Production of Lentiviral Vectors in Protein‐free Media

Hitoshi Kuroda1, Michael P. Marino2, Robert H. Kutner1, Jakob Reiser2

1 Gene Therapy Program, Louisiana State University Health Sciences Center, New Orleans, Louisiana, 2 Division of Cellular and Gene Therapies, FDA/CBER, Bethesda, Maryland
Publication Name:  Current Protocols in Cell Biology
Unit Number:  Unit 26.8
DOI:  10.1002/0471143030.cb2608s50
Online Posting Date:  March, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The use of lentiviral vectors for transgene delivery in vitro and in vivo for applications in neuroscience, hematology, developmental biology, stem cell biology, and transgenesis has become commonplace. Lentiviral vectors provide an attractive toolfor transgene delivery in part because of their ability to incorporate(integrate)into the genomic DNA of target cells with high efficiency, especially in cells thatare not actively dividing. In addition, lentiviral vector‐mediated transgeneexpression can be maintained for long periods of time. In this unit, we describe protocols for lentiviral vector production in protein‐free media using polyethylenimine (PEI)‐mediated transfection, resulting in consistent lentiviral vector stocks. Such stocks are then concentrated by ultracentrifugation. We also provide reliable QPCR protocols to titrate lentiviral vectors based on vector DNA copies present in genomic DNA extracted from transduced cells. The vector production and titration protocol described here can be completed within 8 days. Curr. Protoc. Cell Biol. 50:26.8.1‐26.8.13. © 2011 by John Wiley & Sons, Inc.

Keywords: lentiviral vector production; protein‐free media; PEI transfection

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Small‐Scale Production of Lentiviral Vector Stocks by Transient Transfection of HEK 293T Cells
  • Basic Protocol 2: Large‐Scale Production of Lentiviral Vector Stocks by Transient Transfection of HEK 293T Cells
  • Support Protocol 1: Titration of Lentiviral Vectors Using Flow Cytometry
  • Support Protocol 2: Titration of Lentivectors by Quantitative PCR (QPCR)
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Small‐Scale Production of Lentiviral Vector Stocks by Transient Transfection of HEK 293T Cells

  Materials
  • 293T human embryonic kidney (HEK) cells (ATCC# CRL‐11268)
  • DMEM high glucose (Invitrogen, cat. no. 11995)
  • Heat‐inactivated fetal bovine serum (FBS; Invitrogen, cat. no. 26140‐079)
  • L‐glutamine (Invitrogen, cat. no 25030)
  • Penicillin‐streptomycin (Invitrogen, cat. no. 15140‐122)
  • Qiagen Plasmid Maxi kit (Qiagen, cat. no. 12163)
  • Plasmids available from Addgene (www.addgene.org) or from the Reiser laboratory ( ):
    • pNL‐EGFP/CMV/WPREΔU3 (second‐generation lentiviral transgene plasmid); Addgene plasmid 17579 (referred to by Addgene as pNL‐EGFP/CMV/WPREdU3)
    • pCD/NL‐BH*ΔΔΔ (second‐generation lentiviral packaging plasmid); Addgene plasmid 17531 (referred to by Addgene as pCD/NL‐BH*DDD)
    • pLTR‐G [second‐generation vesicular stomatitis virus glycoprotein (VSV‐G)‐encoding plasmid]; Addgene plasmid 17532
    • pNL(CMV)EGFP/CMV/PREΔU3.1 (third‐generation lentiviral transgene plasmid)
    • pCD/NL‐BHΔ1 (third‐generation lentiviral packaging plasmid)
    • pCMV‐rev (HIV‐1 Rev‐encoding plasmid) (Lewis et al., )
    • pCEF‐VSV‐G (VSV‐G glycoprotein‐encoding plasmid)
  • 5 M NaCl (molecular‐biology grade; Quality Biological, cat. no. 351‐036‐101)
  • PEI stock solution (see recipe)
  • UltraCULTURE serum‐free medium (Lonza, cat. no. 12‐725F)
  • Ice
  • Crushed dry ice
  • 6‐well cell culture plates (Corning Costar, cat. no. 3506)
  • 37°C, 5% CO 2 tissue culture incubator
  • 5‐ml polypropylene tubes (Falcon, cat. no. 352005)
  • 3‐ml syringe
  • 0.45‐µm filter (Millipore, cat. no. SLHA033SS)
  • 1.5‐ml micro tubes (Sarstedt, cat. no. 72.692.005)

Basic Protocol 2: Large‐Scale Production of Lentiviral Vector Stocks by Transient Transfection of HEK 293T Cells

  Materials
  • 293T human embryonic kidney (HEK) cells (ATCC# CRL‐11268)
  • DMEM high glucose (Invitrogen, cat. no. 11995)
  • Heat‐inactivated fetal bovine serum (FBS; Invitrogen, cat. no. 26140‐079)
  • L‐glutamine (Invitrogen, cat. no 25030)
  • Penicillin‐streptomycin (Invitrogen, cat. no. 15140‐122)
  • Plasmids available from Addgene (www.addgene.org) or from the Reiser laboratory ( ):
    • pNL‐EGFP/CMV/WPREΔU3 (second‐generation lentiviral transgene plasmid); Addgene plasmid 17579
    • pCD/NL‐BH*ΔΔΔ (second‐generation lentiviral packaging plasmid); Addgene plasmid 17531
    • pLTR‐G [second‐generation vesicular stomatitis virus glycoprotein (VSV‐G)‐encoding plasmid]; Addgene plasmid 17532
    • pNL(CMV)EGFP/CMV/PREΔU3.1 (third‐generation lentiviral transgene plasmid)
    • pCD/NL‐BHΔ1 (third‐generation lentiviral packaging plasmid)
    • pCMV‐rev (HIV‐1 Rev‐encoding plasmid) (Lewis et al., )
    • pCEF‐VSV‐G (VSV‐G glycoprotein‐encoding plasmid)
  • 5 M NaCl (molecular‐biology grade; Quality Biological, cat. no. 351‐036‐101)
  • PEI stock solution (see recipe)
  • UltraCULTURE serum‐free medium (Lonza, cat. no. 12‐725F)
  • 70% ethanol
  • 20% (w/v) sucrose solution (see recipe)
  • Phosphate‐buffered saline, calcium‐ and magnesium‐free (CMF‐PBS; Invitrogen, cat. no. 14190)
  • 1 mM EDTA in CMF‐PBS
  • 15‐cm dishes (Nunclon, cat. no. 168381)
  • 50‐ml conical centrifuge tubes (BD Biosciences, cat. no. 352098)
  • 15‐ml conical centrifuge tubes (Greiner Bio‐One, cat. no. 188161)
  • Vortex
  • Benchtop centrifuge
  • Fluorescence microscope
  • 50‐ml tube‐top vacuum filter (Corning, cat. no. 430314)
  • Ultra‐Clear centrifuge tubes (Beckman Coulter, cat. no. 344058)
  • UV light source
  • 10‐ml and 200‐µl pipets
  • SW 32 Ti Swinging‐bucket ultracentrifuge rotor (Beckman Coulter)
  • Beckman ultracentrifuge (Beckman Coulter)
  • Paper towels
  • 1.5‐ml tubes

Support Protocol 1: Titration of Lentiviral Vectors Using Flow Cytometry

  • Human osteosarcoma (HOS) cells (ATCC Cat. No. CRL‐1543)
  • 8 mg/ml polybrene (Sigma, cat. no. H9268) dissolved in H 2O
  • Lentiviral vector samples to be titrated (see protocol 1 or protocol 2)
  • Phosphate‐buffered saline, calcium‐ and magnesium‐free (CMF‐PBS; Invitrogen, cat. no. 14190)
  • Formaldehyde solution (Mallinckrodt, cat. no. 5016)
  • 0.25% trypsin/EDTA (Invitrogen, cat. no. 25200)
  • Hemacytometer
  • 5‐ml polystyrene round‐bottom tubes (12 × 75 mm) for FACS (BD Falcon, cat. no. 352052)
  • FACS machine

Support Protocol 2: Titration of Lentivectors by Quantitative PCR (QPCR)

  • Cloned DNase I (RNase free; Takara Bio, cat. no. 2220A)
  • DNeasy tissue kit (Qiagen, cat. no. 69506) containing:
    • Buffer AE
  • Fluorescent DNA Quantitation kit (Bio‐Rad Cat. No. 170‐2480)
  • QPCR master mix I (see Table 26.8.3)
    Table 6.8.3   Additional Materials (see also protocol 3)   Additional MaterialsMaster Mix I for QPCRMaster Mix II for QPCR

    2× TaqMan master mix a 25 µl × number of reactions (n)
    Forward primer (100 pmoles/µl) b 0.1 µl × n
    Reverse primer (100 pmoles/µl) b 0.1 µl × n
    Probe (100 pmoles/µl) b 0.1 µl × n
    H 2O 19.7 µl × n
    2× TaqMan master mix c 25 µl × number of reactions (n)
    10× RNaseP primer/probe mix 2.5 µl × n
    H 2O 17.5 µl × n

     aTaqMan Universal PCR Master Mix (Applied Biosystems, cat. no. 4304437).
     bPrimers and probes for real‐time PCR (Integrated DNA Technologies, www.IDTDNA.com): the sequences of the WPRE‐specific primers are: 5′‐CCTTTCCGGGACTTTCGCTTT‐3′ (forward primer); 5′‐GCAGAATCCAGGTGGCAACA‐3′ (reverse primer), and 5′ FAM‐ACTCATCGCCGCCTGCCTTGCC‐TAMRA 3′ IB FQ (probe).
  • Ice
  • QPCR master mix II (see Table 26.8.4)
    Table 6.8.4   Additional Materials (see also protocol 3)   Additional MaterialsMaster Mix I for QPCRMaster Mix II for QPCR

    2× TaqMan master mix a 25 µl × number of reactions (n)
    Forward primer (100 pmoles/µl) b 0.1 µl × n
    Reverse primer (100 pmoles/µl) b 0.1 µl × n
    Probe (100 pmoles/µl) b 0.1 µl × n
    H 2O 19.7 µl × n
    2× TaqMan master mix c 25 µl × number of reactions (n)
    10× RNaseP primer/probe mix 2.5 µl × n
    H 2O 17.5 µl × n

     cTaqMan Universal PCR Master Mix (Applied Biosystems, cat. no. 4304437).
     dTaqMan RNaseP control reagent (Applied Biosystems, cat. no. 4316844).
  • Real‐time PCR standards for human genomic DNA (see recipe)
  • Real‐time PCR standards for vector DNA copy determination (see recipe)
  • Optic 96‐well plates (Applied Biosystems, cat. no. N801‐0560)
  • MicroAmp Optical Adhesive Film kit (Applied Biosystems, cat. no. 4313663)
  • QPCR machine
NOTE: This primer‐probe set is fully compatible with the WPRE element present in the second‐generation lentiviral vectors described in this unit but not with the PRE element present in the third‐generation vectors described here. For additional primer‐probe sets that are compatible with the PRE element, see Lizee et al. ( ).
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Baekelandt, V., Eggermont, K., Michiels, M., Nuttin, B., and Debyser, Z. 2003. Optimized lentiviral vector production and purification procedure prevents immune response after transduction of mouse brain. Gene Ther. 10:1933‐1940.
   Bao, L., Guo, H., Huang, X., Tammana, S., Wong, M., Mcivor, R.S., and Zhou, X. 2009. High‐titer lentiviral vectors stimulate fetal calf serum‐specific human CD4 T‐cell responses: Implications in human gene therapy. Gene Ther. 16:788‐795.
   Chen, S.T., Iida, A., Guo, L., Friedmann, T., and Yee, J.K. 1996. Generation of packaging cell lines for pseudotyped retroviral vectors of the G protein of vesicular stomatitis virus by using a modified tetracycline inducible system. Proc. Natl. Acad. Sci. U.S.A 93:10057‐10062.
   Cronin, J., Zhang, X.Y., and Reiser, J. 2005. Altering the tropism of lentiviral vectors through pseudotyping. Curr. Gene Ther. 5:387‐398.
   D'Costa, J., Mansfield, S.G., and Humeau, L.M. 2009. Lentiviral vectors in clinical trials: Current status. Curr. Opin. Mol. Ther. 11:554‐564.
   Geraerts, M., Michiels, M. Baeklandt, V., Debyser, Z., and Gijsbers, R. 2005. Upscaling of lentiviral vector production by tangential flow filtration. J. Gene Med. 7:1299‐1310.
   Kuroda, H., Kutner, R.H., Bazan, N.G., and Reiser, J. 2009. Simplified lentivirus vector production in protein‐free media using polyethylenimine‐mediated transfection. J. Virol. Methods 157:113‐121.
   Kutner, R.H., Puthli, S., Marino, M.P., and Reiser, J. 2009a. Simplified production and concentration of HIV‐1‐based lentiviral vectors using HYPERFlask vessels and anion exchange membrane chromatography. BMC Biotechnol. 9:10.
   Kutner, R.H., Zhang, X.Y., and Reiser, J. 2009b. Production, concentration and titration of pseudotyped HIV‐1‐based lentiviral vectors. Nat. Protoc. 4:495‐505.
   Lewis, N., Williams, J., Rekosh, D., and Hammarskjold, M.L. 1990. Identification of a cis‐acting element in human immunodeficiency virus type 2 (HIV‐2) that is responsive to the HIV‐1 rev and human T‐cell leukemia virus types I and II rex proteins. J. Virol. 64:1690‐1697.
   Lizee, G., Aerts, J.L., Gonzales, M.I., Chinnasamy, N., Morgan, R.A., and Topalian, S.L. 2003. Real‐time quantitative reverse transcriptase‐polymerase chain reaction as a method for determining lentiviral vector titers and measuring transgene expression. Hum Gene Ther 14:497‐507.
   Marino, M.P., Luce, M.J., and Reiser, J. 2003. Small‐ to large‐scale production of lentivirus vectors. In Lentivirus Gene Engineering Protocols. (M. Federico, ed.) pp. 43‐55. Humana Press, Totowa, NJ.
   Matrai, J., Chuah, M.K., and Vandendriessche, T. 2010. Recent advances in lentiviral vector development and applications. Mol. Ther. 18:477‐490.
   Mavilio, F., Ferrari, G., Rossini, S., Nobili, N., Bonini, C., Casorati, G., Traversari, C., and Bordignon, C. 1994. Peripheral blood lymphocytes as target cells of retroviral vector‐mediated gene transfer. Blood 83:1988‐1997.
   Mochizuki, H., Schwartz, J.P., Tanaka, K., Brady, R.O., and Reiser, J. 1998. High‐titer human immunodeficiency virus type 1‐based vector systems for gene delivery into nondividing cells. J. Virol. 72:8873‐8883.
   Pauwels, K., Gijsbers, R., Toelen, J., Schambach, A., Willard‐Gallo, K., Verheust, C., Debyser, Z., and Herman, P. 2009. State‐of‐the‐art lentiviral vectors for research use: Risk assessment and biosafety recommendations. Curr. Gene Ther. 9:459‐474.
   Pluta, K. and Kacprzak, M.M. 2009. Use of HIV as a gene transfer vector. Acta Biochim. Pol. 56:531‐595.
   Reed, S.E., Staley, E.M., Mayginnes, J.P., Pintel, D.J., and Tullis, G.E. 2006. Transfection of mammalian cells using linear polyethylenimine is a simple and effective means of producing recombinant adeno‐associated virus vectors. J. Virol. Methods 138:85‐98.
   Reiser, J. 2000. Production and concentration of pseudotyped HIV‐1‐based gene transfer vectors. Gene Therapy 7:910‐913.
   Ricks, D.M., Kutner, R., Zhang, X.Y., Welsh, D.A., and Reiser, J. 2008. Optimized lentiviral transduction of mouse bone marrow‐derived mesenchymal stem cells. Stem Cells Dev. 17:441‐450.
   Sastry, L., Johnson, T., Hobson, M.J., Smucker, B., and Cornetta, K. 2002. Titering lentiviral vectors: comparison of DNA, RNA and marker expression methods. Gene Ther. 9:1155‐1162.
   Segura, M.M., Garnier, A., Durocher, Y., Coelho, H., and Kamen, A. 2007. Production of lentiviral vectors by large‐scale transient transfection of suspension cultures and affinity chromatography purification. Biotechnol. Bioeng. 98:789‐799.
   Wiznerowicz, M. and Trono, D. 2005. Harnessing HIV for therapy, basic research and biotechnology. Trends Biotechnol. 23:42‐47.
   Zhang, X.Y., La Russa, V.F., and Reiser, J. 2004. Transduction of bone‐marrow‐derived mesenchymal stem cells by using lentivirus vectors pseudotyped with modified RD114 envelope glycoproteins. J. Virol. 78:1219‐1229.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library