Discovering Protein‐Protein Interactions Using Nucleic Acid Programmable Protein Arrays

Yanyang Tang1, Ji Qiu1, Matthias Machner2, Joshua LaBaer1

1 Virginia G. Piper Center for Personalized Diagnostics, Biodesign Institute, Arizona State University, Tempe, Arizona, 2 Division of Molecular and Cellular Biology, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland
Publication Name:  Current Protocols in Cell Biology
Unit Number:  Unit 15.21
DOI:  10.1002/cpcb.14
Online Posting Date:  March, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

We have developed a protocol enabling the study of protein‐protein interactions (PPIs) at the proteome level using in vitro–synthesized proteins. Assay preparation requires molecular cloning of the query gene into a vector that supports in vitro transcription/translation (IVTT) and appends a HaloTag to the query protein of interest. In parallel, protein microarrays are prepared by printing plasmids encoding glutathione S‐transferase (GST)‐tagged target proteins onto a carrier matrix/glass slide coated with antibody directed against GST. At the time of the experiment, the query protein and the target protein are produced separately through IVTT. The query protein is then applied to nucleic acid programmable protein arrays (NAPPA) that display thousands of freshly produced target proteins captured by anti‐GST antibody. Interactions between the query and immobilized target proteins are detected through addition of a fluorophore‐labeled HaloTag ligand. Our protocol allows the elucidation of PPIs in a high‐throughput fashion using proteins produced in vitro, obviating the scientific challenges, high cost, and laborious work, as well as concerns about protein stability, which are usually present in protocols using conventional protein arrays. © 2017 by John Wiley & Sons, Inc.

Keywords: protein‐protein interactions; protein arrays; NAPPA; cell‐free gene expression; HaloTag

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Reagents and Solutions
  • Commentary
  • Literature cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1:

  Materials
  • Entry/expression vectors including pDONR221, pJFT7_nHALO_DC, pJFT7_nHALO_empty, pANT7_cGST (DNASU Plasmid Repository)
  • Gateway LR Clonase enzyme mix (Thermo Fisher Scientific, cat. no. 11791019; store at −20 °C; always keep on ice when in use)
  • MAX Efficiency E. coli DH5‐α competent cells (Thermo Fisher Scientific, cat. no. 18258012; store at −80°C)
  • SOC medium (Thermo Fisher Scientific, cat. no. 15544034)
  • LB agar and LB liquid medium (see recipe for LB medium in appendix 2A) containing 100 µg/ml ampicillin (sodium salt; Sigma‐Aldrich, cat. no. A9518‐25 G)
  • 80% (v/v) glycerol stock solution
  • QIAprep Spin Miniprep kit (Qiagen, cat. no. 27106)
  • Sequencing primers for pJFT7_nHALO_query_gene:
    • Forward: AAGCCTGCCTAACTGCAA
    • Reverse: TTTTTGTTTAAACTACCACTTT
  • Nucleobond xtra Maxi kit (Macherey‐Nagel, cat. no. 740 414.50)
  • Human HeLa lysate‐based cell‐free expression system (1‐step Human Coupled IVT Kit, Thermo Fisher Scientific, cat. no. 88881; stored at −80°C and limit to three freeze/thaw cycles; aliquot if needed; always keep on ice when use)
  • Alexa Fluor 660‐HaloTag ligand (Promega, cat. no. G8471)
  • 4× Laemmli sample buffer (Bio‐Rad, cat. no. 1610747)
  • Mouse anti‐GST primary antibody (26H1; Cell Signaling Technology, cat. no. 2624)
  • Alexa Fluor 647‐goat anti‐mouse IgG secondary antibody (Thermo Fisher Scientific, cat. no. A‐21235)
  • SuperBlock blocking buffer (Pierce, cat. no. 37535)
  • Phosphate‐buffered saline with Tween 20 (PBST): phosphate‐buffered saline (PBS; appendix 2A), pH 7.4, containing 0.2% (v/v) Tween 20 (Sigma‐Aldrich, cat. no. P1379)
  • PPI blocking buffer (see recipe)
  • PPI washing buffer (see recipe)
  • 42ºC water bath
  • Sterile applicators for bacteria
  • Thermal shaker for microtubes (BIOTANG, cat. no. MS‐100)
  • New Brunswick Innova 44 Incubator Shaker (Eppendorf, cat. no. M1282‐0000)
  • NanoDrop spectrophotometer
  • EchoTherm programmable chilling/heating incubator (Torrey Pines Scientific, cat. no. 11‐680‐35)
  • Typhoon FLA 9500 Scanner (GE Healthcare, cat. no. 28‐9969‐43)
  • NAPPA arrays printed with target ORF sequences in pANT7_cGST expression vector (NAPPA Protein Array Core; http://nappaproteinarray.org/); customized NAPPA arrays can also be fabricated by the users according to the published protocol (Ramachandran et al., ; Miersch and LaBaer, ; Qiu and LaBaer, ; Sibani and LaBaer, ) and tutorial video (https://www.youtube.com/watch?v=Ur1fg9jQv04; Miersch and LaBaer, ); store under anhydrous conditions for up to 6 months at room temperature (23°C)
  • CELLSTAR FourWell plate (VWR, cat. no. 30617‐596)
  • VWR Rocking Platform Shaker (VWR, cat. no. 4000‐304)
  • Slotted rack for glass microscope sides (Sigma‐Aldrich, cat. no. Z710989)
  • Allegra X‐12 Benchtop Centrifuge (Beckman Coulter, cat. no. Allegr X‐12R)
  • HBW HybriWell sealing system (Grace Bio‐Labs, cat. no. 440904)
  • Wooden applicator stick
  • Tweezers
  • Corning 245 mm Square BioAssay Dish (Fisher Scientific, cat. no. 06‐443‐22)
  • StainTray slide staining system (Sigma‐Aldrich, cat. no. Z670146)
  • Tecan PowerScanner (Tecan)
  • Array‐Pro analyzer, version 6.3 (Media Cybernetics)
  • Excel 2013 software (Microsoft)
  • Additional reagents and equipment for SDS‐PAGE (unit 6.1; Gallagher, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature cited
  Calderwood, M.A., Venkatesan, K., Xing, L., Chase, M.R., Vazquez, A., Holthaus, A.M., Ewence, A.E., Li, N., Hirozane‐Kishikawa, T., Hill, D.E., Vidal, M., Kieff, E., and Johannsen, E. 2007. Epstein‐Barr virus and virus human protein interaction maps. Proc. Natl. Acad. Sci. U.S.A. 104:7606‐7611. doi: 10.1073/pnas.0702332104.
  Gallagher, S. R. 2007. One‐dimensional SDS gel electrophoresis of proteins. Curr. Protoc. Cell Biol. 37:6.1.1‐6.1.38.
  Jager, S., Cimermancic, P., Gulbahce, N., Johnson, J.R., McGovern, K.E., Clarke, S.C., Shales, M., Mercenne, G., Pache, L., Li, K., Hernandez, H., Jang, G.M., Roth, S.L., Akiva, E., Marlett, J., Stephens, M., D'Orso, I., Fernandes, J., Fahey, M., Mahon, C., O'Donoghue, A.J., Todorovic, A., Morris, J.H., Maltby, D.A., Alber, T., Cagney, G., Bushman, F.D., Young, J.A., Chanda, S.K., Sundquist, W.I., Kortemme, T., Hernandez, R.D., Craik, C.S., Burlingame, A., Sali, A., Frankel, A.D., and Krogan, N.J. 2012. Global landscape of HIV‐human protein complexes. Nature 481:365‐370. doi: 10.1038/nature10719.
  Jones, R.B., Gordus, A., Krall, J.A., and MacBeath, G.A. 2006. quantitative protein interaction network for the ErbB receptors using protein microarrays. Nature 439:168‐174. doi: 10.1038/nature04177.
  Karthikeyan, K., Barker, K., Tang, Y., Kahn, P., Wiktor, P., Brunner, A., Knabben, V., Takulapalli, B., Buckner, J., Nepom, G., LaBaer, J., and Qiu, J. 2016. A contra capture protein array platform for studying post‐translationally modified (PTM) auto‐antigenomes. Mol. Cell Proteomics 15:2324‐2337. doi: 10.1074/mcp.M115.057661.
  Katzen, F., Peterson, T.C., and Kudlicki, W. 2009. Membrane protein expression: No cells required. Trends Biotechnol. 27:455‐460. doi: 10.1016/j.tibtech.2009.05.005.
  Kaushansky, A., Gordus, A., Budnik, B.A., Lane, W.S., Rush, J., and MacBeath, G. 2008. System‐wide investigation of ErbB4 reveals 19 sites of Tyr phosphorylation that are unusually selective in their recruitment properties. Chem. Biol. 15:808‐817. doi: 10.1016/j.chembiol.2008.07.006.
  Krogan, N.J., Cagney, G., Yu, H., Zhong, G., Guo, X., Ignatchenko, A., Li, J., Pu, S., Datta, N., Tikuisis, A.P., Punna, T., Peregrín‐Alvarez, J.M., Shales, M., Zhang, X., Davey, M., Robinson, M.D., Paccanaro, A., Bray, J.E., Sheung, A., Beattie, B., Richards, D.P., Canadien, V., Lalev, A., Mena, F., Wong, P., Starostine, A., Canete, M.M., Vlasblom, J., Wu, S., Orsi, C., Collins, S.R., Chandran, S., Haw, R., Rilstone, J.J., Gandi, K., Thompson, N.J., Musso, G., St Onge, P., Ghanny, S., Lam, M.H., Butland, G., Altaf‐Ul, A.M., Kanaya, S., Shilatifard, A., O'Shea, E., Weissman, J.S., Ingles, C.J., Hughes, T.R., Parkinson, J., Gerstein, M., Wodak, S.J., Emili, A., and Greenblatt, J.F. 2006. Global landscape of protein complexes in the yeast Saccharomyces cerevisiae. Nature 440:637‐643. doi: 10.1038/nature04670.
  Miersch, S. and LaBaer, J. 2011. Nucleic acid programmable protein arrays: Versatile tools for array‐based functional protein studies. Curr. Protoc. Protein Sci. 64:27.2:27.2.1‐27.2.26. doi: 10.1002/0471140864.ps2702s64.
  Montor, W.R., Huang, J., Hu, Y., Hainsworth, E., Lynch, S., Kronish, J.W., Ordonez, C.L., Logvinenko, T., Lory, S., and LaBaer, J. 2009. Genome‐wide study of Pseudomonas aeruginosa outer membrane protein immunogenicity using self‐assembling protein microarrays. Infect. Immun. 77:4877‐4886. doi: 10.1128/IAI.00698‐09.
  Park, J., Throop, A.L., and LaBaer, J. 2015. Site‐specific recombinational cloning using Gateway and in‐fusion cloning schemes. Curr. Protoc. Mol. Biol. 110:3.20.1‐3.20.23. doi: 10.1002/0471142727.mb0320s110.
  Qiu, J. and LaBaer, J. 2011. Nucleic acid programmable protein array a just‐in‐time multiplexed protein expression and purification platform. Methods Enzymol. 500:151‐163. doi: 10.1016/B978‐0‐12‐385118‐5.00009‐8.
  Ramachandran, N., Hainsworth, E., Bhullar, B., Eisenstein, S., Rosen, B., Lau, A.Y., Walter, J.C., and LaBaer, J. 2004. Self‐assembling protein microarrays. Science 305:86‐90. doi: 10.1126/science.1097639.
  Ramachandran, N., Raphael, J.V., Hainsworth, E., Demirkan, G., Fuentes, M.G., Rolfs, A., Hu, Y., and LaBaer J. 2008. Next‐generation high‐density self‐assembling functional protein arrays. Nat. Methods 5:535‐538. doi: 10.1038/nmeth.1210.
  Ramani, S.R., Tom, I., Lewin‐Koh, N., Wranik, B., Depalatis, L., Zhang, J., Eaton, D., and Gonzalez, L.C. 2012. A secreted protein microarray platform for extracellular protein interaction discovery. Anal. Biochem. 420:127‐138. doi: 10.1016/j.ab.2011.09.017.
  Rozenblatt‐Rosen, O., Deo, R.C., Padi, M., Adelmant, G., Calderwood, M.A., Rolland, T., Grace, M., Dricot, A., Askenazi, M., Tavares, M., Pevzner, S.J., Abderazzaq, F., Byrdsong, D., Carvunis, A.R., Chen, A.A., Cheng, J., Correll, M., Duarte, M., Fan, C., Feltkamp, M.C., Ficarro, S.B., Franchi, R., Garg, B.K., Gulbahce, N., Hao, T., Holthaus, A.M., James, R., Korkhin, A., Litovchick, L., Mar, J.C., Pak, T.R., Rabello, S., Rubio, R., Shen, Y., Singh, S., Spangle, J.M., Tasan, M., Wanamaker, S., Webber, J.T., Roecklein‐Canfield, J., Johannsen, E., Barabási, A.L., Beroukhim, R., Kieff, E., Cusick, M.E., Hill, D.E., Münger, K., Marto, J.A., Quackenbush, J., Roth, F.P., DeCaprio, J.A., and Vidal, M. 2012. Interpreting cancer genomes using systematic host network perturbations by tumour virus proteins. Nature 487:491‐495. doi: 10.1038/nature11288.
  Saul, J., Petritis, B., Sau, S., Rauf, F., Gaskin, M., Ober‐Reynolds, B., Mineyev, I., Magee, M., Chaput, J., Qiu, J., and LaBaer, J. 2014. Development of a full‐length human protein production pipeline. Protein. Sci. 23:1123‐1135. doi: 10.1002/pro.2484.
  Seiler, C.Y., Park, J.G., Sharma, A., Hunter, P., Surapaneni, P., Sedillo, C., Field, J., Algar, R., Price, A., Steel, J., Throop, A., Fiacco, M., and LaBaer, J. 2014. DNASU plasmid and PSI:Biology‐Materials repositories: Resources to accelerate biological research. Nucleic Acids Res. 42:D1253‐60. doi: 10.1093/nar/gkt1060.
  Shapira, S.D., Gat‐Viks, I., Shum, B.O., Dricot, A., de Grace, M.M., Wu, L., Gupta, P.B., Hao, T., Silver, S.J., Root, D.E., Hill, D.E., Regev, A., and Hacohen, N. 2009. A physical and regulatory map of host‐influenza interactions reveals pathways in H1N1 infection. Cell 139:1255‐1267. doi: 10.1016/j.cell.2009.12.018.
  Sibani, S. and LaBaer, J. 2011. Immunoprofiling using NAPPA protein microarrays. Methods Mol. Biol. 723:149‐161. doi: 10.1007/978‐1‐61779‐043‐0_10.
  Tafforeau, L., Rabourdin‐Combe, C., and Lotteau, V. 2012. Virus‐human cell interactomes. Methods Mol. Biol. 812:103‐120. doi: 10.1007/978‐1‐61779‐455‐1_6.
  Tyagi, M., Hashimoto, K., Shoemaker, B.A., Wuchty, S., and Panchenko, A.R. 2012. Large‐scale mapping of human protein interactome using structural complexes. EMBO Rep. 13:266‐271. doi: 10.1038/embor.2011.261.
  Uetz, P., Giot, L., Cagney, G., Mansfield, T.A., Judson, R.S., Knight, J.R., Lockshon, D., Narayan, V., Srinivasan, M., Pochart, P., Qureshi‐Emili, A., Li, Y., Godwin, B., Conover, D., Kalbfleisch, T., Vijayadamodar, G., Yang, M., Johnston, M., Fields, S., and Rothberg, J.M. 2000. A comprehensive analysis of protein‐protein interactions in Saccharomyces cerevisiae. Nature 403:623‐627. doi: 10.1038/35001009.
  Venkatesan, K., Green, J., Shapiro, S.R., and Steinhardt, G.F. 2009. Correlation of hydronephrosis index to society of fetal urology hydronephrosis scale. Adv. Urol. 960490. doi: 10.1155/2009/960490.
  Yu, X. and LaBaer, J. 2015. High‐throughput identification of proteins with AMPylation using self‐assembled human protein (NAPPA) microarrays. Nat. Protoc. 10:756‐767. doi: 10.1038/nprot.2015.044.
  Yu, X., Decker, K.B., Barker, K., Neunuebel, M.R., Saul, J., Graves, M., Westcott, N., Hang, H., LaBaer, J., Qiu, J., and Machner, M.P. 2015. Host‐pathogen interaction profiling using self‐assembling human protein arrays. J. Proteome Res. 14:1920‐1936. doi: 10.1021/pr5013015.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library