Gene Down‐Regulation with Short Hairpin RNAs and Validation of Specificity by Inducible Rescue in Mammalian Cells

Hoi Tang Ma1, Randy Y.C. Poon1

1 Division of Life Science, Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong
Publication Name:  Current Protocols in Cell Biology
Unit Number:  Unit 27.2
DOI:  10.1002/0471143030.cb2702s49
Online Posting Date:  December, 2010
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The principal problem with RNA interference (RNAi) experiments is off‐target effects. The most vigorous demonstration of the specificity is the rescue of the RNAi effects with an RNAi‐resistant target gene. By combining the expression of short hairpin RNA (shRNA) and rescue cDNA in the same vector, both the validation of shRNA specificity and the generation of shRNA‐expressing cell lines can easily be accomplished. If the compensatory cDNA is under the control of an inducible promoter, stable shRNA‐expressing cells can be generated before the knockdown phenotypes are studied, by conditionally turning off the rescue protein. The use of model systems is detailed in these protocols. Curr. Protoc. Cell Biol. 49:27.2.1‐27.2.12. © 2010 by John Wiley & Sons, Inc.

Keywords: inducible expression; RNA interference; short hairpin RNA

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Down‐Regulation of Gene Expression with Short Hairpin RNA
  • Support Protocol 1: Testing of the Down‐Regulation of Protein by shRNA Using Immunoblotting
  • Basic Protocol 2: Rescuing RNA Interference Effects with Target Genes
  • Basic Protocol 3: Generation of Stable Cell Lines Expressing Both shRNA and Rescue cDNA
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Down‐Regulation of Gene Expression with Short Hairpin RNA

  Materials
  • pKAR1 or pKAR1/PUR vectors (Addgene)
  • BbsI and XbaI enzymes (New England Biolabs)
  • NEBuffer 2 (New England Biolabs; also see recipe)
  • QIAquick Gel Extraction Kit (Qiagen) or equivalent
  • 10× annealing buffer: 100 mM Tris⋅Cl pH 7.4 ( appendix 2A) containing 1 M NaCl.
  • T4 DNA ligase and 10× ligation buffer (Fermentas)
  • damE. coli (e.g., GM2163 from Fermentas)
  • LB agar plates ( appendix 2A) with 50 µg/ml ampicillin
  • LB liquid medium ( appendix 2A) 50 µg/ml ampicillin
  • PCR primers (Invitrogen):
    • U6 FOR primer: 5′‐CTCACCCTAACTGTAAAGTAATTG‐3′
    • M13 REV primer: 5′‐CAGGAAACAGCTATGACCATG‐3′
  • Floating rack
  • 16°C water bath (optional)
  • Additional reagents and equipment for DNA oligonucleotide synthesis (Ellington and Pollard, ), transforming competent E. coli (Thomason et al., ), PCR ( appendix 3F), agarose gel electrophoresis (Voytas, ), and DNA sequencing (Ausubel et al., , Chapter 7)

Support Protocol 1: Testing of the Down‐Regulation of Protein by shRNA Using Immunoblotting

  Materials
  • HeLa cells (ATCC no. CCL‐2)
  • HeLa cell growth medium (DMEM containing 10% appendix 2B); test batches of calf serum to ensure that there are no traces of tetracycline
  • pKAR1 or pKAR1/PUR plasmid bearing shRNA plus gene of interest ( protocol 1) and blank plasmids as controls
  • Plasmid expressing blastacidin‐resistance gene and histone H2B‐GFP (available from the authors; can also use similar constructs such as pBOS‐H2BGFP from BD Pharmingen)
  • Blasticidin: stock 5 mg/ml in H 2O, filter sterilized and stored as small aliquots at −20°C
  • Puromycin: stock 1.5 mg/ml in H 2O, filter sterilized and stored as small aliquots at −20°C
  • Antibodies that are capable phosphate‐buffered saline (PBS; appendix 2A) cell lysis buffer (e.g., Invitrogen) of detecting the target protein by immunoblotting
  • 100‐mm tissue culture plates
  • Additional reagents and equipment for mammalian cell tissue culture, including trypsinization (unit 1.1), calcium phosphate transfection (unit 20.3), determining protein concentration ( appendix 3B), SDS‐PAGE (unit 6.1), and immunoblotting (unit 6.2)

Basic Protocol 2: Rescuing RNA Interference Effects with Target Genes

  Materials
  • QuickChange site‐directed mutagenesis kit (Stratagene)
  • Target cDNA
  • shRNA‐containing pKAR1 or pKAR1/PUR ( protocol 1)
  • HeLa cells (see discussion in protocol introduction, above)
  • Doxycycline hydrochloride: 1 mg/ml in H 2O, filter sterilized and stored as small aliquots at −20°C
  • Antibody against FLAG peptide (M2 monoclonal antibody from Sigma)
  • Antibody against target protein
  • Additional reagents and equipment for DNA sequencing (Ausubel et al., ), Preparing cell‐free extracts (Support Protocol, step 6), SDS‐PAGE (unit 6.1), and immunoblotting (unit 6.2)

Basic Protocol 3: Generation of Stable Cell Lines Expressing Both shRNA and Rescue cDNA

  Materials
  • HeLa Tet‐Off cells (Clontech)
  • pKAR1/PUR expressing shRNA and cDNA ( protocol 3)
  • HeLa cell growth medium (DMEM containing 10% calf serum; appendix 2B); test batches of calf serum to ensure that there are no traces of tetracycline
  • Puromycin: stock 1.5 mg/ml in H 2O, filter sterilized and stored as small aliquots at −20°C
  • 10‐cm tissue culture plates
  • Stainless steel cloning rings (internal diameter: 6 mm, thickness: 1 mm, height: 10 mm)
  • Autoclaved high vacuum grease silicone lubricant (Dow Corning)
  • Additional reagents and equipment for transfecting HeLa cells and testing for expression ( protocol 3) and mammalian cell culture techniques including trypsinization (unit 1.1)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. 2010. Current Protocols in Molecular Biology. John Wiley & Sons, Hoboken, N.J.
   Brasier, AZ.F and Fortin, J.J. 2001. Nonisotopic assays for reporter gene activity. Curr. Protoc. Pharmcol. 5:6.5.1‐6.5.5.
   Brummelkamp, T.R., Bernards, R., and Agami, R. 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science 296:550‐553.
   Cullen, B.R. 2004. Transcription and processing of human microRNA precursors. Mol. Cell 16:861‐865.
   Cullen, B.R. 2006. Enhancing and confirming the specificity of RNAi experiments. Nat. Methods 3:677‐681.
   Editorial. 2003. Whither RNAi? Nat. Cell Biol. 5:489‐490.
   Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. 2001. Duplexes of 21‐nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411:494‐498.
   Ellington, A. and Pollard, J. D. 1998. Synthesis and purification of oligonucleotides. 2. Curr. Protoc. Mol. Biol. 42:2.11.1–2.11.25.
   Fung, T.K., Yam, C.H., and Poon, R.Y. 2005. The N‐terminal regulatory domain of cyclin A contains redundant ubiquitination targeting sequences and acceptor sites. Cell Cycle 4:1411‐1420.
   Gossen, M. and Bujard, H. 1992. Tight control of gene expression in mammalian cells by tetracycline‐responsive promoters. Proc. Natl. Acad. Sci. U.S.A. 89:5547‐5551.
   Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W., and Bujard, H. 1995. Transcriptional activation by tetracyclines in mammalian cells. Science 268:1766‐1769.
   Hannon, G.J. 2002. RNA interference. Nature 418:244‐251.
   Hannon, G.J. and Rossi, J.J. 2004. Unlocking the potential of the human genome with RNA interference. Nature 431:371‐378.
   Jackson, A.L., Bartz, S.R., Schelter, J., Kobayashi, S.V., Burchard, J., Mao, M., Li, B., Cavet, G., and Linsley, P.S. 2003. Expression profiling reveals off‐target gene regulation by RNAi. Nat. Biotechnol. 21:635‐637.
   Ma, H.T., On, K.F., Tsang, Y.H., and Poon, R.Y.C. 2007. An inducible system for expression and validation of the specificity of short hairpin RNA in mammalian cells. Nucleic Acids Res. 35:e22.
   Meister, G. and Tuschl, T. 2004. Mechanisms of gene silencing by double‐stranded RNA. Nature 431:343‐349.
   Paddison, P.J., Caudy, A.A., Bernstein, E., Hannon, G.J., and Conklin, D.S. 2002. Short hairpin RNAs (shRNAs) induce sequence‐specific silencing in mammalian cells. Genes Dev. 16:948‐958.
   Pei, Y. and Tuschl, T. 2006. On the art of identifying effective and specific siRNAs. Nat. Methods 3:670‐676.
   Thomason, L., Court, D.L., Bubunetko, M., Costantino, N., Wilson, H., Datta, S., and Oppenheim, A. 2007. Recombineering: Genetic engineering in bacteria using homologous recombination. Curr. Protoc. Mol. Biol. 78:1.16.1‐1.16.24.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
   Yu, J.Y., DeRuiter, S.L., and Turner, D.L. 2002. RNA interference by expression of short‐interfering RNAs and hairpin RNAs in mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 99:6047‐6052.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library