Fluorescence Lifetime Imaging of a Caspase‐3 Apoptosis Reporter

Johanna M. Buschhaus1, Anne E. Gibbons2, Kathryn E. Luker2, Gary D. Luker3

1 Department of Biomedical Engineering, University of Michigan, Ann Arbor, Michigan, 2 Center for Molecular Imaging, Department of Radiology, University of Michigan, Ann Arbor, Michigan, 3 Department of Microbiology and Immunology, University of Michigan, Ann Arbor, Michigan
Publication Name:  Current Protocols in Cell Biology
Unit Number:  Unit 21.12
DOI:  10.1002/cpcb.36
Online Posting Date:  December, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Caspase‐3 is a proteolytic enzyme that functions as a key effector in apoptotic cell death. Determining activity of caspase‐3 provides critical information about cancer cell viability and response to treatment. To measure apoptosis in intact cells and living mice, a fluorescence imaging reporter that detects caspase‐3 activity by Förster resonance energy transfer (FRET) was used. Changes in FRET by fluorescence lifetime imaging microscopy (FLIM) were measured. Unlike FRET measurements based on fluorescence intensity, lifetime measurements are independent of reporter concentration and scattering of light in tissue, making FLIM a robust method for imaging in 3D environments. Apoptosis of breast cancer cells in 2D culture, spheroids, and in vivo murine breast tumor xenografts in response to a variety of genetic and pharmacologic methods implicated in apoptosis of cancer cells was studied. This approach for quantifying apoptosis of cancer cells is based on caspase‐3 activity at single‐cell resolution using FLIM. © 2017 by John Wiley & Sons, Inc.

Keywords: apoptosis; breast cancer; caspase‐3; fluorescence lifetime imaging; Förster resonance energy transfer

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Cell Culture and Generation of Stable Cell Lines
  • Basic Protocol 2: Experimental Setup
  • Basic Protocol 3: Metabolic Flux Studies
  • Basic Protocol 4: FLIM and Data Analysis
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Cell Culture and Generation of Stable Cell Lines

  Materials
  • Cell lines:
  • HEK 293T cells (293T, ATCC® CRL‐3216™)
  • MDA‐MB‐231 breast cancer cells (231, ATCC® HTB‐26™)
  • Immortalized human bone marrow cell line HS‐5 (HS‐5, ATCC® CRL‐11882™)
  • Immortalized human bone marrow cell line HS‐27a (HS‐27a, ATCC® CRL‐2496™)
  • Dulbecco's modified Eagle medium with high glucose and pyruvate (DMEM, Gibco®, cat. no. 11995‐065)
  • Standard fetal bovine serum (FBS, HyClone™, cat. no. SH300088.03)
  • 100x penicillin/streptomycin/glutamine (Gibco®, cat. no. 10378‐016)
  • 0.25% Trypsin‐EDTA (Gibco®, cat. no. 25200‐056)
  • 1× sterile phosphate buffered saline, pH 7.4 (PBS, Gibco®, cat. no. 10010‐049)
  • pcDNA™6/V5‐His A, B, & C Mammalian Expression Vectors (pcDNA, Invitrogen™, cat. no. V220‐20)
  • PCR primers for blasticidin reading frame amplification (IDT® or similar vendor)
  • 5′‐GTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCAAGCCTTTG TCTC‐3′
  • 5′‐ CCAGACGCGTTCAATTAATTAGCCCTCCCACACATAACCAG‐3′
  • Lentiviral vector pLVX IRES puromycin (Clontech, cat. no. 632183)
  • Fluorescent protein LSS‐mOrange (gift of V. Verkhusha, Albert Einstein College of Medicine)
  • PCR primers for LSS‐mOrange amplification (IDT® or similar vendor)
  • 5′‐ATGCGCTAGCGCCACCATGGTGAGCAAGGGCGAGGAG‐3′
  • 5′‐GCATGCGGCCGCTTACTTGTACAGCTCGTCCATGCCGC‐3′
  • Blasticidin S HCl, powder (ThermoFisher Scientific, cat. no. R21001)
  • Fluorescent protein LSS‐mOrange‐DEVD‐mKate2 (gift of V. Verkhusha, Albert Einstein College of Medicine)
  • Super PiggyBac Transposase expression vector (Systems Bioscience, cat. no. PB210PA‐1)
  • α‐tri‐Calcium phosphate (Sigma‐Aldrich®, cat. no. 50553)
  • FuGENE® 6 Transfection Reagent (Promega, cat. no. E2691)
  • PB‐CMV‐MCS‐EF1‐Puro cDNA cloning and expression vector (Systems Bioscience, cat. no. PB510B‐1)
  • 37ºC, 5% CO 2 incubator
  • Flow cytometer
  • Additional reagents and equipment for PCR and DNA restriction enzyme digestion and ligations

Basic Protocol 2: Experimental Setup

  Additional Materials (also see protocol 1)
  • Plasmid encoding pro‐apoptotic protein BAX (gift of S. Galbán, University of Michigan)
  • Empty plasmid vector
  • Trametinib (GSK112021, SelleckChem©, cat. no. S2673)
  • Staurosporine (Cell Signaling Technology®, cat. no. 9953S)
  • Dimethyl sulfoxide (DMSO, Corning®, cat. no. 25‐950‐CQC)
  • Dulbecco's modified Eagle's medium without glucose, glutamine, or phenol red (Gibco®, cat. no. A1443001)
  • Standard fetal bovine serum (FBS, HyClone™, cat. no. SH300088.03)
  • L‐Glutamine, 200 nM (Gibco®, cat. no. 25030081)
  • Glucose solution (Gibco®, cat. no. A2494001)
  • Sodium pyruvate, 100× (Gibco®, cat. no. 11360‐070)
  • Sodium dichloroacetate (DCA, Sigma‐Aldrich®, cat. no. 347795)
  • Dulbecco's modified Eagle's medium with high glucose and without phenol red (PRF DMEM, Gibco®, cat. no. 31053‐028)
  • Penicillin/streptomycin/glutamine, 100× (P/S/G, Gibco®, cat. no. 10378‐016)
  • 0.9% (w/v) NaCl solution, sterile
  • 12‐ to 14‐week‐old female NSG mice (The Jackson Laboratory)
  • Carboxymethylcellulose, sodium salt, low‐viscosity (Calbiochem, cat. no. 217277)
  • Tween® 80 (Sigma‐Aldrich®, cat. no. P4780‐100ML)
  • Isoflurane
  • Depilatory solution (e.g., Nair™)
  • 10% formalin
  • Cleaved caspase‐3 (Asp175) antibody (Cell Signaling Technology ®, cat. no. 9661)
  • H&E
  • 6‐well plates
  • 384‐well, low‐volume, black round‐bottom polystyrene NBS™ microplates, non‐sterile (Corning®, cat. no. 3676)
  • UV source
  • Transfer, imaging, and analysis (TRIM) plates (Cavnar, Salomonsson, Luker, Luker, & Takayama, )
  • Microscope
  • Small animal shaver (Wahl compact cordless trimmer or similar instrument)
  • Various surgical instruments

Basic Protocol 3: Metabolic Flux Studies

  Materials
  • MDA‐MB‐231 breast cancer cells (231, ATCC® HTB‐26™)
  • Dulbecco's modified Eagle's medium with high glucose and pyruvate (DMEM, Gibco®, cat. no. 11995‐065)
  • Standard fetal bovine serum (FBS, HyClone™, cat. no. SH300088.03)
  • Seahorse Bioscience XF calibrant (Agilent, cat. no.100840‐000)
  • 100× pyruvate (Gibco®, cat. no. 11360‐070)
  • 100× glutamine (Gibco®, cat. no. 25030‐081)
  • 1 M glucose, dissolved in sterile water (Sigma Aldrich, cat. no. G5767)
  • Seahorse Bioscience XF base medium (Agilent, cat. no. 102353‐100)
  • 0.1 N NaOH
  • Seahorse Bioscience Glycolysis Stress Test kit (Agilent, cat. no. 103017‐100)
  • Seahorse Bioscience XF96 96‐well cell culture microplate (Agilent, cat. no. 101085‐004)
  • 37ºC, 5% CO 2 incubator
  • 37ºC incubator
  • Seahorse XFe96 analyzer
  • Multichannel pipette
  • Seahorse Bioscience Wave program

Basic Protocol 4: FLIM and Data Analysis

  Materials
  • 2‐Photon upright imaging system with variable laser power and compatible 25× objective equipped with an 80 MHz pulsed scanning laser (Spectra Physics Mai Tai‐Deep Sea or comparable product) and 572/15‐nm emission filter
  • Frequency domain instrument for FLIM (FastFLIM, ISS or comparable product)
  • VistaVision Software or comparable product for data analysis (ISS)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Bouchier‐Hayes, L., Muñoz‐Pinedo, C., Connell, S., & Green, D. R. (2008). Measuring apoptosis at the single cell level. Methods, 44(3), 222–228. doi: 10.1016/j.ymeth.2007.11.007.
  Cavnar, S., Salomonsson, E., Luker, K., Luker, G., & Takayama, S. (2014). Transfer, imaging, and analysis plate for facile handling of 384 hanging drop 3D tissue spheroids. Journal of Laboratory Automation, 19(2), 208–214. doi: 10.1177/2211068213504296.
  Hoppe, A., Christensen, K., & Swanson, J. A. (2002). Fluorescence resonance energy transfer‐based stoichiometry in living cells. Biophysical Journal, 83(6), 3652–3664. doi: 10.1016/S0006‐3495(02)75365‐4.
  Jares‐Erijman, E. A., & Jovin, T. M. (2003). FRET imaging. Nature Biotechnology, 21(11), 1387–1395. doi: 10.1038/nbt896.
  Kerr, J. F. R., Wyllie, A. H., & Currie, A. R. (1972). Apoptosis: A basic biological phenomenon with wide‐ranging implications in tissue kinetics. British Journal of Cancer, 26(4), 239–257. doi: 10.1038/bjc.1972.33.
  Kwong, L., Costello, J., Liu, H., Jiang, S., Helms, T., Langsdorf, A., … Chin, L. (2012). Oncogenic NRAS signaling differentially regulates survival and proliferation in melanoma. Nature Medicine, 18(10), 1503–1510. doi: 10.1038/nm.2941.
  Luker, K. E., Mihalko, L. A., Schmidt, B. T., Lewin, S. A., Ray, P., Shcherbo, D., … Luker, G. D. (2012). In vivo imaging of ligand receptor binding with Gaussia luciferase complementation. Nature Medicine, 18(1), 172–177. doi: 10.1038/nm.2590.
  Masedunskas, A., Milberg, O., Porat‐Shliom, N., Sramkova, M., Wigand, T., Amornphimoltham, P., & Weigert, R. (2012). Intravital microscopy: A practical guide on imaging intracellular structures in live animals. Bioarchitecture, 2(5), 143–157. doi: 10.4161/bioa.21758.
  McGlynn, S. P. (1966). Fluorescence and phosphorescence analysis. Principles and applications. Journal of the American Chemical Society, 88(23), 5688–5688. doi: 10.1021/ja00975a083.
  Ouyang, L., Shi, Z., Zhao, S., Wang, F., Zhou, T., Liu, B., & Bao, J. (2012). Programmed cell death pathways in cancer: A review of apoptosis, autophagy and programmed necrosis. Cell Proliferation, 45(6), 487–498. doi: 10.1111/j.1365‐2184.2012.00845.x.
  Salomonnson, E., Mihalko, L., Verkhusha, V., Luker, K., & Luker, G. (2012). Cell‐based and in vivo spectral analysis of fluorescent proteins for multiphoton microscopy. Journal of Biomedical Optics, 17(9), 96001. doi: 10.1117/1.JBO.17.9.096001.
  Shcherbakova, D., Hink, M., Joosen, L., Gadella, T., & Verkhusha, V. (2012). An orange fluorescent protein with a large Stokes shift for single‐excitation multicolor FCCS and FRET imaging. Journal of the American Chemical Society, 134(18), 7913–7923. doi: 10.1021/ja3018972.
  Shrestha, D., Jenei, A., Nagy, P., Vereb, G., & Szöllősi, J. (2015). Understanding FRET as a research tool for cellular studies. International Journal of Molecular Sciences, 16(4), 6718–6756. doi: 10.3390/ijms16046718.
  Suhling, K., Hirvonen, L. M., Levitt, J. A., Chung, P.‐H., Tregidgo, C., Le Marois, A., … Krstajic, N. (2015). Fluorescence lifetime imaging (FLIM): Basic concepts and some recent developments. Medical Photonics, 27, 3–40. doi: https://doi.org/10.1016/j.medpho.2014.12.001.
  Wang, Y., Zhang, B., Liu, W., Dai, Y., Shi, Y., Zeng, Q., & Wang, F. (2016). Noninvasive bioluminescence imaging of the dynamics of sanguinarine induced apoptosis via activation of reactive oxygen species. Oncotarget, 7(16), 22355–22367. doi: 10.18632/oncotarget.7971.
  Wong, R. (2011). Apoptosis in cancer: From pathogenesis to treatment. Journal of Experimental & Clinical Cancer Research, 30, 87. doi: 10.1186/1756‐9966‐30‐87.
  Xiao, A., Gibbons, A., Luker, K., & Luker, G. (2015). Fluorescence lifetime imaging of apoptosis. Tomography, 1(2), 115–124. doi: 10.18383/j.tom.2015.00163.
  Yellen, G., & Mongeon, R. (2015). Quantitative two‐photon imaging of fluorescent biosensors. Current Opinion in Chemical Biology, 27, 24–30. doi: 10.1016/j.cbpa.2015.05.024.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library