Analysis of Telomeres and Telomerase

Brittney‐Shea Herbert1, Jerry W. Shay1, Woodring E. Wright1

1 The University of Texas Southwestern Medical Center, Dallas, Texas
Publication Name:  Current Protocols in Cell Biology
Unit Number:  Unit 18.6
DOI:  10.1002/0471143030.cb1806s20
Online Posting Date:  November, 2003
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes techniques to analyze telomeric length and telomerase activity in human cells. Telomere length can be determined by a modification of Southern blotting in which the analysis of chromosome terminal restriction fragments (TRFs) provides the average lengths of all telomeres in a cell population. Telomerase activity can be measured in vitro by a sensitive and efficient polymerase chain reaction (PCR)‐based detection method, also known as telomeric repeat amplification protocol (TRAP). These assays can be used to study the in vitro cellular effects of aging and cancer treatments on telomere biology and telomerase activity.

Keywords: telomeres; terminal restriction fragment (TRF); telomerase; TS primer; PCR

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Terminal Restriction Fragment Size Determination to Measure Average Telomere Lengths
  • Support Protocol 1: Making A Labeled Molecular Weight Marker for Running on an Agarose Gel
  • Support Protocol 2: Making Kinased Radiolabeled Telomeric Repeat Probe
  • Support Protocol 3: Synthesis of A High–Specific Activity Telomeric Repeat Probe
  • Basic Protocol 2: Measurement of Telomerase Activity by the Telomeric Repeat Amplification Protocol
  • Alternate Protocol 1: Measurement of Telomerase Activity by the Telomeric Repeat Amplification Protocol Using Fluorescent Primers
  • Support Protocol 4: Lysis of Tissue Samples for the Telomeric Repeat Amplification Protocol
  • Support Protocol 5: Making Radiolabeled TS Primer for Telomeric Repeat Amplification Protocol
  • Support Protocol 6: Making the Primer Mix for Telomeric Repeat Amplification Protocol
  • Reagents and Solutions
  • Commentary
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Terminal Restriction Fragment Size Determination to Measure Average Telomere Lengths

  Materials
  • Cell pellet from ≥300,000 cells and appropriate medium
  • Quick‐prep lysis buffer (see recipe)
  • Triton X‐100
  • 20 mg/ml proteinase K
  • TE buffer, pH 7.5 to 8.0 ( appendix 2A)
  • Restriction enzyme mix: equal volumes of HinfI, RsaI, MspI, CfoI, HaeIII, and AluI restriction enzymes (Boehringer Mannheim; 10 U/µl each before mixing, final 1.67 U/µl each)
  • 10× TAE buffer ( appendix 2A)
  • 10× TBE buffer ( appendix 2A)
  • 10,000 cpm radiolabeled molecular weight markers mixed with ≥500 ng unlabeled, StyI‐digested λ DNA (or other appropriate unlabeled, digested DNA; see protocol 2)
  • Denaturing solution: 0.5 M NaOH/1.5 M NaCl
  • Neutralizing solution: 1.5 M NaCl/0.5 M Tris⋅Cl, pH 8.0 (see appendix 2A for Tris⋅Cl)
  • Hybridization solution (see recipe)
  • Radiolabeled telomeric repeat probe (see Support Protocols protocol 32 and protocol 43)
  • 20× SSC (see recipe)
  • 0.1× SSC/0.1% (w/v) SDS
  • 2‐ml polypropylene screw‐cap tubes (Sarstedt) with an optional extra set of screw caps to be cut vertically with jigsaw to form open screw‐cap ring (Fig. A)
  • 37°, 55°, and 70°C water baths heating blocks, or PCR machine
  • Dialysis membrane sheets or tubing (e.g., Spectra/Por; Spectrum), molecular weight cutoff (MWCO) ≥6000 to 8000
  • Wide‐bore pipet tips
  • Whatman 3MM filter paper
  • Hybridization oven, 42°C, and appropriate hybridization containers, or equivalent
  • PhosphorImager, including phosphor screens and ImageQuant software (Molecular Dynamics)
  • Additional reagents and equipment for agarose gel electrophoresis ( appendix 3A)

Support Protocol 1: Making A Labeled Molecular Weight Marker for Running on an Agarose Gel

  Materials
  • ∼250 ng/µl DNA molecular weight marker (e.g., λ DNA digested with StyI)
  • 10× React 2 buffer (Roche)
  • 100 µM dAGT mix: 100 µM each dATP, dGTP, dTTP in H 2O, stored up to 1 year at −20°C
  • [α‐32P]dCTP (3000 Ci/mmol)
  • 2 U/µl Klenow fragment of E. coli DNA polymerase I
  • QIAquick nucleotide removal kit (Qiagen)

Support Protocol 2: Making Kinased Radiolabeled Telomeric Repeat Probe

  Materials
  • (T 2AG 3) 4 or (C 3TA 2) 4 oligonucleotide (20 pmol/µl or 0.16 µg/µl)
  • [γ‐32P]ATP (3000 Ci/mmol)
  • 5× forward or exchange reaction buffer (GIBCO/BRL)
  • 10 U/µl T4 polynucleotide kinase (GIBCO/BRL)
  • QIAquick nucleotide removal kit (Qiagen)

Support Protocol 3: Synthesis of A High–Specific Activity Telomeric Repeat Probe

  Materials
  • 10 pmol/µl GTU4 oligonucleotide dissolved in TE buffer: 5′‐GGGUUAGGGUUAGGGUUAGGGAAA‐3′
  • 100 pmol/µl T3C3+9 oligonucleotide dissolved in TE buffer: 5′‐TTTCCCTAACCCTAA‐3′
  • 1 M NaCl
  • 10× buffer M: 10 mM Tris·Cl (pH 7.5)/10 mM MgCl 2/50 mM NaCl/1 mM dithioerythritol (DTE; Roche)
  • 2 M Tris·Cl, pH 7.4 to 7.6 ( appendix 2A)
  • 10 mg/ml BSA (e.g., Ambion)
  • 1.25 mM dAdT: 1.25 mM each of dATP and dTTP
  • [α‐32P]dCTP (3000 Ci/mmol)
  • 5 U/µl Klenow large fragment of E. coli DNA polymerase I
  • 1 U/µl uracil deglycosylase (UDG)
  • 37°, 95°, and 99°C water baths heating blocks, or PCR machines
  • PhosphorImager, including phosphor screens (Molecular Dynamics)
  • Additional reagents and equipment for DNA acrylamide gel electrophoresis ( appendix 3A)

Basic Protocol 2: Measurement of Telomerase Activity by the Telomeric Repeat Amplification Protocol

  Materials
  • 100,000 cells grown in culture or tissue lysate containing 6 µg protein (see protocol 7)
  • Liquid nitrogen
  • NP‐40 lysis buffer (see recipe), ice cold
  • RNase
  • 50× dNTP mix: 2.5 mM each dATP, dTTP, dGTP, and dCTP in RNase‐free water
  • 10× TRAP buffer (see recipe)
  • Radiolabeled TS primer (see protocol 8)
  • Primer mix (see protocol 9)
  • RNase‐free H 2O (DEPC‐treated)
  • 50 mg/ml BSA, ultrapure (Ambion)
  • 5 U/µl Taq DNA polymerase
  • Loading dye (see recipe)
  • 0.5 M NaCl/50% (v/v) ethanol/40 mM sodium acetate (pH 4.2), optional
  • DNase‐, RNase‐free 0.5‐ml microcentrifuge and PCR tubes
  • Tabletop centrifuge (e.g., 5415D; Eppendorf), room temperature and, optionally, 4°C
  • 37°C water bath or 85°C heating block
  • Thermal cycler
  • PhosphorImager with phosphor screens and ImageQuant software (Molecular Dynamics)
  • Additional reagents and equipment for nondenaturing acrylamide gel electrophoresis (unit 6.5)
NOTE: Most of the reagents are included in the TRAPeze kit (Intergen).

Alternate Protocol 1: Measurement of Telomerase Activity by the Telomeric Repeat Amplification Protocol Using Fluorescent Primers

  • 100 ng/µl fluorescently labeled TS primer: 5′‐Cy5‐AATCCGTCGAGCAGAGTT (Integrated DNA Technologies), HPLC or PAGE purified

Support Protocol 4: Lysis of Tissue Samples for the Telomeric Repeat Amplification Protocol

  • 50 to 100 mg tissue sample, frozen at −80°C
  • Washing buffer (see recipe), ice cold
  • BCA protein assay kit (Pierce)
  • Kontes tubes and disposable pestles (VWR)
  • Hand‐powered drill

Support Protocol 5: Making Radiolabeled TS Primer for Telomeric Repeat Amplification Protocol

  Materials
  • 100 ng/µl TS primer (5′‐AATCCGTCGAGCAGAGTT‐3′)
  • [γ‐32P]ATP (3000 Ci/mmol), sterile
  • 10 U/µl T4 polynucleotide kinase and 5× forward kinase buffer (GIBCO/BRL)
  • Sterile, RNase‐free H 2O
  • RNase‐free 1.5‐ml microcentrifuge tubes
  • 37° and 85°C water baths or heating block, or PCR machine

Support Protocol 6: Making the Primer Mix for Telomeric Repeat Amplification Protocol

  Materials
  • TSNT oligonucleotide: 5′‐AATCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT‐3′
  • RNase‐free H 2O
  • 1 µg/µl ACX primer: 5′‐GCGCGGCTTACCCTTACCCTTACCCTAACC‐3′
  • 1 µg/µl NT primer: 5′‐ATCGCTTCTCGGCCTTTT‐3′
  • 10% (v/v) bleach
  • RNase‐free 0.5‐ml PCR tubes, including some that are siliconized
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Allsopp, R.C., Vaziri, H., Patterson, C., Goldstein, S., Younglai, E.V., Futcher, A.B., Greider, C.W., and Harley, C.B. 1992. Telomere length predicts replicative capacity of human fibroblasts. Proc. Natl. Acad. Sci. U.S.A. 89:10114‐10118.
   Collins, K. 2000. Mammalian telomeres and telomerase. Curr. Opin. Cell Biol. 12:378‐383.
   Cong, Y.‐S., Wright, W.E., and Shay, J.W. 2002. Human telomerase and its regulation. Microbiol. Mol. Bio. Rev. 66:407‐425.
   Counter, C.M., Avilion, A.A., LeFeuvre, C.E., Stewart, N.G., Greider, C.W., Harley, C.B., and Bacchetti, S. 1992. Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J. 11:1921‐1929.
   Gollahon, L.S. and Holt, S.E. 2000. Alternative methods of extracting telomerase activity from human tumor samples. Cancer Lett. 159:141‐149.
   Greider, C.W. and Blackburn, E.H. 1985. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 43:405‐413.
   Harley, C.B., Futcher, A.B., and Greider, C.W. 1990. Telomeres shorten during ageing of human fibroblasts. Nature 345:458‐460.
   Holt, S.E., Norton, J.C., Wright, W.E., and Shay, J.W. 1996. Comparison of the telomeric repeat amplification protocol (TRAP) to the new TRAP‐eze telomerase detection kit. Methods Cell Sci. 18:237‐248.
   Kim, N.‐W., Piatyszek, M.A., Prowse, K.R., Harley, C.B., West, M.D., Ho, P.L.C., Coviello, G.M., Wright, W.E., Weinrich, S.L., and Shay, J.W. 1994. Specific association of human telomerase activity with immortal cells and cancer. Science 266:2011‐2015.
   Norton, J.C., Holt, S.E., Wright, W.E., and Shay, J.W. 1998. Enhanced detection of human telomerase activity. DNA Cell Biol. 17:217‐219.
   Ouellette, M.M., Liao, M., Herbert, B.‐S., Johnson, M., Holt, S.E., Liss, H.S., Shay, J.W., and Wright, W.E. 2000. Subsenescent telomere lengths in fibroblasts immortalized by limiting amounts of telomerase. J. Biol. Chem. 275:10072‐10076.
   Piatyszek, M.A., Kim, N.W., Weinrich, S.L., Hiyama, K., Hiyama, E., Wright, W.E., and Shay, J.W. 1995. Detection of telomerase activity in human cells and tumors by a telomeric repeat amplification protocol (TRAP). Methods Cell Sci. 17:1‐15.
   Wright, W.E., Shay, J.W., and Piatyszek, M.A. 1995. Modifications of a telomeric repeat amplification protocol (TRAP) result in increased reliability, linearity and sensitivity. Nucl. Acids Res. 23:3794‐3795.
   Wright, W.E., Brasiskyte, D., Piatyszek, M.A., and Shay, J.W. 1996. Experimental elongation of telomeres in immortal human cells extends the lifespan of immortal × normal cell hybrids. EMBO J. 15:1734‐1741.
Internet Resource
  http://www.swmed.edu/home_pages/cellbio/shay-wright/
  Includes TELORUN for calculating mean TRF.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library