250:1197‐1206.
   Moritz, M., Pulaski, B. and Woolford, J. 1991. Assembly of 60S ribosomal subunits is perturbed in temperature‐sensitive yeast mutants defective in ribosomal protein L16. Mol. Cell Biol. 11:5681‐5692.
   Nielsen, P. and Trachsel, H. 1988. The mouse protein synthesis initiation factor 4A gene family includes two related functional genes which are differentially expressed. EMBO J. 7:2097‐2105.
   Pelham, H.R.B. and Jackson, R.J. 1976. An efficient mRNA‐dependent translation system from rabbit reticulocyte lysates. Eur. J. BioChem. 67:247‐256.
   Peterson, D.T., Merrick, W.C. and Safer, B. 1979a. Binding and release of radiolabelled eukaryotic initiation factors 2 and 3 during 80S initiation complex formation. J. Biol. Chem. 254:2509‐2516.
   Peterson, D.T., Safer, B. and Merrick, W.C. 1979b. Role of eukaryotic initiation factor 5 in the formation of 80S initiation complexes. J. Biol. Chem. 254:7730‐7735.
   Proweller, A. and Butler, S. 1994. Efficient translation of poly(A)‐deficient mRNAs in Saccharomyces cerevisiae. Genes & Devel 8:2629‐2640.
   Proweller, A. and Butler, S. 1997. Ribosome concentration contributes to discrimination against poly(A)‐mRNA during translation initiation in Saccharomyces cerevisiae. J. Biol. Chem. 272:6004‐6010.
   Richter, N.J., Rogers, G., Hensold, J.O. and Merrick, W.C. 1999. Further biochemical and kinetic characterization of human eukaryotic initiation factor 4H. J. Biol. Chem. 274:35415‐35424.
   Rinker, Schaeffer C., Austin, V., Simmer, S. and Rhoads, R. 1992. Ras transformation of cloned rat embryo fibroblasts results in increased rates of protein synthesis and phosphorylation of eukaryotic initiation factor 4E. J. Biol. Chem. 267:2593‐2598.
   Rudland, P., de Asua, L.J. 1979. Action of growth factors in the cell cycle. Biochim. Biophys. Acta 560:91‐133.
   Safer, B., Jagus, R. and Kemper, W.M. 1979. Analysis of initiation factor function in highly fractionated and unfractionated reticulocyte lysate systems. Methods Enzymol 60:61‐87.
   Sonenberg, N. 1993. Translation factors as effectors of cell growth and tumorigenesis. Curr. Opin. Cell Biol 5:955‐960.
   Spirin, A. 1986. Ribosome Structure and Protein Biosynthesis. Benjamin/Cummings, Menlo Park, Calif.
   Steel, L. and Jacobson, A. 1987. Translational control of ribosomal protein synthesis during early Dictylostelium development. Mol. Cell. Biol. 7:965‐972.
   Warner, J., Knopf, P. and Rich, A. 1963. A multiple ribosome structure in protein synthesis. Proc. Natl. Acad. Sci. U.S.A. 49:122‐129.
   Zylber, E. and Penman, S. 1970. The effect of high ionic strength on monomers, polyribosomes and puromycin‐treated polyribosomes. Biochim. Biophys. Acta 204:221‐229.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library