Cross‐Coupling Modification of Nucleoside Triphosphates, PEX, and PCR Construction of Base‐Modified DNA

Hana Macickova‐Cahová1, Milan Vrábel1, Michal Hocek1

1 Institute of Organic Chemistry and Biochemistry, Academy of Sciences of the Czech Republic, Prague, Czech Republic
Publication Name:  Current Protocols in Chemical Biology
Unit Number:   
DOI:  10.1002/9780470559277.ch090177
Online Posting Date:  February, 2010
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

A novel, efficient, two‐step methodology is presented for construction of base‐modified oligonucleotides or DNA, involving aqueous cross‐coupling reactions of halogenated nucleoside triphosphates (dNTPs) with terminal acetylenes or arylboronic acids, followed by polymerase incorporation of the modified dNTPs either using primer extension (PEX) or polymerase chain reaction (PCR). Curr. Protoc. Chem Biol. 2:1‐14. © 2010 by John Wiley & Sons, Inc.

Keywords: nucleoside triphosphates; DNA polymerase; base‐modified DNA; cross‐coupling

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: The Sonogashira Cross‐Coupling Reaction of 9‐(2‐Deoxy‐β‐D‐Erythro‐Pentofuranosyl)‐7‐Iodo‐7‐Deazaadenine 5′‐O‐Triphosphate With Ethynylferrocene
  • Basic Protocol 2: The Suzuki‐Miyaura Cross‐Coupling Reaction of 1‐(2‐Deoxy‐β‐D‐Erythro‐Pentofuranosyl)‐5‐Iodocytidine 5′‐O‐Triphosphate with 3‐Aminophenylboronic Acid
  • Basic Protocol 3: Primer Extension Experiment (PEX) with 7‐Modified 7‐Deaza‐dATP
  • Basic Protocol 4: Polymerase Chain Reaction (PCR) Incorporation of 5‐Modified dCTP into DNA
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: The Sonogashira Cross‐Coupling Reaction of 9‐(2‐Deoxy‐β‐D‐Erythro‐Pentofuranosyl)‐7‐Iodo‐7‐Deazaadenine 5′‐O‐Triphosphate With Ethynylferrocene

  Materials
  • 9‐(2‐deoxy‐β‐D‐erythro‐pentofuranosyl)‐7‐iodo‐7‐deazapurine 5′‐O‐triphosphate (1) [synthesized according to Čapek et al. ( ), and commercially available from TriLink BioTechnologies; http://www.trilinkbiotech.com/]
  • Cross‐coupling reagents:
    • Ethynylferrocene (Sigma‐Aldrich)
    • Palladium(II) acetate [Pd(OAc) 2 ;Fluka]
    • Tris(3‐sulfonatophenyl)phosphine hydrate, sodium salt (TPPTS; Strem Chemicals, http://www.strem.com/)
    • CuI (Sigma‐Aldrich)
    • Triethylamine (TEA; Fluka)
  • Argon
  • Acetonitrile (Sigma‐Aldrich)
  • H 2O (HPLC grade)
  • Triethylammonium bicarbonate (TEAB, pH 7.5 at 10° to 12°C, 2M; store at 4° to 6°C)
  • Methanol (MeOH, HPLC grade)
  • Mobile phase solution A: 0.1 M TEAB
  • Mobile phase solution B: 0.1 M TEAB in 50% MeOH
  • Mobile phase solution C: MeOH
  • 10‐ml and 50‐ml flasks
  • Rubber (PTFE/silicone) septa
  • Magnetic stirrer with Heating MR Hei‐Standard (Heidolph; http://www.heidolph.com/)
  • 21‐G needles
  • Vacuum system (oil pump with manifold and cold trap)
  • Single‐use 1‐ml syringe
  • Oil bath
  • Rotary evaporator (Heidolph) equipped with a vacuum system (membrane pump Vacuubrand)
  • Waters 600 HPLC system
  • Column packed with 10 µm C18 reversed‐phase medium (Phenomenex, Luna 10 µm C18, 100A HPLC Column 250 × 21.2 mm)
  • 17‐mm nylon syringe filter, 0.2 µm (National Scientific)
  • Lyophilizer

Basic Protocol 2: The Suzuki‐Miyaura Cross‐Coupling Reaction of 1‐(2‐Deoxy‐β‐D‐Erythro‐Pentofuranosyl)‐5‐Iodocytidine 5′‐O‐Triphosphate with 3‐Aminophenylboronic Acid

  Materials
  • 1‐(2‐deoxy‐β‐D‐erythro‐pentofuranosyl)‐5‐iodocytidine 5′‐O‐triphosphate (3) [prepared according to Cahová ( ); commercially available from TriLink BioTechnologies; http://www.trilinkbiotech.com/]
  • Cross‐coupling reagents:
    • 3‐aminophenylboronic acid hydrochloride (Sigma‐Aldrich)
    • Palladium(II) acetate [Pd(OAc) 2; Fluka]
    • Tris(3‐sulfonatophenyl)phosphine hydrate, sodium salt (TPPTS, Strem Chemicals, http://www.strem.com/)
    • Cesium carbonate (Cs 2CO 3, Sigma‐Aldrich)
  • Argon
  • Acetonitrile (Sigma‐Aldrich)
  • H 2O (HPLC grade)
  • Methanol (MeOH, HPLC grade)
  • Triethylammonium bicarbonate (TEAB, pH 7.5 at 10° to 12°C, 2 M, stored at 4° to 6°C)
  • Mobile phase solution A : 0.1 M TEAB
  • Mobile phase solution B: 0.1 M TEAB in 50% MeOH
  • Mobile phase solution C : MeOH
  • Dowex 50WX8 in Na+ cycle (Fluka)
  • Lyophilizer
  • 10‐ml and 50‐ml flasks
  • Vacuum system (oil pump with manifold and cold trap)
  • Rubber (PTFE/silicone) septa
  • 21‐G needles
  • Magnetic stirrer with Heating MR Hei‐Standard (Heidolph)
  • Single‐use 1‐ml syringe
  • Oil bath
  • 17‐mm nylon syringe filter 0.2 µm (National Scientific)
  • Waters 600 HPLC system
  • Column packed with 10 µm C18 reversed phase (Phenomenex, Luna 10 µm C18, 100A HPLC Column 250 × 21.2 mm)
  • Nylon 66 membrane filter, 0.2 µm × 47 mm (Supelco)
  • Rotary evaporator (Heidolph) equipped with a vacuum system (membrane pump Vacuubrand)
  • Glass column (1.5 cm i.d. × 12.5 cm length)

Basic Protocol 3: Primer Extension Experiment (PEX) with 7‐Modified 7‐Deaza‐dATP

  Materials
  • PCR Ultra H 2O (Top‐Bio, Czech Republic)
  • 10 U/ml T4 polynucleotide kinase (Takara) and 10× polynucleotide kinase buffer
  • Adenosine 5′‐[γ‐32P] triphosphate, triethylammonium salt (Izotop, Institutes of Isotopes Co.; http://www.izotop.hu)
  • Primer 5′‐CATGGGCGGCATGGG‐3′ (VBC Biotech, http://www.vbc‐biotech.at/)
  • Dynazyme DNA polymerase and 10× buffer (Finnzymes, http://www.finnzymes.com/)
  • Template temp2A: 5′‐GCGTGGAAGTGGAGCCCATGCCGCCCATG‐3′ (VBC Biotech)
  • Natural deoxynucleoside triphosphates: dATP, dCTP, dGTP, dTTP (Fermentas)
  • 2 ( protocol 1)
  • PAGE stop solution (see recipe)
  • Rotiphorese Sequencing Gel Concentrate (Carl Roth; http://www.carl‐roth.de)
  • 2× and 1× TBE buffer (see recipe)
  • N,N,N′,N′‐tetramethylethylenediamine (TEMED, Sigma‐Aldrich)
  • Ammonium persulfate (APS, Sigma‐Aldrich)
  • 1.5‐ml microcentrifuge tubes (Axygen)
  • MicroSpin G‐25 Columns (GE Healthcare)
  • Heating blocks
  • 250 ml Erlenmeyer flask
  • Sequigen electrophoresis apparatus, 21 × 40 (BioRad)
  • PowerPac HV electrophoresis power supply (BioRad)
  • Scalpel
  • 3 MM chromatography paper (Whatman)
  • Gel Dryer Model 583 (BioRad)
  • Plastic wrap (e.g., Saran Wrap)
  • Storage phosphor screen and cassette (Amersham Biosciences)
  • Typhoon 9410 Gel Imager (Amersham Biosciences)
CAUTION: Radioactive materials require special handling. The authors recommend the use of Sekuroka radiation protection screens, protection boxes, and protection waste boxes (available from Carl Roth). Dispose of all waste material in accordance with institutional radiation safety regulations.

Basic Protocol 4: Polymerase Chain Reaction (PCR) Incorporation of 5‐Modified dCTP into DNA

  Materials
  • PCR Ultra H 2O (Top‐Bio, Czech Republic)
  • Vent(exo‐) DNA polymerase and 10× buffer (New England Biolabs)
  • Template Temp PCR (VBC Biotech; see Table 9.1.7700 for sequence)
  • Natural deoxynucleoside triphosphates: dATP, dCTP, dGTP, dTTP (Fermentas)
  • PCR primers: Primer for and Primer rev (VBC Biotech; see Table 9.1.7700 for sequences)
  • Tetramethylammonium chloride (TMAC, Fluka)
  • 4 ( protocol 2)
  • Loading color buffer (see recipe)
  • Agarose for DNA electrophoresis (Serva)
  • 0.5× TBE buffer (see recipe)
  • Low Molecular Weight DNA Ladder (New England Biolabs)
  • 0.5× TBE buffer containing 0.5 µg/ml ethidium bromide
    Table 9.1.2   MaterialsSequences of Template and Primers Employed in PCR

    Sequences
    Temp PCR 5′‐GCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGA‐3′
    Primer for 5′‐ATCCAAATACTCCACACGCA‐3′
    Primer rev 5′‐AGAGACCGGCGCACAGAGGA‐3′

  • 1.5‐ml and 0.5‐ml microcentrifuge tubes (Axygen)
  • TGradient 96 thermal cycler (Whatman Biometra)
  • 250‐ml Erlenmeyer flask
  • Owl B1 type electrophoresis system (Owl Separation System, Inc.)
  • PowerPac HV (Bio‐Rad)
  • Opaque plastic box
  • UltraCam 8gD Digital Imaging System ( Ultra.Lūm, http://www.ultralum.com/)
  • Electronic dual‐wave transilluminator (Ultra.Lūm)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Brázdilová, P., Vrábel, M., Pohl, R., Pivoňková, H., Havran, L., Hocek, M., and Fojta, M. 2007. Ferrocenylethynyl derivatives of nucleoside triphosphates: Synthesis, incorporation, electrochemistry, and bioanalytical applications. Chem. Eur. J. 13:9527‐9533.
   Cahová, H., Pohl, R., Bednárová, L., Nováková, K., Cvačka, J., and Hocek, M. 2008a. Synthesis of 8‐bromo‐, 8‐methyl‐ and 8‐phenyl‐dATP and their polymerase incorporation into DNA. Org. Biomol. Chem. 6:3657‐3660.
   Cahová, H., Havran, L., Brázdilová, P., Pivoňková, H., Pohl, R., Fojta, M., and Hocek, M. 2008b. Aminophenyl‐ and nitrophenyl‐labeled nucleoside triphosphates: Synthesis, enzymatic incorporation, and electrochemical detection. Angew. Chem. Int. Ed. 47:2059‐2062.
   Čapek, P., Cahová, H., Pohl, R., Hocek, M., Gloeckner, C., and Marx, A. 2007. An efficient method for the construction of functionalized DNA bearing amino acid groups through cross‐coupling reactions of nucleoside triphosphates followed by primer extension or PCR. Chem. Eur. J. 13:6196‐6203.
   Condon, A. 2006. Designed DNA molecules: Principles and applications of molecular nanotechnology. Nat. Rev. Genet. 7:565‐575.
   Famulok, M., Hartig, J.S., and Mayer, G. 2007. Functional aptamers and aptazymes in biotechnology, diagnostics, and therapy. Chem. Rev. 107:3715‐3743.
   Gramlich, P.M., Wirges, C.T., Gierlich, J., and Carell, T. 2008. Synthesis of modified DNA by PCR with alkyne‐bearing purines followed by a click reaction. Org. Lett. 10:249‐251.
   Hocek, M. and Fojta, M. 2008. Cross‐coupling reactions of nucleoside triphosphates followed by polymerase incorporation: Construction and applications of base‐functionalized nucleic acids. Org. Biomol. Chem. 6:2233‐2241.
   Jager, S., Rasched, G., Kornreich‐Leshem, H., Engeser, M., Thum, O., and Famulok, M. 2005. A versatile toolbox for variable DNA functionalization at high density. J. Am. Chem. Soc. 127:15071‐15082.
   Peracchi, A. 2005. DNA catalysis: Potential, limitations, open questions. ChemBioChem 6:1316‐1322.
   Vrábel, M., Horáková, P., Pivoňková, H., Kalachova, L., Černocká, H., Cahová, H., Pohl, R., Šebest, P., Havran, L., Hocek, M. and Fojta, M. 2009. Base‐modified DNA labeled by [Ru(bpy)(3)](2+) and [Os(bpy)(3)](2+) complexes: Construction by polymerase incorporation of modified nucleoside triphosphates, electrochemical and luminescent properties, and applications. Chem. Eur. J. 15:1144‐1154.
   Weisbrod, S.H. and Marx, A. 2007. A nucleoside triphosphate for site‐specific labelling of DNA by the Staudinger ligation. Chem. Commun. 1828‐1830.
   Weisbrod, S.H. and Marx, A. 2008. Novel strategies for the site‐specific covalent labelling of nucleic acids. Chem. Commun. 5675‐5685.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library