Analysis of Copy‐Number Alterations in Single Cells Using Microarray‐Based Comparative Genomic Hybridization (aCGH)

Birte Möhlendick1, Nikolas H. Stoecklein1

1 Department of Surgery (A), Heinrich Heine University and University Hospital Düsseldorf, Düsseldorf
Publication Name:  Current Protocols in Cell Biology
Unit Number:  Unit 22.19
DOI:  10.1002/0471143030.cb2219s65
Online Posting Date:  December, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

In this unit, we describe a workflow that enables array comparative genomic hybridization (aCGH) of single cells. The unit first describes the isolation and preparation of single peripheral mononuclear cells from blood (PBMC) to prepare a suitable reference DNA for aCGH experiments. An alternative procedure is described for the preparation of single cells of GM14667 and GM05423 cell lines to use as reference DNA and for sex‐mismatched control experiments. A guide is also provided for micromanipulation of single cells. Next, the unit describes whole‐genome amplification using adapter‐linker PCR (Ampli1 WGA Kit) and an alternative nonlinear WGA method (PicoPLEX WGA Kit) for single‐cell amplification. A protocol is also included for reamplification of Ampli1 WGA products, which can be used for aCGH as well. Finally, the use of 4 × 180k oligonucleotide microarrays to perform aCGH with single‐cell WGA products is described. Curr. Protoc. Cell Biol. 65:22.19.1‐22.19.23. © 2014 by John Wiley & Sons, Inc.

Keywords: single‐cell analysis; aCGH; whole genome amplification; adapter‐linker‐PCR; copy‐number alterations

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Preparation and Isolation of Single Mononuclear Cells from Peripheral Blood
  • Alternate Protocol 1: Preparation and Isolation of Single Cells from Cell Lines
  • Support Protocol 1: Isolation of Single Cells by Micromanipulation
  • Basic Protocol 2: Amplification of Single‐Cell DNA Using Adapter‐Linker PCR
  • Support Protocol 2: Reamplification of Ampli1 WGA Products
  • Alternate Protocol 2: Amplification of Single‐Cell DNA Using the PicoPLEX WGA Kit
  • Support Protocol 3: Quality Control of Single‐Cell WGA Products
  • Basic Protocol 3: Comparative Genomic Hybridization on Oligonucleotide Microarrays (ACGH)
  • Reagents and Solutions
  • Commentary
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation and Isolation of Single Mononuclear Cells from Peripheral Blood

  Materials
  • Blood sample in EDTA tube (BD Vacutainer Collection Tubes)
  • Dulbecco's phosphate‐buffered saline (DPBS), pH 7.4 ( appendix 2A)
  • Ficoll‐Paque Plus (GE Healthcare, cat. no. 17‐1440‐03; store at 4°C)
  • Fetal bovine serum (FBS)
  • 15‐ml conical centrifuge tubes (e.g., Corning Falcon)
  • Centrifuge
  • 5‐cm‐diameter petri dishes
  • Inverted microscope equipped with a 10× to 20× objective and a 10× ocular
  • 200‐μl PCR tubes
  • Lysis Reaction Mix (see protocol 1, step 2) or extraction cocktail (see protocol 6, step 1)

Alternate Protocol 1: Preparation and Isolation of Single Cells from Cell Lines

  Materials
  • Cell line sample: GM14667 (“LCL male”) or GM05423 (“LCL female”), growing in suspension, cultured according to supplier (Coriell Institute For Medical Research)
  • Dulbecco's phosphate‐buffered saline (DPBS), pH 7.4 ( appendix 2A)
  • 15‐ml conical centrifuge tubes (e.g., Corning Falcon)
  • Centrifuge

Support Protocol 1: Isolation of Single Cells by Micromanipulation

  Materials
  • Single‐cell suspension ( protocol 1, steps 1 to 6, or protocol 2)
  • Dulbecco's phosphate‐buffered saline (DPBS; appendix 2A)
  • Fetal bovine serum (FBS)
  • Picking buffer (see recipe)
  • Lysis Reaction Mix (see protocol 4) or Extraction Cocktail (see protocol 6)
  • Chamber slides, 4‐well (Thermo Scientific, cat. no. 177399)
  • Inverted microscope (up to 400× magnification) equipped with micromanipulator (Eppendorf, cat. no. 920000011)
  • Chamber slides, 8‐well (Thermo Scientific, cat. no. 177402)

Basic Protocol 2: Amplification of Single‐Cell DNA Using Adapter‐Linker PCR

  Materials
  • Ampli1 WGA Kit (Silicon Biosystems) including (for 50 reactions):
    • R1 Reaction Buffer 1
    • R2 Reagent 2
    • R3 Reagent 3
    • R4 Reagent 4
    • R5 Reagent 5
    • R6 Reagent 6
    • R7 Reaction Buffer 7
    • R8 Reagent 8
    • H 2O
    • E1 Enzyme 1
    • E2 Enzyme 2
    • E3 Enzyme 3
    • E4 Enzyme 4
  • Single cell (in 1 μl picking buffer) in 2 μl Lysis Reaction Mix (prepared according to protocol 1, protocol 2, or protocol 3)
  • 200‐μl PCR reaction tubes
  • Thermal cycler

Support Protocol 2: Reamplification of Ampli1 WGA Products

  Materials
  • Buffer 2 (Roche, cat. no. 11681 842001)
  • dNTP mix (New England Biolabs, cat. no. N0447)
  • 50 mM MgCl 2 (supplied with the Taq polymerase)
  • 100 μM LIB1 (5′‐AGTGGGATTCCTGCTGTCAGT‐3′)
  • 5 U/μl Taq DNA polymerase (Life Technologies, cat. no. 18038‐026)
  • Primary WGA product
  • 200‐μl PCR reaction tubes
  • Thermal cycler

Alternate Protocol 2: Amplification of Single‐Cell DNA Using the PicoPLEX WGA Kit

  Materials
  • Single cell (in 1 μl picking buffer or DPBS) in 4 μl Cell Extraction Cocktail (prepared according to protocol 1, protocol 2, or protocol 3)
  • PicoPLEXWGA Kit (New England Biolabs, cat. no. E2620S/L)
    • Contents (sufficient for 12/50 reactions)
    • Cell Extraction Buffer
    • Extraction Enzyme Dilution Buffer
    • Cell Extraction Enzyme
    • Pre‐Amp Reaction Mix
    • Pre‐Amp Enzyme
    • Amplification Reaction Mix
    • Amplification Enzyme
    • Nuclease‐Free H 2O
  • 200‐μl PCR reaction tubes
  • Thermal cycler

Support Protocol 3: Quality Control of Single‐Cell WGA Products

  Materials
  • DreamTaq Green PCR Master Mix (Thermo Scientific, cat. no. K1081)
  • 10× primer mix (see recipe)
  • WGA DNA products (see protocols above)
  • Non‐amplified genomic DNA (positive control)
  • 1× TBE buffer (see appendix 2A)
  • GeneRuler 100 bp Plus DNA Ladder, 100 to 3000 bp (Thermo Scientific, cat. no. SM0323)
  • 200‐μl PCR reaction tubes
  • Thermal cycler
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, 2000)

Basic Protocol 3: Comparative Genomic Hybridization on Oligonucleotide Microarrays (ACGH)

  Materials
  • WGA products (see protocols above)
  • 1× TE buffer, pH 8.0 (molecular grade; Promega, cat. no. V6231)
  • SureTag Complete DNA Labeling Kit (Agilent Technologies, cat. no. 5190‐4240; sufficient for labeling of 50 samples) including:
    • Random Primers
    • Exo‐Klenow
    • Cyanine 3‐dUTP
    • Cyanine 5‐dUTP
    • 10× dNTP Mix
    • 5× Reaction Buffer
    • Nuclease‐free Water
    • Purification Columns
  • Oligo aCGH/ChIP‐on‐Chip Hybridization Kit (Agilent Technologies, cat. no. 5188‐5220; sufficient for 25 slides) including:
    • 2× Hi‐RPM Hybridization Buffer
    • 1× Oligo aCGH/ChIP‐on‐Chip Blocking Agent
  • Human C Ot‐1 DNA (Array‐Grade KREAcot DNA, Kreatech, cat. no. EA‐020, or equivalent)
  • Oligo aCGH/ChIP‐on‐Chip Wash Buffer Kit, containing Wash Buffer #1 and #2 (Agilent Technologies, cat. no. 5188‐5226)
  • Acetonitrile, anhydrous, 99.8% (Sigma‐Aldrich, cat. no. 271004‐1L)
  • Stabilization & Drying Solution (Agilent Technologies, cat. no. 5185‐5979)
  • 1.5‐ml reaction tubes (amber, for light protection, Eppendorf, cat. no. 0030120191, or equivalent)
  • Amicon Ultra‐0.5, Ultracel‐30 Membrane, 30 kDa purification columns (Merck Millipore, cat. no. UFC503008)
  • Infinite 200 PRO NanoQuant spectrometer (Tecan, or equivalent), equipped with 16‐well NanoQuant microplate, with i‐control V1.9 (or higher) software
  • 200‐μl PCR reaction tubes
  • Thermal cycler
  • Heat block
  • Microarray Hybridization Oven (Agilent Technologies, cat. no. G2545A)
  • Hybridization Oven Rotator Rack (Agilent Technologies, cat. no. G2530‐60029)
  • Hybridization Gasket Slide Kit/Backing: four microarrays per slide format (Agilent Technologies, cat. no. G2534‐60011; five slides)
  • SurePrint G3 Human CGH Microarray Kit, 4 × 180K (Agilent Technologies, cat. no. G4449A, 12 samples)
  • Hybridization Chamber Kit—SureHyb enabled, stainless (Agilent Technologies, cat. no. G2534A)
  • Slide‐staining dish (250 ml), with slide rack
  • Ozone‐Barrier Slide Cover (Agilent Technologies, cat. no. G2505‐90550)
  • Forceps
  • Magnetic stirrer
  • SureScan Microarray Scanner (Agilent Technologies) and Scan Control software
  • Feature Extraction Software (Agilent Technologies)
  • Genomic Workbench Software (Agilent Technologies)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Bi, W., Breman, A., Shaw, C.A., Stankiewicz, P., Gambin, T., Lu, X., Cheung, S.W., Jackson, L.G., Lupski, J.R., Van den Veyver, I.B., and Beaudet, A.L. 2012. Detection of ≥1 Mb microdeletions and microduplications in a single cell using custom oligonucleotide arrays. Prenat. Diagn. 32: 10‐20.
  Curtis, C., Lynch, A.G., Dunning, M.J., Spiteri, I., Marioni, J.C., Hadfield, J., Chin, S.‐F., Brenton, J.D., Tavaré, S., and Caldas, C. 2009. The pitfalls of platform comparison: DNA copy number array technologies assessed. BMC Genomics 10:588.
  Czyż, Z.T., Hoffmann, M., Schlimok, G., Polzer, B., and Klein, C.A. 2014. Reliable single cell array CGH for clinical samples. PLoS One 9:e85907.
  Du Manoir, S., Speicher, M.R., Joos, S., Schröck, E., Popp, S., Döhner, H., Kovacs, G., Robert‐Nicoud, M., Lichter, P., and Cremer, T. 1993. Detection of complete and partial chromosome gains and losses by comparative genomic in situ hybridization. Hum. Genet. 90:590‐610.
  Fiegler, H., Geigl, J.B., Langer, S., Rigler, D., Porter, K., Unger, K., Carter, N.P., and Speicher, M.R. 2007. High resolution array‐CGH analysis of single cells. Nucleic Acids Res. 35:e15.
  Fuhrmann, C., Schmidt‐Kittler, O., Stoecklein, N.H., Petat‐Dutter, K., Vay, C., Bockler, K., Reinhardt, R., Ragg, T., and Klein, C.A. 2008. High‐resolution array comparative genomic hybridization of single micrometastatic tumor cells. Nucleic Acids Res. 36:e39.
  Gangnus, R., Langer, S., Breit, E., Pantel, K., and Speicher, M.R. 2004. Genomic profiling of viable and proliferative micrometastatic cells from early‐stage breast cancer patients. Clin. Cancer Res. 10:3457‐3464.
  Geigl, J.B. and Speicher, M.R. 2007. Single‐cell isolation from cell suspensions and whole genome amplification from single cells to provide templates for CGH analysis. Nat. Protoc. 2:3173‐3184.
  Geigl, J.B., Obenauf, A.C., Waldispuehl‐Geigl, J., Hoffmann, E.M., Auer, M., Hörmann, M., Fischer, M., Trajanoski, Z., Schenk, M.A., Baumbusch, L.O., and Speicher, M.R. 2009. Identification of small gains and losses in single cells after whole genome amplification on tiling oligo arrays. Nucleic Acids Res. 37:e105.
  Hjortland, G.O., Meza‐Zepeda, L.A., Beiske, K., Ree, A.H., Tveito, S., Hoifodt, H., Bohler, P.J., Hole, K.H., Myklebost, O., Fodstad, O., Smeland, S., and Hovig, E. 2011. Genome wide single cell analysis of chemotherapy resistant metastatic cells in a case of gastroesophageal adenocarcinoma. BMC Cancer 11:455.
  Hüsemann, Y., Geigl, J.B., Schubert, F., Musiani, P., Meyer, M., Burghart, E., Forni, G., Eils, R., Fehm, T., Riethmüller, G., and Klein, C.A. 2008. Systemic spread is an early step in breast cancer. Cancer Cell 13: 58‐68.
  Kallioniemi, O.P., Kallioniemi, A., Sudar, D., Rutovitz, D., Gray, J.W., Waldman, F., and Pinkel, D., 1993. Comparative genomic hybridization: A rapid new method for detecting and mapping DNA amplification in tumors. Semin. Cancer Biol. 4:41‐46.
  Kang, Y. and Pantel, K. 2013. Tumor cell dissemination: Emerging biological insights from animal models and cancer patients. Cancer Cell 23:573‐581.
  Klein, C.A. 2013. Selection and adaptation during metastatic cancer progression. Nature 501:365‐372.
  Klein, C.A., Schmidt‐Kittler, O., Schardt, J.A., Pantel, K., Speicher, M.R., and Riethmüller, G. 1999. Comparative genomic hybridization, loss of heterozygosity, and DNA sequence analysis of single cells. Proc. Natl. Acad. Sci. U.S.A. 96:4494‐4499.
  Klein, C.A., Blankenstein, Thomas J F., Schmidt‐Kittler, O., Petronio, M., Polzer, B., Stoecklein, N.H., and Riethmüller, G. 2002. Genetic heterogeneity of single disseminated tumour cells in minimal residual cancer. Lancet 360:683‐689.
  Knijnenburg, J., van der Burg, M., Tanke, H.J., and Szuhai, K. 2007. Optimized amplification and fluorescent labeling of small cell samples for genomic array‐CGH. Cytometry A 71:585‐591.
  Le Caignec, C., Spits, C., Sermon, K., Rycke, M., de Thienpont, B., Debrock, S., Staessen, C., Moreau, Y., Fryns, J.‐P., van Steirteghem, A., Liebaers, I., and Vermeesch, J.R. 2006. Single‐cell chromosomal imbalances detection by array CGH. Nucleic Acids Res. 34:e68.
  Lianidou, E.S., Mavroudis, D., and Pantel, K. 2013. Advances in circulating tumor cells (ACTC): From basic research to clinical practice. Breast Cancer Res. 15:319.
  Mathiesen, R.R., Fjelldal, R., Liestøl, K., Due, E.U., Geigl, J.B., Riethdorf, S., Borgen, E., Rye, I.H., Schneider, I.J., Obenauf, A.C., Mauermann, O., Nilsen, G., Christian Lingjaerde, O., Børresen‐Dale, A.‐L., Pantel, K., Speicher, M.R., Naume, B., and Baumbusch, L.O. 2012. High‐resolution analyses of copy number changes in disseminated tumor cells of patients with breast cancer. Int. J. Cancer 131:E405‐E415.
  Navin, N., Kendall, J., Troge, J., Andrews, P., Rodgers, L., McIndoo, J., Cook, K., Stepansky, A., Levy, D., Esposito, D., Muthuswamy, L., Krasnitz, A., McCombie, W.R., Hicks, J., and Wigler, M. 2011. Tumour evolution inferred by single‐cell sequencing. Nature 472:90‐94.
  Pinkel, D. and Albertson, D.G. 2005. Array comparative genomic hybridization and its applications in cancer. Nat. Genet. 37:S11‐S17.
  Polzer, B. and Klein, C.A. 2013. Metastasis awakening: The challenges of targeting minimal residual cancer. Nat. Med. 19:274‐275.
  Schardt, J.A., Meyer, M., Hartmann, C.H., Schubert, F., Schmidt‐Kittler, O., Fuhrmann, C., Polzer, B., Petronio, M., Eils, R., and Klein, C.A. 2005. Genomic analysis of single cytokeratin‐positive cells from bone marrow reveals early mutational events in breast cancer. Cancer Cell 8:227‐239.
  Schmidt‐Kittler, O., Ragg, T., Daskalakis, A., Granzow, M., Ahr, A., Blankenstein, Thomas J F, Kaufmann, M., Diebold, J., Arnholdt, H., Muller, P., Bischoff, J., Harich, D., Schlimok, G., Riethmuller, G., Eils, R., and Klein, C.A. 2003. From latent disseminated cells to overt metastasis: Genetic analysis of systemic breast cancer progression. Proc. Natl. Acad. Sci. U.S.A. 100:7737‐7742.
  Steinert, G., Schölch, S., Niemietz, T., Iwata, N., García, S.A., Behrens, B., Voigt, A., Kloor, M., Benner, A., Bork, U., Rahbari, N.N., Büchler, M.W., Stoecklein, N.H., Weitz, J., and Koch, M. 2014. Immune escape and survival mechanisms in circulating tumor cells of colorectal cancer. Cancer Res. 74:1694‐1704.
  Stoecklein, N.H. and Klein, C.A. 2010. Genetic disparity between primary tumours, disseminated tumour cells, and manifest metastasis. Int. J. Cancer 126:589‐598.
  Stoecklein, N.H., Hosch, S.B., Bezler, M., Stern, F., Hartmann, C.H., Vay, C., Siegmund, A., Scheunemann, P., Schurr, P., Knoefel, W.T., Verde, P.E., Reichelt, U., Erbersdobler, A., Grau, R., Ullrich, A., Izbicki, J.R., and Klein, C.A. 2008. Direct genetic analysis of single disseminated cancer cells for prediction of outcome and therapy selection in esophageal cancer. Cancer Cell 13:441‐453.
  Ulmer, A., Schmidt‐Kittler, O., Fischer, J., Ellwanger, U., Rassner, G., Riethmüller, G., Fierlbeck, G., and Klein, C.A. 2004. Immunomagnetic enrichment, genomic characterization, and prognostic impact of circulating melanoma cells. Clin. Cancer Res. 10:531‐537.
  Ulmer, A., Fischer, J.R., Schanz, S., Sotlar, K., Breuninger, H., Dietz, K., Fierlbeck, G., and Klein, C.A. 2005. Detection of melanoma cells displaying multiple genomic changes in histopathologically negative sentinel lymph nodes. Clin. Cancer Res. 11:5425‐5432.
  Ulmer, A., Dietz, K., Hodak, I., Polzer, B., Scheitler, S., Yildiz, M., Czyz, Z., Lehnert, P., Fehm, T., Hafner, C., Schanz, S., Röcken, M., Garbe, C., Breuninger, H., Fierlbeck, G., and Klein, C.A. 2014. Quantitative measurement of melanoma spread in sentinel lymph nodes and survival. PLoS Med. 11:e1001604.
  van Loo, P. and Voet, T. 2014. Single cell analysis of cancer genomes. Curr. Opin. Genet. Dev. 24:82‐91.
  Vanneste, E., Bittman, L., Van der Aa, N., Voet, T., and Vermeesch, J.R. 2012. New array approaches to explore single cells genomes. Front. Genet. 3:44.
  Voytas, D. 2001. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1–2.5A.9.
  Walsh, P.S., Erlich, H.A., and Higuchi, R. 1992. Preferential PCR amplification of alleles: Mechanisms and solutions. PCR Methods Appl. 1:241‐250.
  Weckermann, D., Polzer, B., Ragg, T., Blana, A., Schlimok, G., Arnholdt, H., Bertz, S., Harzmann, R., and Klein, C.A. 2009. Perioperative activation of disseminated tumor cells in bone marrow of patients with prostate cancer. J. Clin. Oncol. 27:1549‐1556.
  Ylstra, B., van den Ijssel, Paul, Carvalho, B., Brakenhoff, R.H., and Meijer, G.A. 2006. BAC to the future! or oligonucleotides: A perspective for micro array comparative genomic hybridization (array CGH). Nucleic Acids Res. 34:445‐450.
Key References
  Klein, et al., 1999. See above.
  First description of whole‐genome amplification of single‐cell DNA by adapter‐linker PCR.
  Möhlendick, B., Bartenhagen, C., Behrens, B., Honisch, E., Raba, K., Knoefel, W.T., and Stoecklein, N.H. 2013. A robust method to analyze copy number alterations of less than 100 kb in single cells using oligonucleotide array CGH. PLoS One 8:e67031.
  Original description of the protocol for oligonucleotide aCGH using WGA products from single cells amplified by adapter‐linker PCR.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library