Mapping Replication Origin Sequences in Eukaryotic Chromosomes

Haiqing Fu1, Emilie Besnard2, Romain Desprat3, Michael Ryan4, Malik Kahli2, Jean‐Marc Lemaitre3, Mirit I. Aladjem1

1 Developmental Therapeutics Branch, Center for Cancer Research, National Cancer Institute, Bethesda, Maryland, 2 Laboratory of Genome Plasticity and Aging, Institute of Functional Genomics, Montpellier, France, 3 Institute of Regenerative Medicine and Research in Biotherapies, Stem Cell Core Facility, Saint‐Eloi Hospital, Montpellier, France, 4 InSilico Inc, Falls Church, Virginia
Publication Name:  Current Protocols in Cell Biology
Unit Number:  Unit 22.20
DOI:  10.1002/0471143030.cb2220s65
Online Posting Date:  December, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Recent advances in genome‐sequencing technology have led to the complete mapping of DNA replication initiation sites in the human genome. This thorough origin mapping facilitates understanding of the relationship between replication initiation events, transcription, and chromatin modifications, and allows the characterization of consensus sequences of potential replication origins. This unit provides a detailed protocol for isolation and sequence analysis of nascent DNA strands. Two variations of the protocol based on non‐overlapping assumptions are described below, addressing potential bias issues for whole‐genome analyses. © 2014 by John Wiley & Sons, Inc.

Keywords: DNA replication; replication origins; next‐generation sequencing (NGS)

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Exonuclease‐Facilitated SNS Abundance Assay
  • Alternate Protocol 1: BrdU Labeling and Immunoprecipitation
  • Support Protocol 1: Phenol Chloroform Extraction
  • Support Protocol 2: Lambda Exonuclease Digestion with a Plasmid Control
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Exonuclease‐Facilitated SNS Abundance Assay

  Materials
  • Adherent or suspension cells in logarithmic growth phase
  • Phosphate‐buffered saline (PBS; Life Technologies, cat. no. 10010‐0123)
  • 2× SDS lysis buffer (see recipe)
  • 25 mg/ml proteinase K (RNA grade; Life Technologies, cat. no. 25530‐049) stock solution
  • 25:24:1 phenol:chloroform:isoamyl alcohol
  • 3 M sodium acetate, pH 5.2 ( appendix 2A)
  • 2 M sodium chloride (optional)
  • 70%, 75%, and 100% ethanol
  • DEPC‐treated H 2O ( appendix 2A)
  • DNAzol reagent (Life Technologies, cat. no. 10503‐027)
  • TE buffer, pH 8.0 ( appendix 2A)
  • 40 U/μl RNasin ribonuclease inhibitor (Promega, cat. no. N2511 or N2515)
  • 5% sucrose (see recipe)
  • 30% sucrose (see recipe)
  • Molecular weight ladder (see recipe)
  • 1.2% denaturing (20 × 25‐cm) or 1.5% nondenaturing (20 × 25‐cm) agarose gel (also see Voytas, )
  • Denaturing gel buffer: 50 mM NaOH/1 mM EDTA in H 2O
  • Nondenaturing gel buffer: 1× TBE buffer
  • Glycogen (Qbiogene, cat. no. GLYCO001)
  • Alkaline loading buffer (see recipe)
  • GelRed Nucleic Acid Gel Stain (Biotium)
  • Polynucleotide kinase (PNK; New England Biolabs, cat. no. M0201S) and 10× PNK buffer (New England Biolabs, cat. no. B0201S)
  • 100 mM ATP
  • 5% (w/v) N‐lauroylsarcosine (Sarkosyl)
  • 2.5× lambda exonuclease buffer (see recipe)
  • 50 U/μl lambda exonuclease (Fermentas, cat. no. EN0563B03)
  • SYBR Green Master Mix (KAPA Biosystems; prepare according to manufacturer's instructions)
  • Primers (Table 22.20.1)
  • 2.5× Random Primer Solution (e.g., Invitrogen, cat. no. Y01393)
  • 10 mM dNTP mix (available from various molecular biology suppliers)
  • Klenow fragment (Invitrogen, cat. no. Y01396)
  • QIAquick PCR purification kit (Qiagen, cat. no. 28104)
  • 37°, 50°, 95°C, and boiling water baths
  • End‐over‐end rotator (e.g., Labnet, cat. no. H5500)
  • Tabletop centrifuge
  • Dounce homogenizer with loose pestle
  • Gradient maker (e.g., Gradient Master from BioComp)
  • Beckman centrifuge with SW28, SW32i, or SW40 rotor and corresponding centrifuge tubes
  • 15‐ml and 50‐ml conical centrifuge tubes (e.g., Corning Falcon)
  • 1.5‐ and 0.5‐ml low‐retention (Lobind) tubes (Eppendorf, cat. no. 033870/033871)
  • RNase‐free PCR tubes
  • Bioruptor (http://www.diagenode.com/) or similar sonicator
  • qPCR machine: Light Cycler 480 (Roche Life Science) and/or 7900HT Real‐Time PCR System (Applied Biosystems)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ), test of endonuclease efficiency ( protocol 4) and phenol/chloroform extraction of DNA ( protocol 3)
Table 2.0.1   MaterialsQuality Control Oligonucleotide Sequences (for Human Cells)

Primer Sequence
C‐Myc ORI
C‐Myc non ORI (I)
Forward primer 5′‐CTTATACATTCCTGACCAAGTTGC‐3′
Reverse primer 5′‐ATAATAATCAAGAATCGGACGTGA‐3′
C‐Myc ORI (II)
Forward primer 5′‐TAACGTTGAGGGGCATCG‐3′
Reverse primer 5′‐GCACCAAGACCCCTTTAACTC‐3′
C‐Myc non ORI (III)
Forward primer 5′‐ATCAGCCTACAAGGCTCCTG‐3′
Reverse primer 5′‐GTGTCTGATCACTTAGATGCCCTA‐3′
DBF4 ORI
DBF4 ORI
Forward primer 5′‐GCCATGAGGATCCACAGTAA‐3′
Reverse primer 5′‐CGAGGGGAGGAAAGGATTA‐3′
Probe 5′‐TCCTCCGCCTGCAGTCCCTT‐3′
DBF4 non ORI
Forward primer 5′‐AAGATTGTGCCACTGCACTC‐3′
Reverse primer 5′‐TGAGGATGGGATGGACATAA‐3′
Probe 5′‐TCTCGCTCTGTTGCCCAGGTG‐3′
JunB ORI
JunB ORI
Forward primer 5′‐GTGTATCCTGCGTCCGTGT‐3′
Reverse primer 5′‐GCCTGCTGTCCTCTGTGA‐3′
JunB non ORI
Forward primer 5′‐CGACACAAGTTAGCCATAGGAA‐3′
Reverse primer 5′‐CCCTGGATGCAAAGGTCTAT‐3′

Alternate Protocol 1: BrdU Labeling and Immunoprecipitation

  Additional Materials (also see protocol 1Basic Protocol)
  • 50 μM 5‐bromo‐2′‐deoxyuridine (BrdU) in growth medium
  • 10× IP buffer: 10× PBS (Life Technologies, cat. no. 70011) containing 0.5% (v/v) Triton X‐100
  • 0.5 mg/ml mouse anti‐BrdU antibody (e.g., BD Pharmingen, cat. no. 555627)
  • Rabbit anti‐mouse IgG (Sigma‐Aldrich, cat. no. M7023‐2ML)
  • Protein G beads (optional; Santa Cruz Biotechnology, cat. no. SC‐2002)
  • Proteinase K buffer (see recipe)
  • Rocking platform

Support Protocol 1: Phenol Chloroform Extraction

  Materials
  • DNA preparation to be purified
  • 25:24:1 phenol:chloroform:isoamyl alcohol
  • 3 M sodium acetate, pH 5.2 ( appendix 2A) or 2 M sodium chloride
  • 100% and 75% ethanol

Support Protocol 2: Lambda Exonuclease Digestion with a Plasmid Control

  Materials
  • pBlueScript plasmid
  • EcoRV restriction endonuclease
  • Calf intestinal phosphatase (CIP)
  • Qiagen PCR Purification Kit
  • 100 mM ATP
  • T4 kinase and 10× kinase buffer (New England Biolabs)
  • TE‐saturated phenol/chloroform, pH 8.0 (available from molecular biology providers)
  • Chloroform
  • 3 M sodium acetate, pH 5.2 ( appendix 2A)
  • 100% and 70% ethanol
  • DEPC‐treated H 2O ( appendix 2A)
  • 2.5× lambda exonuclease buffer (see recipe)
  • 5 U/μl lambda exonuclease (prepare using 50 U/μl lambda exonuclease (Fermentas, cat. no. EN0563B03 or New England Biolabs, cat. no. M0262S))
  • Molecular weight ladder (see recipe)
  • 65°C water bath
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Besnard, E., Babled, A., Lapasset, L., Milhavet, O., Parrinello, H., Dantec, C., Marin, J.M., and Lemaitre, J.M. 2012. Unraveling cell type‐specific and reprogrammable human replication origin signatures associated with G‐quadruplex consensus motifs. Nat. Struct. Mol. Biol. 19:837‐844.
  Bielinsky, A.K. and Gerbi, S.A. 1998. Discrete start sites for DNA synthesis in the yeast ARS1 origin. Science 279:95‐98.
  Cleary, J.D., Tome, S., Lopez Castel, A., Panigrahi, G.B., Foiry, L., Hagerman, K.A., Sroka, H., Chitayat, D., Gourdon, G., and Pearson, C.E. 2010. Tissue‐ and age‐specific DNA replication patterns at the CTG/CAG‐expanded human myotonic dystrophy type 1 locus. Nat. Struct. Mol. Biol. 17:1079‐1087.
  Martin, M.M., Ryan, M., Kim, R., Zakas, A.L., Fu, H., Lin, C.M., Reinhold, W.C., Davis, S.R., Bilke, S., Liu, H., Doroshow, J.H., Reimers, M.A., Valenzuela, M.S., Pommier, Y., Meltzer, P.S., and Aladjem, M.I. 2011. Genome‐wide depletion of replication initiation events in highly transcribed regions. Genome Res. 21:1822‐1832.
  Mukhopadhyay, R., Lajugie, J., Fourel, N., Selzer, A., Schizas, M., Bartholdy, B., Mar, J., Lin, C.M., Martin, M.M., Ryan, M., Aladjem, M.I., and Bouhassira, E.E. 2014. Allele‐specific genome‐wide profiling in human primary erythroblasts reveal replication program organization. PLoS Genetics 10:e1004319.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library