Microanalysis of Gene Expression in Tissues Using T7‐SAGE: Serial Analysis of Gene Expression After High‐Fidelity T7‐Based RNA Amplification

Takayoshi Sakai1, Melinda Larsen1, Kenneth M. Yamada1

1 National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, Maryland
Publication Name:  Current Protocols in Cell Biology
Unit Number:  Unit 19.3
DOI:  10.1002/0471143030.cb1903s16
Online Posting Date:  November, 2002
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

In this unit, the authors describe a new technique, T7‐SAGE, in which a high‐fidelity T7 amplification step is combined with SAGE analysis. In order to avoid extra PCR or other forms of amplification, the authors incorporate only two cycles of T7‐based RNA amplification as the initial step. This T7‐based amplification step has high accuracy. In addition, T7 RNA polymerase has high processivity and functions effectively even when broad stretches of nucleotides are being amplified. Although no protocol that includes an amplification step can claim to permit determination of absolute transcript number, since slight changes in estimated transcript frequency are always possible, T7 procedures appear to be the safest to date. This new T7‐SAGE procedure should facilitate application of SAGE for gene‐expression profiling using minimal quantities of starting material, such as from embryonic tissues and microdissected cells from histological sections of tissues.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: T7‐Based RNA Amplification
  • Support Protocol 1: Preparation of Total RNA
  • Alternate Protocol 1: Substitution of a Commercial Kit for Amplifying Tiny Quantities of RNA
  • Basic Protocol 2: T7‐SAGE Procedure
  • Support Protocol 2: Phenol‐Chloroform (PC8) Extraction
  • Support Protocol 3: Kinasing of Linkers
  • Support Protocol 4: Gel‐Shift Test for Complete Biotinylation of Biotin‐Oligo dT
  • Support Protocol 5: Preparation of Polyacrylamide Gels Used in SAGE Analysis
  • Support Protocol 6: Direct Sequencing Using a Commercial Sequencing Kit
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: T7‐Based RNA Amplification

  Materials
  • 4 to 5 ng purified total RNA from tissues or cells in a volume of 10.5 µl (see protocol 2)
  • 0.5 mg/ml T7‐oligo(dT) primer:
  • 5′‐TCTAGTCGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGT 21‐3′ (custom‐synthesized, e.g., by Integrated DNA Technologies or core facility)
  • Superscript Choice System for cDNA Synthesis kit (Invitrogen), including:
  •  5× first‐strand reaction buffer
  •  0.1 M dithiothreitol (DTT)
  •  10 mM dNTP mix (10 mM each dATP, dCTP, dGTP, dTTP)
  •  SuperScript II reverse transcriptase
  •  40 U/µl RNaseOUT recombinant ribonuclease inhibitor (Invitrogen)
  •  5× second‐strand reaction buffer
  •  10 U/µl DNA polymerase I
  • 60 U/µl RNase H (PanVera)
  • 60 U/µl DNA ligase (PanVera)
  • DEPC‐treated H 2O (Quality Biological or other supplier; also see appendix 2A)
  • 8 U/µl T4 DNA polymerase (Promega)
  • QIAquick PCR Purification Kit (Qiagen)
  • Ampliscribe T7 High Yield Transcription Kit (Epicentre Technologies), including:
  •  Ampliscribe T7 reaction buffer
  •  100 mM ATP
  •  100 mM CTP
  •  100 mM GTP
  •  100 mM UTP
  •  0.1 M dithiothreitol (DTT)
  •  T7 RNA polymerase solution
  • 10 U/µl DNase I (Boehringer Mannheim)
  • RNeasy Mini Kit (Qiagen)
  • 1 mg/ml random primers (Invitrogen)
  • 0.5 mg/ml biotinylated oligo(dT) primer: 5′‐ [biotin]T 18 ‐3′ (custom‐synthesized, e.g., by Integrated DNA Technologies or core facility), gel‐purified; test for complete biotinylation before use by gel‐shift test (see protocol 7)
  • 16°, 42°, 70°, and 95°C water baths
  • GeneQuant pro RNA/DNA Calculator (Amersham Pharmacia Biotech) or any other spectrophotometer for determining UV absorbance of small samples (e.g., 20 to 50 µl)

Support Protocol 1: Preparation of Total RNA

  Materials
  • Tissues or cells of interest
  • Kit or reagents for total RNA isolation (Table 19.3.1)
  • DEPC‐treated H 2O ( appendix 2A; or supplied with isolation kit)
  • 10× DNase I buffer (Ambion)
  • 2 U/µl DNase I (RNase‐free; Ambion)
  • 40 U/µl RNaseOUT recombinant ribonuclease inhibitor (Invitrogen)
  • RNeasy Mini Kit (Qiagen)
CAUTION: Investigators should wear gloves for all procedures involving RNA and take precautions in order to avoid cross‐contamination of samples. See appendix 2A for general guidelines when working with RNA.

Alternate Protocol 1: Substitution of a Commercial Kit for Amplifying Tiny Quantities of RNA

  • RiboAmp RNA Amplification Kit (Arcturus Engineering)

Basic Protocol 2: T7‐SAGE Procedure

  Materials
  • 1 µg of bds cDNA generated by T7‐based amplification (see protocol 1) in ∼50 µl
  • mRNA Capture Kit (Roche Molecular Biochemicals) including:
  •  Streptavidin‐coated PCR tubes
  •  Washing solution
  • 10× NEBuffer 4 (New England Biolabs; supplied with corresponding restriction enzymes)
  • 10 U/µl restriction endonuclease NlaIII (New England Biolabs)
  • 100× (10 µg/µl) BSA (New England Biolabs; supplied with corresponding restriction enzymes)
  • DNase‐free H 2O
  • 1 U/µl and 5 U/µl T4 DNA ligase and 10× ligase buffer (Invitrogen)
  • LoTE buffer (see recipe)
  • 15 ng/µl annealed linker 1 (formed by annealing linkers 1A and 1B; see protocol 6)
  • 15 ng/µl annealed linker 2 (formed by annealing linkers 2A and 2B; see protocol 6)
  • 2 U/µl restriction endonuclease BsmFI (New England Biolabs)
  • 20 mg/ml glycogen (Boehringer Mannheim)
  • 7.5 M ammonium acetate
  • 70% and 100% ethanol
  • 5× second‐strand reaction buffer (Invitrogen; supplied with SuperScript kit, also see protocol 1)
  • 10 mM dNTP mix (10 mM each dATP, dCTP, dGTP, dTTP; Invitrogen; supplied with SuperScript kit; also see protocol 1)
  • 5 U/ml Klenow fragment of DNA polymerase (Amersham Pharmacia Biotech or USB)
  • 10× PCR buffer (see recipe)
  • Dimethyl sulfoxide (DMSO)
  • 350 ng/µl primer 1: 5′‐GGATTTGCTGGTGCAGTACA‐3′ (custom‐synthesized, e.g., by Integrated DNA Technologies or core facility)
  • 350 ng/µl primer 2: 5′‐CTGCTCGAATTCAAGCTTCT‐3′ (custom‐synthesized, e.g., by Integrated DNA Technologies or core facility)
  • 5 U/µl Platinum Taq polymerase (Invitrogen)
  • 12% and 8% polyacrylamide gels (see protocol 8)
  • 6× Loading Dye Solution (LDS; Fermentas)
  • 10‐ and 25‐bp DNA ladders (Invitrogen)
  • SYBR Green I (Molecular Probes)
  • 1× TAE buffer (e.g., Advanced Technologies, or prepare as in appendix 2A)
  • TE buffer, pH 7.4 ( appendix 2A), cold
  • Ready‐to‐Go 100‐bp DNA ladder (Fermentas)
  • pZERO‐1 plasmid (Invitrogen)
  • 5 U/µl restriction endonuclease SphI (New England Biolabs)
  • 10× NEBuffer 2 (New England Biolabs; supplied with corresponding restriction enzymes)
  • 1% and 3% agarose gels (see appendix 3A)
  • One Shot TOP10 Electrocompetent E. coli cells (Invitrogen)
  • SOC medium (see recipe)
  • 10‐cm Zeocin‐containing low‐salt LB plates (see recipe)
  • 350 ng/µl M13 forward primer: 5′‐GTAAAACGACGGCCAGT‐3′ (custom‐synthesized, e.g., by Integrated DNA Technologies or core facility)
  • 350 ng/µl M13 reverse primer: 5′‐GGAAACAGCTATGACCATG‐3′ (custom‐synthesized, e.g., by Integrated DNA Technologies or core facility)
  • QIAquick 96 Multiwell PCR Purification Kit (Qiagen)
  • 10 mg/ml ethidium bromide
  • 16°, 50°, and 65°C water baths
  • 2‐ml PCR tubes
  • System for PCR using 96‐well plates (e.g., GeneAmp PCR system 9600 or 9700, Applied Biosystems)
  • 96‐well PCR plates (Applied Biosystems)
  • Power Pac 200 power source (Bio‐Rad)
  • 18‐G needle (1‐ to 1.5‐in. length)
  • SpinX columns with collection tubes (Costar)
  • Gene Pulser II and Pulse Controller Plus (Bio‐Rad) and 0.1‐cm electroporation cuvettes
  • 15‐ml polypropylene snap‐top tubes
  • Bacterial shaker
  • Micropipettors with sterile aerosol‐barrier tips
  • SAGE 2000 software (freely available for noncommercial use; see http://www.sagenet.org) and Microsoft Access
  • Additional reagents and equipment for phenol/chloroform extraction using Phase Lock Gel Light (see protocol 5), polymerase chain reaction ( appendix 3F), polyacrylamide gel electrophoresis (see appendix 3A and protocol 8), and agarose gel electrophoresis (see appendix 3A)

Support Protocol 2: Phenol‐Chloroform (PC8) Extraction

  Materials
  • Phase Lock Gel Light (PLG; Eppendorf; purchased in 2‐ or 50‐ml tubes)
  • DNA solution to be extracted
  • PC8 solution (see recipe)

Support Protocol 3: Kinasing of Linkers

  Materials
  • Linkers 1A, 1B, 2A, and 2B (see recipe)
  • LoTE buffer (see recipe)
  • 10× kinase buffer (NEB)
  • 10 mM ATP (NEB)
  • 10 U/µl T4 polynucleotide kinase and 5× ligase buffer
  • 6× Loading Dye Solution (Fermentas)
  • 10‐bp DNA ladder
  • 12% polyacrylamide gel (see protocol 8)
  • 10 mg/ml ethidium bromide
  • 1.5‐ to 1.7‐ml RNAse/DNAse‐free microcentrifuge tube (PGC Scientific or other supplier)
  • 16°, 50°, and 65°C water baths or heating blocks
  • Additional reagents and equipment for polyacrylamide gel electrophoresis (see protocol 8)

Support Protocol 4: Gel‐Shift Test for Complete Biotinylation of Biotin‐Oligo dT

  Materials
  • Biotinylated oligo(dT) primer (custom‐synthesized, e.g., by Integrated DNA Technologies or core facility; gel‐purified)
  • 1 µg/µl streptavidin
  • 6× Loading Dye Solution (Fermentas)
  • 100‐bp DNA ladder
  • 12% polyacrylamide gel (see protocol 8)
  • 10 mg/ml ethidium bromide

Support Protocol 5: Preparation of Polyacrylamide Gels Used in SAGE Analysis

  Materials
  • 40% polyacrylamide (19:1 acrylamide:bis; Bio‐Rad)
  • 40% polyacrylamide (37.5:1 acrylamide:bis; Bio‐Rad)
  • 10× TAE buffer ( appendix 2A)
  • 10% (w/v) ammonium persulfate (prepare fresh)
  • TEMED
  • XCELL II mini cell (Invitrogen)
  • Gel electrophoresis cassettes with 1.5 mm spacers (Invitrogen)
  • 10‐well combs (Invitrogen)
  • Power Pac 200 power source (Bio‐Rad)
CAUTION: Refer to the manufacturer's instructions for electrophoresis conditions specific for the investigator's apparatus.

Support Protocol 6: Direct Sequencing Using a Commercial Sequencing Kit

  Materials
  • ABI PRISM BigDye Terminator v3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems)
  • 30 ng/µl PCR product to be sequenced (> 600 bp; see protocol 4)
  • 1 pmol/µl M13 forward primer
  • Low‐speed centrifuge with 96‐well plate holder
  • System for PCR using 96‐well plates (e.g., GeneAmp PCR system 9700, Applied Biosystems)
  • Centri‐Sep 96 plate (Princeton Separations)
  • Automated DNA sequencer (e.g., ABI Prism 3100 genetic analyzer system, Applied Biosystems)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Angelastro, J.M., Klimaschewski, L.P., and Vitolo, O.V. 2000. Improved NlaIII digestion of PAGE‐purified 102 bp ditags by addition of a single purification step in both the SAGE and microSAGE protocols. Nucleic Acids Res. 28:E62.
  Bashiardes, S. and Lovett, M. 2001. cDNA detection and analysis. Curr. Opin. Chem. Biol. 5:15‐20.
  Chomczynski, P. and Sacchi, N. 1987. Single‐step method of RNA isolation by acid guanidinium thiocyanate‐phenol‐chloroform extraction. Anal. Biochem. 162:156‐159.
  Datson, N.A., van der Perk‐de Jong, J., van den Berg, M.P., de Kloet, E.R., and Vreugdenhil, E. 1999. MicroSAGE: A modified procedure for serial analysis of gene expression in limited amounts of tissue. Nucleic Acids Res. 27:1300‐1307.
  Eberwine, J., Yeh, H., Miyashiro, K., Cao, Y., Nair, S., Finnell, R., Zettel, M., and Coleman, P. 1992. Analysis of gene expression in single live neurons. Proc. Natl. Acad. Sci. U.S.A. 89:3010‐3014.
  Emmert‐Buck, M.R., Bonner, R.F., Smith, P.D., Chuaqui, R.F., Zhuang, Z., Goldstein, S.R., Weiss, R.A., and Liotta, L.A. 1996. Laser capture microdissection. Science 274:998‐1001.
  Ishii, M., Hashimoto, S., Tsutsumi, S., Wada, Y., Matsushima, K., Kodama, T., and Aburatani, H. 2000. Direct comparison of GeneChip and SAGE on the quantitative accuracy in transcript profiling analysis. Genomics 68:136‐143.
  Luo, L., Salunga, R.C., Guo, H., Bittner, A., Joy, K.C., Galindo, J.E., Xiao, H., Rogers, K.E., Wan, J.S., Jackson, M.R., and Erlander, M.G. 1999. Gene expression profiles of laser‐captured adjacent neuronal subtypes. Nat. Med. 5:117‐122.
  Muller, D.K., Martin, C.T., and Coleman, J.E. 1988. Processivity of proteolytically modified forms of T7 RNA polymerase. Biochemistry 27:5763‐5771.
  Neilson, L., Andalibi, A., Kang, D., Coutifaris, C., Strauss, J.F., 3rd, Stanton, J.A., and Green, D.P. 2000. Molecular phenotype of the human oocyte by PCR‐SAGE. Genomics 63:13‐24.
  Peters, D.G., Kassam, A.B., Yonas, H., O'Hare, E.H., Ferrell, R.E., and Brufsky, A.M. 1999. Comprehensive transcript analysis in small quantities of mRNA by SAGE‐lite. Nucleic Acids Res. 27:E39.
  Polyak, K. and Riggins, G.J. 2001. Gene discovery using the serial analysis of gene expression technique: Implications for cancer research. J. Clin. Oncol. 19:2948‐2958.
  Powell, J. 1998. Enhanced concatemer cloning: A modification to the SAGE (Serial Analysis of Gene Expression) technique. Nucleic Acids Res. 26:3445‐3446.
  Sooknanan, R., Howes, M., Read, L., and Malek, L.T. 1994. Fidelity of nucleic acid amplification with avian myeloblastosis virus reverse transcriptase and T7 RNA polymerase. Biotechniques 17:1077‐1080,1083‐1075.
  St. Croix, B., Rago, C., Velculescu, V., Traverso, G., Romans, K.E., Montgomery, E., Lal, A., Riggins, G.J., Lengauer, C., Vogelstein, B., and Kinzler, K.W. 2000. Genes expressed in human tumor endothelium. Science 289:1197‐1202.
  Van Gelder, R.N., von Zastrow, M.E., Yool, A., Dement, W.C., Barchas, J.D., and Eberwine, J.H. 1990. Amplified RNA synthesized from limited quantities of heterogeneous cDNA. Proc. Natl. Acad. Sci. U.S.A. 87:1663‐1667.
  van Kampen, A.H., van Schaik, B.D., Pauws, E., Michiels, E.M., Ruijter, J.M., Caron, H.N., Versteeg, R., Heisterkamp, S.H., Leunissen, J.A., Baas, F., and van der Mee, M. 2000. USAGE: A web‐based approach towards the analysis of SAGE data. Serial Analysis of Gene Expression. Bioinformatics 16:899‐905.
  Velculescu, V.E., Zhang, L., Vogelstein, B., and Kinzler, K.W. 1995. Serial Analysis Of Gene Expression. Science 270:484‐487.
  Velculescu, V.E., Zhang, L., Zhou, W., Vogelstein, J., Basrai, M.A., Bassett, D.E., Jr., Hieter, P., Vogelstein, B., and Kinzler, K.W. 1997. Characterization of the yeast transcriptome. Cell 88:243‐251.
  Virlon, B., Cheval, L., Buhler, J.M., Billon, E., Doucet, A., and Elalouf, J.M. 1999. Serial microanalysis of renal transcriptomes. Proc. Natl. Acad. Sci. U.S.A. 96:15286‐15291.
  Wang, E., Miller, L.D., Ohnmacht, G.A., Liu, E.T., and Marincola, F.M. 2000. High‐fidelity mRNA amplification for gene profiling. Nat. Biotechnol. 18:457‐459.
  Ye, S.Q., Zhang, L.Q., Zheng, F., Virgil, D., and Kwiterovich, P.O. 2000. miniSAGE: Gene expression profiling using serial analysis of gene expression from 1 µg total RNA. Anal. Biochem. 287:144‐152.
  Ying, S.Y., Lui, H.M., Lin, S.L., and Chuong, C.M. 1999. Generation of full‐length cDNA library from single human prostate cancer cells. Biotechniques 27:410‐414.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library