Studies of the Ubiquitin Proteasome System

Kevin L. Lorick1, Yili Yang1, Jane P. Jensen1, Kazuhiro Iwai2, Allan. M. Weissman1

1 National Cancer Institute, Frederick, Maryland, 2 Osaka City University, Osaka
Publication Name:  Current Protocols in Cell Biology
Unit Number:  Unit 15.9
DOI:  10.1002/0471143030.cb1509s31
Online Posting Date:  July, 2006
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

A concept that has arisen over the last decade is that proteins can, in general, be covalently modified by polypeptides, resulting in alterations in their fate and function. The firstā€identified and most well studied of these modifying polypeptides is ubiquitin. Although targeting for proteasomal degradation is the best studied outcome of ubiquitylation, we now understand that modification of proteins with ubiquitin has numerous other cellular roles that alter protein function and that are unrelated to proteasomal degradation. Ubiquitylation is a complex process that is regulated at the level of both addition and removal of ubiquitin from target proteins. This unit includes a number of different basic protocols that will facilitate the study of components of the ubiquitin system and substrate ubiquitylation both in vitro and in cells. Because another protein modifier, NEDD8, itself regulates aspects of the ubiquitin system, basic protocols on neddylation are also included in this unit.

Keywords: Ubiquitin; ubiquitylation; proteasomal degradation; protein modification; NEDD8; E1; E2; E3

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Assays of E1 and E2 Activity
  • Basic Protocol 1: Thiolester Formation Between Rabbit E1 and Ubiquitin
  • Basic Protocol 2: Thiolester Formation Between E2 and Ubiquitin
  • Binding of Ubiquitin‐Proteasome Proteins
  • Basic Protocol 3: Binding of E2s to E3s
  • Alternate Protocol 1: Binding of Ubiquitin Substrates to E3s
  • In Vitro Ubiquitylation (E3) Assays
  • Basic Protocol 4: E3 Auto‐Ubiquitylation
  • Basic Protocol 5: Determination of Auto‐Ubiquitylation versus Pseudo‐Substrate Ubiquitylation
  • Basic Protocol 6: Ubiquitylation of E3 Enzymes Expressed in In Vitro Translation Systems
  • Alternate Protocol 2: Determination of Ubiquitin Chain Variant Phenotype
  • Basic Protocol 7: Chelation of Zinc from RING‐ and PHD‐Finger E3s
  • Alternate Protocol 3: Inhibition of HECT Domain E3s by Alkylation of Active‐Site Cysteines
  • Substrate Ubiquitylation in Vitro
  • Basic Protocol 8: Substrate Ubiquitylation in Solution
  • Alternate Protocol 4: Substrate Ubiquitylation After E3 Binding
  • Basic Protocol 9: Substrate Ubiquitylation by Multisubunit E3s
  • Basic Protocol 10: Detection of E3 Activity in Immunoprecipitated Protein
  • Alternate Protocol 5: Detection of Ubiquitin Modification of Substrates After GST Pull‐Down
  • Detection of Ubiquitylation in Vivo
  • Basic Protocol 11: Lysis and Immunoprecipitation of Ubiquitylated Protein
  • Alternate Protocol 6: Detection of Protein Ubiquitylation Using Tagged Ubiquitin
  • Inhibition of Ubiquitylation and Protein Degradation In Vivo
  • Basic Protocol 12: Use of Dominant Negative Ubiquitin Proteins in Cells
  • Alternate Protocol 7: Use of Small Interfering RNAs (siRNAs) to Reduce Expression of Ubiquitin‐Proteasome System Proteins in Cells
  • Basic Protocol 13: Localizing Degradation to the Proteasome
  • The NEDD8 Conjugation System
  • Basic Protocol 14: Purification of APP‐BP1/Uba3 Complex (E1 for NEDD8) Expressed Using the Baculovirus Expression System
  • Support Protocol 1: Batch Purification of APP‐BP1 and Uba3
  • Support Protocol 2: Column Purification of APP‐BP1 and Uba3
  • Basic Protocol 15: Production of Ubc12 and NEDD8 in Bacterial Expression Systems
  • Basic Protocol 16: In Vitro Neddylation
  • Labeling and Detection of Ubiquitin
  • Basic Protocol 17: Radiolabeling Ubiquitin with 32P
  • Alternate Protocol 8: Radiolabeling Ubiquitin with 125Iodine
  • Alternate Protocol 9: Labeling Ubiquitin with Nonradioactive Tag (Biotin)
  • Alternate Protocol 10: Generation of Tagged Ubiquitin Expression Plasmids
  • Basic Protocol 18: Immunoblotting with Anti‐Ubiquitin
  • Generation and Purification of Rabbit Anti‐Ubiquitin Antibodies
  • Basic Protocol 19: Generation and Purification of Anti‐Ubiquitin Antibodies
  • Support Protocol 3: Preparation of Ubiquitin Affinity Column
  • Generation of Reagent‐Grade Ubiquitin Activating Enzyme (E1)
  • Basic Protocol 20: Preparation of Wheat E1 in E. coli
  • Basic Protocol 21: Preparation of Mouse E1 in Insect Cells Using a Baculovirus System
  • Alternate Protocol 11: Preparation of Rabbit E1
  • Support Protocol 4: Generation of Empty Bacterial Lysates
  • Generation of Ubiquitin‐Conjugating Enzymes (E2s)
  • Basic Protocol 22: Expression of E2s in E. coli Without a Purification Tag
  • Alternate Protocol 12: Purification of E2s from E. coli Using an Affinity Tag
  • Alternate Protocol 13: Purification of E2s from E. coli Using Anti–Affinity Tag Antibodies
  • Basic Protocol 23: Expression of E2s with in Vitro Transcription and Translation Systems
  • In Vitro Production of Ubiquitin‐Protein Ligases (E3s)
  • Basic Protocol 24: Expression of Ring‐Finger E3s in Bacterial Lysates
  • Alternate Protocol 14: Expression of HECT and U‐Box E3s in Bacterial Lysates
  • Alternate Protocol 15: Expression of Unstable E3s in Bacterial Lysates
  • Basic Protocol 25: Expression of E3s in Eukaryotic in Vitro Translation Systems
  • Basic Protocol 26: Expression of Multi‐Subunit E3s Using a Baculovirus Expression System
  • Support Protocol 5: Batch Purification of Multimeric E3s
  • Support Protocol 6: Column Purification of Multimeric E3s
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Thiolester Formation Between Rabbit E1 and Ubiquitin

  Materials
  • E1: rabbit E1 (Calbiochem, Boston Biochem, Affiniti), bacterially expressed wheat E1 ( protocol 33), or mouse E1 ( protocol 34)
  • 100 mM HEPES, pH 7.5
  • 10× thiolester buffer (see recipe)
  • [32P]ubiquitin ( protocol 26) or 10 µg/µl “cold” (unlabeled) ubiquitin (Sigma) for immunoblot detection
  • 4× nonreducing SDS‐PAGE sample buffer (see recipe)
  • 4× reducing SDS‐PAGE sample buffer (see recipe)
  • 6% to 8% SDS‐PAGE minigels (unit 6.1)
  • Anti‐ubiquitin antibody ( protocol 31; for immunoblot detection)
  • Boiling water bath
  • Additional reagents and equipment for SDS‐PAGE (unit 6.1) and autoradiography (unit 6.3) or immunoblotting ( protocol 30)

Basic Protocol 2: Thiolester Formation Between E2 and Ubiquitin

  Materials
  • E1: rabbit E1 (Calbiochem, Boston Biochem, Affiniti,), bacterially expressed wheat E1 ( protocol 33), or mouse E1 ( protocol 34)
  • 100 mM HEPES, pH 7.5
  • E2: crude (Basic Protocol protocol 3722 or protocol 4023) or purified ( protocol 38 or protocol 3913) or commercially available
  • 10× thiolester buffer (see recipe)
  • [32P]ubiquitin ( protocol 26)
  • 4× nonreducing SDS‐PAGE sample buffer (see recipe)
  • 4× reducing SDS‐PAGE sample buffer (see recipe)
  • 18% to 20% SDS‐PAGE minigels (unit 6.1)
  • Anti‐ubiquitin antibody ( protocol 31; optional)
  • Boiling water bath
  • Additional reagents and equipment for SDS‐PAGE (unit 6.1) and autoradiography (unit 6.3) or immunoblotting ( protocol 30)

Basic Protocol 3: Binding of E2s to E3s

  Materials
  • E3 or other putative E2 binding site of interest expressed as a GST fusion protein (see protocol 41 and Alternate Protocols protocol 4214 and protocol 4315)
  • Glutathione‐Sepharose 4B beads (50% slurry; GE Healthcare)
  • Phosphate‐buffered saline (PBS; see recipe), 4°C
  • Binding buffer (see recipe), 4°C
  • Purified native E2 (see Alternate Protocols protocol 3812 and protocol 3913; for detection by Coomassie blue staining or immunoblotting), E2 fusion with GST, His or other tag (Wu et al., ; for detection by Coomassie blue staining or immunoblotting), or35S‐labeled E2 (see protocol 40; for detection by autoradiography)
  • 4× nonreducing SDS‐PAGE sample buffer (see recipe)
  • 4× reducing SDS‐PAGE sample buffer (see recipe)
  • 18% to 20% SDS‐PAGE minigels (unit 6.1)
  • 10% (v/v) acetic acid/25% methanol
  • Anti‐E2 or anti‐tag antibody (Calbiochem, Boston Biochem, Affinity; for immunoblotting)
  • End‐over‐end rotator
  • Boiling water bath
  • Gel densitometer
  • Additional reagents and equipment for Coomassie blue staining (unit 6.6), autoradiography and phospher imaging (unit 6.3), or immunoblotting (unit 6.2)

Alternate Protocol 1: Binding of Ubiquitin Substrates to E3s

  • In vitro–translated 35S‐labeled substrate protein ( protocol 44)
  • 50 mM MG132 (Calbiochem, Boston Biochem, or Biomol) in DMSO
  • 10% (v/v) acetic acid/25% (v/v) methanol

Basic Protocol 4: E3 Auto‐Ubiquitylation

  Materials
  • Glutathione‐Sepharose (GS) beads (GE Healthcare)
  • 50 mM Tris⋅Cl, pH 7.5 ( appendix 2A)
  • Putative E3 expressed as a GST fusion in bacteria (GST‐E3; protocol 44)
  • Empty bacterial lysate ( protocol 36)
  • Wheat E1 ( protocol 33), mouse E1 ( protocol 34), or rabbit E1 (Calbiochem)
  • E2 ( protocol 37)
  • 10× PCK (see recipe)
  • 10× ubiquitylation buffer 1 (see recipe)
  • [32P]ubiquitin ( protocol 26)
  • 50 mM Tris⋅Cl, pH 7.5 ( appendix 2A)
  • 4× reducing SDS‐PAGE sample buffer (see recipe)
  • 10% (v/v) acetic acid/25% methanol
  • 30°C Thermomixer (Eppendorf), or other heated shaker
  • Boiling water bath
  • Additional reagents and equipment for SDS‐PAGE (unit 6.1) and autoradiography (unit 6.3)

Basic Protocol 5: Determination of Auto‐Ubiquitylation versus Pseudo‐Substrate Ubiquitylation

  Materials
  • Putative E3 expressed as a GST fusion in bacteria ( protocol 44)
  • Glutathione‐Sepharose (GS) beads (GE Healthcare)
  • Empty bacterial lysate ( protocol 36)
  • Wheat E1 ( protocol 33), mouse E1 ( protocol 34), or rabbit E1 (Calbiochem)
  • E2 ( protocol 37)
  • 10× PCK (see recipe)
  • 10× ubiquitylation buffer 1 (see recipe)
  • [32P]ubiquitin ( protocol 26)
  • 50 mM Tris⋅Cl, pH 7.5
  • 20× thrombin stock solution (see recipe)
  • Phosphate‐buffered saline (PBS; see recipe)
  • Ubiquitylation buffer 2 for E3 assays (see recipe; optional)
  • Thermomixer, or other heated shaker
  • Additional reagents and equipment for in vitro ubiquitylation ( protocol 6), SDS‐PAGE (unit 6.1), and autoradiography (unit 6.3).

Basic Protocol 6: Ubiquitylation of E3 Enzymes Expressed in In Vitro Translation Systems

  Materials
  • 50 mM MG132 (Calbiochem, Boston Biochem, or BioMol) in DMSO
  • 30 µM ubiquitin aldehyde (Calbiochem, Boston Biochem, or BioMol) in 1 M HEPES, pH 8.0
  • 50 ng/µl E1 (Basic Protocols protocol 3421 and protocol 3722)
  • 50 ng/µl E2 (e.g., Ube2d2/UbcH5B; protocol 37)
  • 10× PCK (see recipe)
  • 10× ubiquitylation buffer 1 (see recipe) or 20× ubiquitylation buffer 2 for E3 assays (see recipe)
  • 10 mg/ml ubiquitin (Sigma)
  • Suspected E3 protein, expressed with 35S label in reticulocyte or wheat germ lysates (25,000 to 100,000 cpm; protocol 40)
  • 4× reducing SDS sample buffer (see recipe)
  • 10% (v/v) acetic acid/25% methanol
  • 30°C Thermomixer (Eppendorf), or other heated shaker
  • Additional reagents and equipment for SDS‐PAGE (unit 6.1) and autoradiography (unit 6.3)

Alternate Protocol 2: Determination of Ubiquitin Chain Variant Phenotype

  • 20× ubiquitylation buffer 2 for E3 assays (see recipe)
  • Mutant ubiquitins: lysine‐less (K0), K48R, K63R, K48 only, K63 only (BioMol, Boston Biochem, or made in house)
  • Wild‐type ubiquitin as reference
  • Additional reagents and equipment for anti‐ubiquitin immunoblotting ( protocol 30)

Basic Protocol 7: Chelation of Zinc from RING‐ and PHD‐Finger E3s

  Materials
  • Putative E3 expressed as a GST fusion in bacteria ( protocol 41).
  • Glutathione‐Sepharose (GS) beads (GE Healthcare)
  • 50 mM Tris⋅Cl, pH 7.5 ( appendix 2A)
  • Zinc chelating agents (Sigma): 5 to 10 mM EDTA, 5 to 10 mM EGTA, 5 to 10 mM DTPA, 1 to 5 mM TPEN, or 1 to 5 mM o‐phenanthroline in 50 mM Tris⋅Cl, pH 7.5
  • 5 mM ZnCl 2
  • Wheat E1 ( protocol 33), mouse E1 ( protocol 34), or rabbit E1 (Calbiochem)
  • E2 ( protocol 37)
  • Empty bacterial lysate ( protocol 36)
  • 10× PCK (see recipe)
  • 10× ubiquitylation buffer 1 (see recipe)
  • [32P]ubiquitin ( protocol 26)
  • 4× reducing SDS‐PAGE sample buffer (see recipe)
  • End‐over‐end rotator
  • Gel‐loading pipet tips
  • 30°C Thermomixer (Eppendorf), or other heated shaker
  • Additional reagents and equipment for SDS‐PAGE (unit 6.1) and autoradiography (unit 6.3)

Alternate Protocol 3: Inhibition of HECT Domain E3s by Alkylation of Active‐Site Cysteines

  • Alkylating agents: 10 mM iodoacetamide (IAA) or 5 mM N‐ethylmaleamide (NEM) in Tris⋅Cl, pH 7.5 (see appendix 2A for buffer)
  • Additional reagents and equipment for SDS‐PAGE (unit 6.1) and autoradiography (unit 6.3) or immunoblotting (unit 6.2)

Basic Protocol 8: Substrate Ubiquitylation in Solution

  Materials
  • 50 µM MG132 (Calbiochem, Boston Biochem, or Biomol) in DMSO
  • 30 µM ubiquitin aldehyde (Calbiochem, Boston Biochem, or BioMol) in 1 M HEPES, pH 8.0
  • 50 ng/µl E1 ( protocol 33 or protocol 3421)
  • 50 ng/µl E2 ( protocol 37 or protocol 4023)
  • 10× PCK (see recipe)
  • 10× ubiquitylation buffer 1 (see recipe)
  • 10 mg/ml ubiquitin
  • Substrate, expressed with 35S‐label in reticulocyte or wheat germ lysates (25,000 to 100,000 cpm; see protocol 40)
  • E3, expressed as a GST fusion in bacteria ( protocol 41)
  • 4× reducing SDS‐PAGE sample buffer (see recipe)
  • 20× ubiquitylation buffer 2 for E3 assays (see recipe; optional)
  • 30°C Thermomixer (Eppendorf), or other heated shaker
  • Boiling water bath
  • Additional reagents and equipment for SDS‐PAGE (unit 6.1) and autoradiography (unit 6.3)

Alternate Protocol 4: Substrate Ubiquitylation After E3 Binding

  • Glutathione‐Sepharose (GS) beads (GE Healthcare)
  • 50 mM Tris⋅Cl, pH 7.5 ( appendix 2A)
  • Binding buffer (see recipe)
  • 1× SDS‐PAGE sample buffer: 4× sample buffer (see recipe) diluted to 1× with binding buffer (see recipe)
  • End‐over‐end rotator
  • 30°C Thermomixer (Eppendorf), or other heated shaker

Basic Protocol 9: Substrate Ubiquitylation by Multisubunit E3s

  Materials
  • VBC‐Cul2 E3 protein complex expressed and purified using baculoviral expression system ( protocol 45)
  • Mouse E1 ( protocol 34)
  • E2‐UbcH5B ( protocol 37)
  • GST‐ubiquitin ( protocol 29)
  • Human APP‐BP1/Uba3 (NEDD8 E1; protocol 21)
  • Ubc12 (E2 for NEDD8), expressed and purified by using bacterial expression system ( protocol 24)
  • NEDD8, expressed and purified by using bacterial expression system ( protocol 24)
  • MBP‐HIF2α‐ODD (Megumi et al., 2005) expressed and purified by using bacterial expression system
  • His 6‐EGLN3 (proline hydroxylases of HIF‐α; Megumi et al., 2005), expressed and purified by using bacterial expression system (note that this is necessary for proline hydroxylation of MBP‐ODD)
  • 10× ATP and ATP‐regenerating system (see recipe)
  • 10× ubiquitylation buffer 2 for multisubunit E3s and neddylation (see recipe)
  • 40 mM sodium 2‐oxoglutarate (α‐ketoglutarate, sodium salt; Sigma)
  • 40 mM ascorbic acid (Sigma)
  • Anti‐MBP antibody (Santa Cruz Biotechnology)
  • Boiling water bath
  • Thermomixer, or other heated shaker
  • Additional reagents and equipment for SDS‐PAGE (unit 6.1) and immunoblotting (unit 6.2)

Basic Protocol 10: Detection of E3 Activity in Immunoprecipitated Protein

  Materials
  • Adherent cells expressing the substrate protein and E3 of interest (e.g., U2OS cells for p53 and MDM2), growing in 100‐mm dishes
  • 50 mM MG132 (Calbiochem, Boston Biochem, or Biomol) in DMSO or other proteasome inhibitor (e.g., lactacystin; Calbiochem or Biomol)
  • Phosphate‐buffered saline (PBS; see recipe)
  • Nondenaturing Triton X‐100 lysis buffer (see recipe) containing 1× phosphatase inhibitors and 50 µM MG132 (or lactacystin)
  • Anti‐E3 or anti‐substrate antibody
  • Nondenaturing Triton X‐100 wash buffer (see recipe)
  • Tris‐buffered saline (TBS; appendix 2A; optional)
  • 30 µM ubiquitin aldehyde (Calbiochem, Boston Biochem, or BioMol) in 1 M HEPES, pH 8.0
  • E1: rabbit (Calbiochem, Boston Biochem, Affiniti,), bacterially expressed wheat E1 ( protocol 33), or mouse E1 ( protocol 34)
  • E2: crude ( protocol 37 or protocol 4023) or purified ( protocol 38 or protocol 3913)
  • 20× ubiquitin buffer 2 for E3 assays (see recipe)
  • 10 mg/ml ubiquitin
  • 4× reducing sample buffer
  • 30°C Thermomixer (Eppendorf), or other heated shaker
  • Boiling water bath
  • Additional reagents and equipment for cell culture (unit 1.1), immunoprecipitation (unit 7.2), SDS‐PAGE (unit 6.1) and immunoblotting (unit 6.2)

Alternate Protocol 5: Detection of Ubiquitin Modification of Substrates After GST Pull‐Down

  • Glutathione‐Sepharose (GS) beads (GE Healthcare)
  • 50 mM Tris⋅Cl, pH 7.5 ( appendix 2A)
  • End‐over‐end rotator

Basic Protocol 11: Lysis and Immunoprecipitation of Ubiquitylated Protein

  Materials
  • Protein A–Sepharose CL‐4B beads (50% slurry; GE Healthcare)
  • Tris‐buffered saline (TBS; appendix 2A), 4°C
  • Specific antibody for the protein of interest and isotype‐matched control antibody, e.g., irrelevant or preimmune serum, purified
  • Tris‐buffered saline/Tween 20 (TBST; see recipe), 4°C
  • Cells growing in culture (unit 1.1)
  • Phosphate‐buffered saline (PBS; see recipe), ice cold
  • Nondenaturing Triton X‐100 lysis buffer (see recipe), ice cold
  • 2× reducing SDS‐PAGE sample buffer (see recipe for 4×)
  • Anti–specific antigen antibody
  • Anti‐ubiquitin antibody
  • End‐over‐end rotator
  • Boiling water bath
  • Additional reagents and equipment for SDS‐PAGE (unit 6.1) and immunoblotting ( protocol 30 and unit 6.2)

Alternate Protocol 6: Detection of Protein Ubiquitylation Using Tagged Ubiquitin

  • Cells to be transfected
  • 1 M CaCl 2
  • Mammalian expression plasmid for ubiquitin fused to FLAG, HA, His 6, myc‐tag, GFP, or GST tag ( protocol 29, or obtained by request from other investigators)
  • Transfection efficiency control plasmid, e.g., GFP, RFP, β‐galactosidase
  • 2× HEPES‐buffered saline (HeBS; see recipe)
  • Anti– tag epitope antibody or anti‐substrate antibody (e.g., Sigma for anti‐FLAG; Santa Cruz‐ Biotechnology for other antibodies)
  • 6‐well tissue culture plates
  • Boiling water bath
  • Additional reagents and equipment for cell culture (unit 1.1)

Basic Protocol 12: Use of Dominant Negative Ubiquitin Proteins in Cells

  Materials
  • Expression plasmids for mutant and wild‐type E2 or E3
  • Cultured cells to be transfected (e.g., U2OS or 293T)
  • Nondenaturing Triton X‐100 lysis buffer (see recipe), ice cold
  • Specific antibody to the protein of interest and matched control antibody, e.g., irrelevant antibody or serum from unimmunized rabbits
  • Antibodies to mutated/wild‐type protein or substrate or ubiquitin
  • Additional reagents and equipment for transfection ( protocol 17), SDS‐PAGE (unit 6.1), immunoblotting (unit 6.2), and immunoprecipitation ( protocol 16)

Alternate Protocol 7: Use of Small Interfering RNAs (siRNAs) to Reduce Expression of Ubiquitin‐Proteasome System Proteins in Cells

  Materials
  • Cultured cells to be transfected (e.g., U2OS or 293T)
  • Inhibitors (Calbiochem, Boston Biochem, Biomol):
    • Calpain inhibitor I (CPI, also known as LlnL or ALLN), soluble in DMSO
    • Calpain inhibitor II (CPII, also known as ALLM), soluble in DMSO
    • MG132, soluble in DMSO
    • Lactacystin, soluble in DMSO or water, but unstable in H 2O
    • NH 4Cl in H 2O
  • Nondenaturing Triton X‐100 lysis buffer (see recipe)
  • 4× reducing SDS‐PAGE sample buffer (see recipe)
  • Specific antibody against protein of interest
  • 6‐well tissue culture dishes
  • Additional reagents and equipment for cell culture (unit 1.1), SDS‐PAGE (unit 6.1), and immunoblotting (unit 6.2)

Basic Protocol 13: Localizing Degradation to the Proteasome

  Materials
  • Sf9 cells or Sf21 cells (Invitrogen)
  • Complete Grace's insect medium (see recipe)
  • cDNAs encoding APP‐BP1 and Uba3
  • Baculovirus transfer vectors (see Murphy et al., 2004)
  • Hypotonic lysis buffer (see recipe)
  • 1 M imidazole, pH 7.5 (adjusted with HCl)
  • Ni‐NTA beads (50% slurry; Qiagen)
  • 25‐cm2 culture flasks (Nunc) or 100‐mm tissue culture dishes
  • 27°C incubator without enhanced CO 2
  • 175‐cm2 tissue culture flasks
  • 15‐ml centrifuge tubes
  • Refrigerated centrifuge
  • 15‐ml Dounce homogenizer with tight‐fitting pestle
  • 15‐ml and 50‐ml centrifuge tubes
  • Additional reagents and equipment for maintenance of insect cell cultures and generation of recombinant baculovirus (Murphy et al., 2004) and batch ( protocol 22) or column ( protocol 23) purification of APP‐BP1 and Uba3

Basic Protocol 14: Purification of APP‐BP1/Uba3 Complex (E1 for NEDD8) Expressed Using the Baculovirus Expression System

  Materials
  • NEDD8 E1 on Ni‐NTA agarose beads ( protocol 21)
  • Wash buffer 1 for His 6‐tagged proteins (see recipe)
  • Wash buffer 2 for His 6‐tagged proteins (see recipe)
  • Elution buffer for His 6‐tagged proteins (see recipe)
  • Dialysis buffer (see recipe; include DTT)
  • Glycerol
  • Refrigerated centrifuge
  • 1.5‐ml screw‐cap microcentrifuge tubes
  • End‐over‐end rotator
  • 8000‐MWCO dialysis membrane
  • Additional reagents and equipment for dialysis ( appendix 3C)
NOTE: Perform all steps at 4°C.

Support Protocol 1: Batch Purification of APP‐BP1 and Uba3

  Materials
  • NEDD8 E1 on Ni‐NTA agarose beads ( protocol 21)
  • Wash buffer 1 for His 6‐tagged proteins (see recipe)
  • Wash buffer 2 for His 6‐tagged proteins (see recipe)
  • Elution buffer for His 6‐tagged proteins (see recipe)
  • Dialysis buffer for ubiquitylating and neddylating enzymes (see recipe; include DTT)
  • Glycerol
  • 2‐ml Poly‐Prep disposable chromatography column (Bio‐Rad)
  • 8000‐MWCO dialysis membrane
  • Additional reagents and equipment for dialysis ( appendix 3C)
NOTE: Perform all steps at 4°C.

Support Protocol 2: Column Purification of APP‐BP1 and Uba3

  Materials
  • Ubc12 or NEDD8 plasmids (Kawakami et al., 2001)
  • E. coli strain BL21(DE3) (Invitrogen)
  • 2×YT + G medium (see recipe) with 50 µg/ml ampicillin
  • 1 M IPTG (dissolve 1 g IPTG in 4.2 ml H 2O; store at −20°C)
  • Sonication buffer (see recipe) or Ni‐NTA purification buffer (see recipe)
  • Liquid N 2
  • 1 M imidazole, pH 7.5 (adjusted with HCl)
  • Ni‐NTA beads (Qiagen)
  • Wash buffer 1 for His 6‐tagged proteins (see recipe)
  • Wash buffer 2 for His 6‐tagged proteins (see recipe)
  • Elution buffer for His 6‐tagged proteins (see recipe)
  • Dialysis buffer for ubiquitylating and neddylating enzymes (see recipe; include DTT)
  • Glycerol
  • 37°C shaking incubator or water bath
  • Refrigerated centrifuge
  • Probe sonicator
  • 15‐ml centrifuge tubes
  • End‐over‐end rotator
  • Screw‐cap 1.5‐ml microcentrifuge tubes
  • 8000‐MWCO dialysis membrane
  • Additional reagents and equipment for transforming bacteria with plasmids (Seidman et al., 1997) and dialysis ( appendix 3C)

Basic Protocol 15: Production of Ubc12 and NEDD8 in Bacterial Expression Systems

  Materials
  • VBC‐Cul2 E3 protein complex expressed and purified by using baculoviral expression system ( protocol 21)
  • Human APP‐BP1/Uba3 (NEDD8 E1), expressed and purified by using baculoviral expression system ( protocol 21)
  • Ubc12 (E2 for NEDD8; protocol 24)
  • NEDD8 ( protocol 25)
  • 10× ATP and ATP‐regenerating system (see recipe)
  • 10× ubiquitylation buffer 2 for E3s and neddylation (see recipe)
  • 4× nonreducing SDS‐PAGE sample buffer (see recipe)
  • Antibody to detect Cul2 (e.g., anti‐myc antibody; Covance)
  • 37°C Thermomixer (Eppendorf), or other heated shaker
  • Boiling water bath
  • Additional reagents and equipment for SDS‐PAGE (unit 6.1) and immunoblotting (unit 6.2)

Basic Protocol 16: In Vitro Neddylation

  Materials
  • E. coli BL21(DE3) or other protease‐deficient bacterial strain (Novagen or Invitrogen)
  • pGEX‐2TK‐ubiquitin plasmid (purchase from GE Healthcare or prepare in house as in protocol 29)
  • 1 M IPTG (dissolve 1 g IPTG in 4.2 ml H 2O, store at −20°C)
  • Sonication buffer (see recipe)
  • Glutathione‐Sepharose beads (GE Healthcare)
  • Phosphate‐buffered saline (PBS; see recipe)
  • 4× reducing SDS‐PAGE sample buffer (see recipe)
  • 12% SDS‐PAGE gel (unit 6.1)
  • 10× kinase buffer (see recipe)
  • Protein kinase A catalytic subunit from bovine heart (259 U; Sigma), resuspend lyophilized powder in 25 µl of 40 mM DTT on ice, allow to solubilize 15 min; prepare fresh
  • [γ‐32P]ATP (GE Healthcare) 6000 Ci/mmol
  • 20× thrombin stock solution (see recipe)
  • Benzamidine‐Sepharose (GE Healthcare)
  • Eco‐Scint A (National Diagnostics)
  • Elution buffer for GST proteins (see recipe)
  • Refrigerated centrifuge and centrifuge bottles
  • Probe sonicator (e.g., Misonix Sonicator 3000)
  • Refrigerated centrifuge
  • Platform shaker
  • End‐over‐end rotator
  • Nitrocellulose filter circles
  • 4‐ml scintillation vials
  • β scintillation counter
  • Additional reagents and equipment for transforming bacteria with plasmids (Seidman et al., 1997), SDS‐PAGE (unit 6.1), and staining of gels with Coomassie blue (unit 6.6)

Basic Protocol 17: Radiolabeling Ubiquitin with 32P

  Materials
  • 20 mg/ml bovine ubiquitin (Sigma‐Aldrich) in coupling buffer
  • Coupling buffer: 50 mM sodium borate, pH 8.5
  • 10 mg/ml Sulfo‐NHS‐LC‐Biotin (Pierce) in coupling buffer (prepare immediately prior to use)
  • 1 M Tris Cl, pH 8.5 ( appendix 2A)
  • 20 mM Tris Cl, pH 7.4 ( appendix 2A)
  • PD‐10 column prepacked with Sephadex G‐25 medium (GE Healthcare)
  • 2000‐MWCO dialysis membrane

Alternate Protocol 8: Radiolabeling Ubiquitin with 125Iodine

  Materials
  • Whole RNA from any eukaryote, or total yeast DNA
  • Primer for reverse transcription (if starting with whole eukaryotic RNA): RT 3′ reverse: ATATAGAATTCCTATCCTCCTCTCAGGCGAAGGACCAGGT 3′ (synthesized at 100 nM scale, and desalted, by IDT, http://www.idtdna.com, Invitrogen, or similar oligonucleotide synthesis facility)
  • Kit for first‐stand cDNA synthesis (e.g., RT‐PCR kit; Fermentas)
  • Kit for PCR amplification of DNA (e.g., RT‐PCR kit, Fermentas, or Ready‐To‐Go PCR beads, GE Healthcare)
  • Primers for PCR:
    • 5′ forward: ATATAGGATCCCAGATCTTCGTGAAGACCCT
    • 3′ reverse: ATATAGAATTCCTATCCTCCTCTCAGGCGAAGGACCAGGT
  • QIAquick PCR Purification Kit (Qiagen)
  • BamHI and EcoR1 restriction endonucleases and 10× EcoRI buffer
  • pGEX‐2TK vector (GE Healthcare)
  • 1% agarose gels with and without ethidium bromide (Voytas, )
  • Molecular weight markers
  • Calf intestinal alkaline phosphatase (CIAP; Roche)
  • QIAquick Gel Extraction Kit (Qiagen)
  • T4 DNA ligase kit (Takara)
  • TOP10 chemically competent E. coli strain DH5α (Invitrogen) or other suitable host bacterial strain
  • SOC medium (Digene)
  • LB medium ( appendix 2A) with ampicillin
  • 100‐mm LB agar plates containing 100 µg/ml ampicillin ( appendix 2A)
  • Ready‐To‐Go PCR kit (containing PCR tubes premixed PCR reagents; GE Healthcare)
  • DNA size markers
  • 14°, 42°C. 56° and 65°C water baths
  • 96‐well microtiter plate
  • 15‐ml snap‐cap culture tubes (e.g., Falcon 2059)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ), transformation of bacteria (Seidman et al., 1997), DNA minipreps (Engebrecht et al., ), and DNA sequencing (Chapter 7 in Ausubel et al., 2006)

Alternate Protocol 9: Labeling Ubiquitin with Nonradioactive Tag (Biotin)

  Materials
  • Protein samples to be analyzed
  • 0.5% (v/v) glutaraldehyde (Sigma) in 0.1 M sodium phosphate, pH 7.0 ( appendix 2A)
  • Phosphate‐buffered saline (PBS; see recipe)
  • TBST/BSA (see recipe for TBST)
  • 1.5 µg/ml polyclonal rabbit anti‐ubiquitin (commercially available or prepared as in protocol 31) or monoclonal anti‐ubiquitin in TBST/BSA
  • TBST buffer (see recipe)
  • [125I]protein A (MP Biomedicals Life Science Division, or see recipe) or HRP‐conjugated anti–rabbit Ig and chemiluminescent detection reagents (SuperSignal West Pico, Pierce, or ECL Plus, GE Healthcare)
  • Biomax MR film (Kodak)
  • Additional reagents and equipment for SDS‐PAGE (unit 6.1), blotting from gels to PDVF or nitrocellulose membranes (unit 6.2), and autoradiography (unit 6.3)

Alternate Protocol 10: Generation of Tagged Ubiquitin Expression Plasmids

  Materials
  • Chicken albumin or ovalbumin, KLH, or other suitable hapten
  • Ubiquitin (from bovine erythrocytes; Sigma)
  • 0.1 M potassium phosphate buffer, pH 7.0 ( appendix 2A)
  • 3% (v/v) glutaraldehyde in potassium phosphate buffer, pH 7.0
  • Phosphate buffered saline (PBS; see recipe)
  • 10% (w/v) SDS
  • Rabbits
  • Complete Freund's adjuvant (CFA, Sigma)
  • Incomplete Freund's adjuvant (IFA, Sigma)
  • Sodium azide
  • Ubiquitin‐agarose affinity column (see protocol 32)
  • 0.2 M glycine, pH 2.7
  • 2 M Tris base
  • PBS (see recipe) containing 0.02% (w/v) sodium azide
  • 1 M KCl
  • 15‐ml tube
  • 10,000‐MWCO dialysis membrane
  • 90°C water bath
  • Tabletop and refrigerated centrifuges
  • Additional reagents and equipment for preparing antigens with adjuvants (unit 16.1), immunoblotting ( protocol 30), and dialysis ( appendix 3C)

Basic Protocol 18: Immunoblotting with Anti‐Ubiquitin

  Materials
  • Affi‐Gel‐10 slurry (Bio‐Rad)
  • 4 mg/ml ubiquitin (Sigma) in 0.1 M NaHCO 3/0.5 M NaCl, pH 8.0
  • 1 M ethanolamine, pH 8.0
  • 0.2 M glycine, pH 4.0 (adjusted with HCl)
  • Phosphate‐buffered saline (PBS; see recipe)
  • 1 M KCl
  • 1% (w/v) sodium azide
  • Fritted‐glass filter, coarse
  • 50‐ml conical centrifuge tubes

Basic Protocol 19: Generation and Purification of Anti‐Ubiquitin Antibodies

  Materials
  • pET E1 plasmid (request from R. Vierstra, University of Wisconsin at Madison, or A. Weissman)
  • E. coli strain BL21 transformation‐competent bacteria (Novagen)
  • SOC medium (Digene)
  • LB plates ( appendix 2A) containing the appropriate selection antibiotic
  • LB medium ( appendix 2A) containing the appropriate selection antibiotic
  • 1 M IPTG (dissolve 1 g IPTG in 4.2 ml water; store at −20°C)
  • Sonication buffer (see recipe)
  • E2 of choice
  • 42°C water bath
  • Platform shaker
  • Refrigerated centrifuge
  • Probe sonicator (e.g., Misonix Sonicator 3000)

Support Protocol 3: Preparation of Ubiquitin Affinity Column

  Materials
  • Sf9 cells (Invitrogen)
  • Complete Grace's insect medium (see recipe)
  • Baculovirus (AcMNPV) stock encoding His 6‐tagged E1, recently titered
  • Baculovirus lysis buffer 2 (see recipe)
  • 5% (w/v) agarose (SeaKem from FMC or Baculovirus Agarose from Invitrogen) in H 2O
  • Grace's insect medium (Invitrogen), serum free
  • 1% (w/v) neutral red (Sigma)
  • 175‐cm2 tissue culture flasks and 60‐mm tissue culture dishes, plus other appropriate tissue culture vessels (Table 15.9.2)
  • 50‐ml conical polypropylene centrifuge tubes
  • 60°C and 47°C water baths
  • Refrigerated centrifuge
  • Probe sonicator (e.g., Misonix Sonicator 3000)
  • Additional reagents and equipment for maintenance of insect cell cultures and generation of recombinant baculovirus (Murphy et al., 2004)

Basic Protocol 20: Preparation of Wheat E1 in E. coli

  • PET3a, pET15b or other vector for expression of proteins in E. coli from a T7 promoter but without a protein sequence

Basic Protocol 21: Preparation of Mouse E1 in Insect Cells Using a Baculovirus System

  Materials
  • pET expression vector (Novagen) containing cDNA for E2 of interest
  • Additional reagents and equipment for transforming bacteria with pET plasmid and preparing crude lysates of bacteria ( protocol 33), purification of E2 ( protocol 38 or protocol 3913), and testing E2 activity ( protocol 2)

Alternate Protocol 11: Preparation of Rabbit E1

  Materials
  • Affinity matrix (Ni‐NTA agarose from Qiagen; Talon from Clontech; or equivalent product from Invitrogen)
  • 50 mM sodium phosphate, pH 8.0 ( appendix 2A)
  • Bacterial lysate containing E2 protein ( protocol 37)
  • 1 M imidazole, pH 7.5 (adjusted with HCl)
  • Wash buffer 1 for His 6‐tagged proteins (see recipe)
  • Elution buffer for His 6‐tagged proteins (see recipe)
  • Dialysis buffer for ubiquitylating and neddylating enzymes (see recipe)
  • Glycerol
  • 3500‐MWCO dialysis membrane
  • Additional reagents and equipment for dialysis ( appendix 3C) and testing E2 activity

Support Protocol 4: Generation of Empty Bacterial Lysates

  Materials
  • Antibody‐agarose conjugates (Santa Cruz Biotechnology; 50% w/v slurry)
  • 50 mM sodium phosphate, pH 7.0
  • Bacterial lysate containing E2 protein ( protocol 37)
  • 50 mM Tris⋅Cl, pH 7.4 ( appendix 2A)
  • 200 mM glycine, pH 2.8
  • 1 M Tris base
  • Dialysis buffer (see recipe)
  • Glycerol
  • 0.1 M NaOH (optional)
  • 20% ethanol or 50 mM sodium phosphate (pH 7.0)/0.02% (w/v) sodium azide (optional)
  • 3500‐MWCO dialysis membrane
  • Additional reagents and equipment for dialysis ( appendix 3C) and testing E2 activity ( protocol 2)

Basic Protocol 22: Expression of E2s in E. coli Without a Purification Tag

  Materials
  • 10× transcription buffer (Promega)
  • 20 to 40 U/µl ribonuclease inhibitor (e.g., RNasin; Promega)
  • 10 mM NTP mix (10 mM each ATP, CTP, GTP, UTP; Promega)
  • 0.5 + 2µg/µl plasmid vector containing cDNA for E2 of interest under the control of a bacteriophage RNA polymerase, e.g., T7, SP6, or T3 (Promega)10 to 20 U/µl RNA polymerase appropriate to vector (SP6, T3, or T7)
  • 0.7% agarose gel in MOPS‐formaldehyde (optional; Brown et al., 2004)
  • 10× in vitro translation (IVT) buffer (Promega)
  • Rabbit reticulocyte lysate or wheat germ extract (Promega)
  • Amino acid mixture (Promega) lacking methionine (−Met), cysteine (−Cys) or lysine (−Lys) depending on amino acid of choice for radiolabeling
  • 50 mM MG132 (Calbiochem, Boston Biochem, or Biomol) in DMSO
  • 15 µCi/µl [35S]methionine, [35S]cysteine, or [15N]lysine (1000 Ci/mmol, NEN)
  • 10% (w/v) trichloroacetic acid (TCA; Sigma), cold
  • EcoScint scintillation fluid (National Diagnostics)
  • 30°C water bath
  • 0.45‐µM HA filters (Millipore)
  • Additional reagents and equipment for spectrophotometric determination of RNA concentration ( appendix 3D) or agarose‐formaldehyde gel electrophoresis of RNA (Brown et al., 2004) and SDS‐PAGE (unit 6.1) and autoradiography (unit 6.3)

Alternate Protocol 12: Purification of E2s from E. coli Using an Affinity Tag

  Materials
  • E. coli, transformation‐competent strain BL21(DE3) pLysS (Novagen)
  • E3 plasmid construct (typically pET vectors from Novagen or pGex vectors from GE Healthcare containing E3 cDNA alone or as a tagged fusion protein)
  • LB agar plates and liquid medium containing appropriate antibiotic ( appendix 2A)
  • 2×YT medium (see recipe) containing appropriate antibiotic and up to 250 µM ZnCl 2
  • 1 M IPTG (dissolve 1 g IPTG in 4.2 ml water; store at −20°C)
  • Sonication buffer (see recipe)
  • Glutathione‐Sepharose (GS) or Ni‐NTA agarose (Ni‐NTA) beads
  • 50 mM Tris⋅Cl, pH 7.5 ( appendix 2A)
  • 2 µg/µl stock solution of bovine serum albumin (BSA; Pierce)
  • Platform shaker
  • Spectrophotometer
  • Probe sonicator (e.g., Misonix Sonicator 300)
  • Refrigerated centrifuge and round‐bottom centrifuge tubes
  • Additional reagents and equipment for transforming bacteria with plasmids (Seidman et al., 1997), SDS‐PAGE (unit 6.1), and staining of gels (unit 6.6)

Alternate Protocol 13: Purification of E2s from E. coli Using Anti–Affinity Tag Antibodies

  Materials
  • Sf9 cells or Sf21 cells (Invitrogen)
  • Complete Grace's insect medium (see recipe)
  • Baculovirus lysis buffer 1 (see recipe)
  • 1 M imidazole, pH 7.5 (adjust with HCl)
  • Ni‐NTA beads (Qiagen)
  • 25‐cm2 culture flasks (Nunc) or 100‐mm tissue culture dishes
  • 27°C incubator without enhanced CO 2
  • 175‐cm2 tissue culture flasks
  • 15‐ and 50‐ml centrifuge tubes
  • Additional reagents and equipment for maintenance of insect cell cultures and generation of recombinant baculovirus (Murphy et al., 2004) and batch ( protocol 46) or column ( protocol 47) purification of multimeric E3s

Basic Protocol 23: Expression of E2s with in Vitro Transcription and Translation Systems

  Materials
  • E3 complexes bound to Ni‐NTA beads ( protocol 45)
  • Wash buffer 1 for His 6‐tagged proteins (see recipe)
  • Wash buffer 2 for His 6‐tagged proteins (see recipe)
  • Elution buffer for His 6‐tagged proteins (see recipe)
  • Dialysis buffer 1 for ubiquitylating and neddylating enzymes (see recipe)
  • Glycerol
  • Refrigerated centrifuge
  • 1.5‐ml screw‐cap microcentrifuge tubes
  • End‐over‐end rotator
  • 8000‐MWCO dialysis membrane
  • Additional reagents and equipment for dialysis ( appendix 3C)

Basic Protocol 24: Expression of Ring‐Finger E3s in Bacterial Lysates

  Materials
  • E3 complexes bound to Ni‐NTA beads
  • Wash buffer 1 for His 6‐tagged proteins (see recipe)
  • Wash buffer 2 for His 6‐tagged proteins (see recipe)
  • Elution buffer for His 6‐tagged proteins (see recipe)
  • Dialysis buffer for ubiquitylating and neddylating enzymes (see recipe)
  • Glycerol
  • 2‐ml Poly‐Prep disposable chromatography column (Bio‐Rad)
  • 8000‐MWCO dialysis membrane
  • Additional reagents and equipment for dialysis ( appendix 3C)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Amir, R.E., Iwai, K., and Ciechanover, A. 2002. The NEDD8 pathway is essential for SCF(beta‐TrCP)‐mediated ubiquitination and processing of the NF‐kappa B precursor p105. J. Biol. Chem. 277:23253‐23259.
   Aravind, L. and Koonin, E.V. 2000. The U box is a modified RING finger: A common domain in ubiquitination. Curr. Biol. 10: R132‐R134.
   Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. 2006. Current Protocols in Molecular Biology. John Wiley & Sons, Hoboken, N.J.
   Brown, T., Mackey, K., and Du, T. 2004. Analysis of RNA by northern and slot blot hybridization. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 4.9.1‐4.9.19. John Wiley & Sons, Hoboken, N.J.
   Brzovic, P.S., Keeffe, J.R., Nishikawa, H., Miyamoto, K., Fox, D. 3rd, Fukuda, M., Ohta, T., and Klevit, R. 2003. Binding and recognition in the assembly of an active BRCA1/BARD1 ubiquitin‐ligase complex. Proc. Natl. Acad. Sci. U.S.A. 100:5646‐5651.
   Chan, A.H., Lee, S.M., Chim, S.S., Kok, L.D., Waye, M.M., Lee, C.Y., Fung, K.P., and Tsui, S.K. 2001. Molecular cloning and characterization of a RING‐H2 finger protein, ANAPC11, the human homolog of yeast Apc11p. J. Cell Biochem. 83:249‐258.
   Coligan, J.E., Bierer, B., Marguiles, D.H., She vach, E.M., and Strober, W., eds.) 2006. Current Protocols in Immunology. John Wiley & Sons, Hoboken, N.J.
   Ellison, M.J. and Hochstrasser, M. 1991. Epitope‐tagged ubiquitin. A new probe for analyzing ubiquitin function. J. Biol. Chem. 266:21150‐21157.
   Engebrecht, J., Brent, R., and Kaderbhai, M.A. 1991. Minipreps of plasmid DNA. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Sei dman, J.A. Smith, and K. Struhl, eds.) pp. 1.6.1‐1.6.10. John Wiley & Sons, Hoboken, N.J.
   Fang, S., Jensen, J.P., Ludwig, R.L., Vousden, K.H., and Weissman, A.M. 2000. Mdm2 is a RING finger‐dependent ubiquitin protein ligase for itself and p53. J. Biol. Chem. 275:8945‐8951.
   Fang, S. and Weissman, A.M. 2004. A field guide to ubiquitylation. Cell Mol. Life Sci. 61:1546‐1561.
   Glickman, M. H. and Ciechanover, A. 2002. The ubiquitin‐proteasome proteolytic pathway: Destruction for the sake of construction. Physiol. Rev. 82:373‐428.
   Groll, M. and Huber, R. 2004. Inhibitors of the eukaryotic 20S proteasome core particle: A structural approach. Biochim. Biophys. Acta 1695:33‐44.
   Häkli, M., Lorick, K.L., Weissman, A.M., Janne, O.A., and Palvimo, J.J., 2004. Transcriptional coregulator SNURF (RNF4) possesses ubiquitin E3 ligase activity FEBS Lett. 560:56‐62.
   Hatakeyama, S., Yada, M., Natsumoto, M., Ishida, N., and Nakayama, K.I. 2001. U box proteins as a new family of ubiquitin‐protein ligases. J. Biol. Chem. 276:33111‐33120.
   Hatfield, P.M., Callis, J., and Vierstra, R.D. 1990. Cloning of ubiquitin activating enzyme from wheat and expression of a functional protein in Escherichia coli. J. Biol. Chem. 265:15813‐15817.
   Heitz, F., Nay, C., and Guenet, C. 1997. Expression of functional human muscarinic M2 receptors in different insect cell lines. J. Recept. Signal Transduct. Res. 17: 305‐317.
   Huibregtse, J.M., Scheffner, M., and Howley, P.M. 1993. Cloning and expression of the cDNA for E6‐AP, a protein that mediates the interaction of the human papillomavirus E6 oncoprotein with p53. Mol. Cell Biol. 13:775‐784.
   Imajoh‐Ohmi, S., Kawaguchi, T., Sugiyama, S., Tanaka, K., Omura, S., and Kikuchi, H. 1995. Lactacystin, a specific inhibitor of the proteasome, induces apoptosis in human monoblast U937 cells. Biochem. Biophys. Res. Commun. 217:1070‐1077.
   Iwai, K., Ya manaka, K., Kamura, T., Minato, N., Conaway, R.C., Conaway, J.W., Klausner, R.D., and Pause, A. 1999. Identification of the von Hippel‐lindau tumor‐suppressor protein as part of an active E3 ubiquitin ligase complex. Proc. Natl. Acad. Sci. U.S.A 96:12436‐12441.
   Johnson, E.S. and Gupta, A.A. 2001. An E3‐like factor that promotes SUMO conjugation to the yeast septins. Cell 106:735‐744.
   Kamura, T., Conrad, M.N., Yan, Q., Conaway, R.C., and Conaway, J.W. 1999. The Rbx1 subunit of SCF and VHL E3 ubiquitin ligase activates Rub1 modification of cullins Cdc53 and Cul2. Genes Dev. 13:2928‐933.
   Kawakami, T., Chiba, T., Suzuki, T., Iwai, K., Ya manaka, K., Minato, N., Suzuki, H., Shim bara, N., Hidaka, Y., Osaka, F., Omata, M., and Tanaka, K. 2001. NEDD8 recruits E2‐ubiquitin to SCF E3 ligase. EMBO J. 20:4003‐4012.
   Lorick, K.L., Jensen, J.P., Fang, S., Ong, A.M., Hatakeyama, S., and Weissman, A.M. 1999. RING fingers mediate ubiquitin‐conjugating enzyme (E2)‐dependent ubiquitination. Proc. Natl. Acad. Sci. U.S.A. 96:11364‐11369.
   Lorick, K. L., Jensen, J.P., and Weissman, A.M. 2005a. Expression, purification and properties of the Ubc4/5 family of E2 enzymes. Methods Enzymol. 398:54‐68.
   Lorick, K.L., Tsai, Y.‐C., Yang, Y., and Weissman, A.M. 2005b. RING fingers and relatives: Determinators of protein fate. In Protein Degradation. Vol. 1: Ubiquitin and the Chemistry of Life (R.J. Mayer, A.J. Ciechanover, and M. Rechsteiner, eds.) pp. 4‐101. Wiley‐VCH, Weinheim, Germany.
   Mahaffey, D. and Rechsteiner, M. 1999. Discrimination between ubiquitin‐dependent and ubiquitin‐independent proteolytic pathways by the 26S proteasome subunit 5a. FEBS Lett. 450:123‐125.
   Maki, C.G., Huibregtse, J.M., and Howley, P.M. 1996. In vivo ubiquitination and proteasome‐mediated degradation of p53(1). Cancer Res. 56:2649‐2654.
   Mc Cormack, T., Baumeister, W., Grenier, L., Moomaw, C., Plamondon, L., Pramanik, B., Slaughter, C., Soucy, F., Stein, R., Zuhl, F., and Dick, L. 1997. Active site‐directed inhibitors of Rhodococcus 20 S proteasome: Kinetics and mechanism. J. Biol. Chem. 272:26103‐26109.
   Megumi, Y., Miyauchi, Y., Sakurai, H., Nobeyama, H., Lorick, K., Nakamura, E., Chiba, T., Tanaka, K, Weissman, A.M., Kirisako, T., Ogawa, O., and Iwai, K. 2005. Multiple roles of Rbx1 in the VBC‐Cul2 ubiquitin ligase complex Genes Cells 10:679‐691.
   Murakami, Y., Matsufuji, S., Kameji, T., Hayashi, S., Igarashi, K., Tamura, T., Tanaka, K., and Ichihara, A. 1992. Ornithine decarboxylase is degraded by the 26S proteasome without ubiquitination. Nature 360:597‐599.
   Murakami, Y., Matsufuji, S., Tanaka, K., Ichihara, A., and Hayashi, S. 1993. Involvement of the proteasome and antizyme in ornithine decarboxylase degradation by a reticulocyte lysate. Biochem J. 295:305‐308.
   Murphy, C.I., Piwnica‐Worms, H., Grünwald, S., Romanow, W.G., Francis, N., and Fan, H.‐Y. 2004. Maintainance of insect cell cultures and generation of recombinant baculoviruses. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 16.10.1‐16.10.19. John Wiley & Sons, Hoboken, N.J.
   Naujokat, C., Sezer, O., Zinke, H., Leclere, A., Hauptmann, S., and Possinger, K. 2000. Proteasome inhibitors induced caspase‐dependent apoptosis and accumulation of p21WAF1/Cip1 in human immature leukemic cells. Eur. J. Haematol. 65:221‐236.
   Newman, R.M., Mobascher, A., Mangold, U., Koika, C., Diah, S., Schmidt, M., Finley, D., and Zeiter, B.R. 2004. Antizyme targets cyclin D1 for degradation: A novel mechanism for cell growth repression. J. Biol. Chem. 279:41504‐41511.
   Sambrook, J.F., Frisch, E.F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y.
   Seidman, C.E., Struhl, K., Sheen, J., and Jessen, T. 1997. Introduction of plasmid DNA into cells. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 1.8.1‐1.8.10. John Wiley & Sons, Hoboken, N.J.
   Skowyra, D., Koepp, D.M., Kamura, T., Conrad, M.N, Conaway, R.C., Conaway, J.W., Elledge, S.J., and Harper, J.W. 1999. Reconstitution of G1 cyclin ubiquitination with complexes containing SCFGrr1 and Rbx1. Science 284:662‐665.
   Studier, F.W., Rosenberg, A.H., Dunn, J.J., and Dubendorff, J.W. 1990. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185:60‐89.
   Tanaka, K., Suzuki, T., and Chiba, T. 1998. The ligation systems for ubiquitin and ubiquitin‐like proteins. Mol. Cells 8:503‐512.
   Voytas, D. 2000. Agarose gel electrophoresis. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 2.5A.1‐2.5A.9. John Wiley & Sons, Hoboken, N.J.
   Wang, W., Yum, L., and Beinfeld, M.C. 1997. Expression of rat pro cholecystokinin (CCK) in bacteria and in insect cells infected with recombinant baculovirus. Peptides 18:1295‐1299.
   Weissman, A. M. 2001. Themes and variations on ubiquitylation. Nat. Rev. Mol. Cell Biol. 2:169‐178.
   Wilkinson, K.D. 1997. Regulation of ubiquitin‐dependent processes by deubiquitinating enzymes FASEB J. 11:1245‐1256.
   Wu, P.Y., Hanlon, M., Eddins, M., Tsui, C., Rogers, R.S., Jensen, J.P., Matunis, M.J., Weissman, A.M., Wolberger, C.P., and Pickart, C.M. 2003. A conserved catalytic residue in the ubiquitin‐conjugating enzyme family FASEB J. 22:5241‐5250.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library