Differentiation of Mouse Embryonic Stem Cells and of Human Adult Stem Cells into Adipocytes

Brigitte Wdziekonski1, Phi Villageois1, Christian Dani1

1 CNRS Université de Nice Sophia Antipolis, Nice
Publication Name:  Current Protocols in Cell Biology
Unit Number:  Unit 23.4
DOI:  10.1002/0471143030.cb2304s34
Online Posting Date:  March, 2007
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The authors describe protocols for culture conditions in which mouse ES cells can be maintained in an undifferentiated state or committed to undergo adipocyte differentiation at a high rate and in a highly reproducible fashion. There is also a protocol for maintaining and differentiating human adult stem cells, isolated form adipose tissue and from bone marrow, into adipocytes. These culture systems provide a powerful means for studying the first step of adipose cell development and a means to investigate effects of drugs on the biology of adipocytes. There are also protocols for detection of adipocytes and analysis of their gene expression.

Keywords: adipocyte; stem cells; adult stem cells; differentiation

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Differentiation of Mouse ES Cells to Adipocytes
  • Support Protocol 1: Maintenance of Mouse ES Cells Without Feeder Layers
  • Basic Protocol 2: Differentiation of Human Multipotent Adipose‐Derived Stem (hMADS) Cells to Adipocytes
  • Alternate Protocol 1: Differentiation of Human MS Cells to Adipocytes
  • Support Protocol 2: Maintenance of Human Mads and Human MS Cells Without Feeder Layer
  • Support Protocol 3: Visualization of Adipocytes
  • Support Protocol 4: Analysis of Adipocyte Gene Expression
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Differentiation of Mouse ES Cells to Adipocytes

  Materials
  • ES cells
  • Growth medium for mES cells (see recipe)
  • Leukemia inhibitory factor (LIF)
  • CMF‐PBS (phosphate‐buffered saline, calcium and magnesium free; Cambrex)
  • Trypsin solution (see recipe)
  • Fetal bovine serum (FBS, see recipe)
  • Retinoic acid (RA, see recipe)
  • Differentiation medium for mES cells (see recipe)
  • 60‐ and 100‐mm bacteriological grade petri dishes (Greiner)
  • 20‐ml conical sterile tube
  • 100‐mm gelatinized‐tissue culture dishes (see recipe)
  • Additional reagents and equipment for cell counting (unit 1.1)

Support Protocol 1: Maintenance of Mouse ES Cells Without Feeder Layers

  Materials
  • ES cells in 25‐cm2 flasks (up to passage 25)
  • CMF‐PBS (phosphate‐buffered saline, calcium and magnesium free; Cambrex)
  • 1× trypsin solution (see recipe)
  • Growth medium for mES cells (see recipe)
  • Leukemia inhibitory factor (Chemicon, Invitrogen)
  • 20‐ml conical centrifuge tubes, sterile
  • Gelatinized tissue culture 25‐cm2 flasks (see recipe)
  • Additional reagents and equipment for cell counting (unit 1.1)

Basic Protocol 2: Differentiation of Human Multipotent Adipose‐Derived Stem (hMADS) Cells to Adipocytes

  Materials
  • Adult stem cells: hMADS (for isolation of hMADS cells see Rodriguez et al., ; Zaragosi et al., )
  • Growth medium for hMADS cells (see recipe)
  • Differentiation medium for hMADS cells (see recipe)
  • Tissue culture 100‐mm dishes (Greiner, S.A. Dutscher) or 6‐well plates or 12‐well plates

Alternate Protocol 1: Differentiation of Human MS Cells to Adipocytes

  Materials
  • Adult stem cells: hMS cells (for isolation of adult stem cells from bone marrow see Pittenger et al., )
  • Growth medium for hMS cells (see recipe)
  • Differentiation medium for hMS cells (see recipe)
  • Tissue culture 100‐mm dishes or 6‐well plates or 12‐well plates (Greiner; S.A. Dutscher)

Support Protocol 2: Maintenance of Human Mads and Human MS Cells Without Feeder Layer

  Materials
  • hMADS or hMS cells (for isolation of hMADS see Rodriguez et al., ; for isolation of hMS cells see Pittenger et al., )
  • Phosphate‐buffered saline, calcium and magnesium free (CMF‐PBS, Cambrex)
  • 1× trypsin ‐EDTA solution (Invitrogen no:25300‐054)
  • Growth medium for hMADS and hMS cells (see recipe)
  • Tissue culture 100‐mm dishes (Greiner; S.A. Dutscher)
  • 20‐ml conical centrifuge tubes, sterile
  • Additional reagents and equipment for cell counting (unit 1.1)

Support Protocol 3: Visualization of Adipocytes

  Materials
  • Cultures to be examined
  • CMF‐PBS (phosphate‐buffered saline, calcium and magnesium free; Cambrex)
  • Fixation buffer (see recipe)
  • Oil‐red O solution (see recipe)
  • Storage solution: 70% glycerol (v/v) in H 2O
  • Oil‐red O elution buffer (see recipe)
  • Spectrophotometer

Support Protocol 4: Analysis of Adipocyte Gene Expression

  Materials
  • TRI Reagent (Molecular Research Center, Euromedex, France)
  • Chloroform
  • Isopropanol
  • 100% ethanol
  • 5 M NaCl, sterile
  • TES buffer (see recipe)
  • RT‐PCR kit (available from several companies)
  • Primers to reveal mouse a‐FABP gene expression:
    • forward: 5′‐GATGCCTTTGTGGGAACCTGG‐3′
    • reverse: 5′‐TTCATCGAATTCCACGCCCAG‐3′
  • Mouse hypoxanthine phosphoribosyltransferase (HPRT, as a standard to balance the amount of RNA and cDNA used):
    • forward: 5′‐GCTGGTGAAAAGGACCTCT‐3′
    • reverse: 5′‐CACAGGACTAGAACACCTGC‐3′
  • Primers to reveal human a‐FABP gene expression:
    • forward: 5′‐GCTTTGCCACCAGGAAAGTG‐3′
    • reverse: 5′‐ATGACGCATTCCACCACCAG‐3′
  • Human β‐actin as a housekeeping gene standard:
    • forward: 5′‐AGCCATGTACGTTGCTA‐3′
    • reverse: 5′‐AGTCCGCCTAGAAGCA‐3′
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Ailhaud, G. 2002. Autocrine/paracrine effectors of adipogenesis. Ann. Endocrinol. (Paris) 63:83‐85.
   Dani, C. 1999. Embryonic stem cell‐derived adipogenesis. Cells Tissues Organs 165:173‐180.
   Dani, C., Smith, A., Dessolin, S., Leroy, P., Staccini, L., Villageois, P., Darimont, C., and Ailhaud, G. 1997. Differentiation of embryonic stem cells into adipocytes in vitro. J. Cell Sci. 110:1279‐1285.
   Darimont, C., Zbinden, I., Avanti, O., Leone‐Vautravers, P., Giusti, V., Burckhardt, P., Pfeifer, A.M., and Mace, K. 2003. Reconstitution of telomerase activity combined with HPV‐E7 expression allow human preadipocytes to preserve their differentiation capacity after immortalization. Cell Death Differ. 10:1025‐1031.
   Doetschman, T.C., Eistetter, H., Katz, M., Schmidt, W., and Kemler, R. 1985. The in vitro development of blastocyst‐derived embryonic stem cell lines: Formation of visceral yolk sac, blood islands and myocardium. J. Embryol. Exp. Morphol. 87:27‐45.
   Field, S.J., Johnson, R.S., Mortensen, R.M., Papaioannou, V.E., Spiegelman, B.M., and Greenberg, M.E. 1992. Growth and differentiation of embryonic stem cells that lack an intact c‐fos gene. Proc. Natl. Acad. Sci. U.S.A. 89:9306‐9310.
   Lehmann, J.M., Moore, L.B., Smith, O.T., Wilkison, W.O., Willson, T.M., and Kliewer, S.A. 1995. An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator‐activated receptor gamma (PPAR gamma). J. Biol. Chem. 270:12953‐12956.
   Mandrup, S. and Lane, M.D. 1997. Regulating adipogenesis. J. Biol. Chem. 272:5367‐5370.
   Phillips, B.W., Vernochet, C., and Dani, C. 2003. Differentiation of embryonic stem cells for pharmacological studies on adipose cells. Pharmacol. Res. 47:263‐268.
   Pittenger, M.F., Mackay, A.M., Beck, S.C., Jaiswal, R.K., Douglas, R., Mosca, J.D., Moorman, M.A., Simonetti, D.W., Craig, S., and Marshak, D.R. 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284:143‐147.
   Rodriguez, A.‐M., Elabd, C., Delteil, F., Astier, J., Vernochet, C., Saint‐Marc, P., Guesnet, J., Guezennec, A., Amri, E.‐Z., Dani, C., and Ailhaud, G. 2004. Adipocyte differentiation of multipotent cells established from human adipose tissue. Biochem. Biophys. Res. Commun. 315:255‐263.
   Rodriguez, A.‐M., Pisani, D., Dechesne, C.A., Turc‐Carel, C., Kurzenne, J.‐Y., Wdziekonski, B., Villageois, A., Bagnis, C., Breittmayer, J.‐P., Groux, H., Ailhoud, G., and Dani, C. 2005a. Transplantation of a multipotent cell population from human adipose tissue induces dystrophin expression in the immunocompetent mdx mouse. J. Exp. Med. 201:1397‐1405.
   Rodriguez, A.‐M., Elabd, C., Amri, E.Z., Ailhaud, G., and Dani, C. 2005b. The human adipose tissue is a source of multipotent stem cells. Biochimie 87:125‐128.
   Smith, A.G. 1992. Mouse embryo stem cells: Their identification, propagation and manipulation. Semin. Cell Biol. 3:385‐399.
   Tontonoz, P., Hu, E., Devine, J., Beale, E.G., and Spiegelman, B.M. 1995. PPAR gamma 2 regulates adipose expression of the phosphoenolpyruvate carboxykinase gene. Mol. Cell Biol. 15:351‐357.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
   Wabitsch, M., Bruderlein, S., Melzner, I., Braun, M., Mechtersheimer, G., and Moller, P. 2000. LiSa‐2, a novel human liposarcoma cell line with a high capacity for terminal adipose differentiation. Int. J. Cancer 88:889‐894.
   Wabitsch, M., Brenner, R.E., Melzner, I., Braun, M., Moller, P., Heinze, E., Debatin, K.M., and Hauner, H. 2001. Characterization of a human preadipocyte cell strain with high capacity for adipose differentiation. Int. J. Obes. Relat. Metab. Disord. 25:8‐15.
   Zaragosi, L.E., Ailhaud, G., and Dani, C. 2006. Autocrine fibroblast growth factor 2 signaling is critical for self‐renewal of human multipotent adipose‐derived stem cells. Stem Cells 24:2412‐2419.
   Zilberfarb, V., Pietri‐Rouxel, F., Jockers, R., Krief, S., Delouis, C., Issad, T., and Strosberg, A.D. 1997. Human immortalized brown adipocytes express functional beta3‐adrenoceptor coupled to lipolysis. J. Cell Sci. 110:801‐807.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library