Imaging of Endogenous RNA Using Genetically Encoded Probes

Takeaki Ozawa1, Yoshio Umezawa2

1 Department of Chemistry, Graduate School of Science, The University of Tokyo, Tokyo, and Japan Science and Technology Agency, Tokyo, Japan, 2 Research Institute of Pharmaceutical Sciences, Musashino University, Tokyo, Japan
Publication Name:  Current Protocols in Chemical Biology
Unit Number:   
DOI:  10.1002/9780470559277.ch100152
Online Posting Date:  February, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Imaging of RNAs in single cells revealed their localized transcription and specific function. Such information cannot be obtained from bulk measurements. This unit contains a protocol of an imaging method capable of visualizing endogenous RNAs bound to genetically encoded fluorescent probes in single living cells. The protocol includes methods of design and construction of the probes, their characterization, and imaging a target RNA in living cells. The methods for RNA imaging are generally applicable to many kinds of RNAs and may allow for elucidating novel functions of localized RNAs and understanding their dynamics in living cells. Curr. Protoc. Chem. Biol. 3:27‐37 © 2011 by John Wiley & Sons, Inc.

Keywords: RNA; imaging; GFP; fluorescence; molecular beacon

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Characterization of RNA Probes
  • Basic Protocol 2: Imaging Endogenous RNA Using Genetically Engineered Fluorescent Probes
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Characterization of RNA Probes

  Materials
  • HeLa cells
  • DMEM with 10% FBS
  • Plasmids: GN‐mPUM1, VN‐mPUM1, mPUM2‐GC, mPUM2‐VC, and MTS‐DsRed‐Ex, cloned into a mammalian expression vector, pcDNA3.1 (+) (Invitrogen) (Fig. )
  • Lipofectamine 2000 (Invitrogen)
  • Lysis buffer A (see recipe)
  • Mouse monoclonal anti‐Flag antibody (Sigma) or mouse monoclonal anti‐GFP antibody (Roche)
  • Protein Sepharose 4FF beads (GE healthcare)
  • Lysis buffer B (see recipe)
  • 2× loading buffer (see recipe)
  • cDNA synthesis kit (Invitrogen)
  • Primers: ND6F (5′‐ATGATGTATGCTTTGTTTCT‐3′) and ND6R (5′‐CCTATTCCCCCGAGCAATCT‐3′) for mitochondrial ND6 mRNA, and ND1F (5′‐ATACCCATGGCCAACCTCCT‐3′) and ND1R (5′‐TTAGGTTTGAGGGGGAATGC‐3′) for controls
  • 6‐well plates
  • 37°C cell culture incubator
  • 1.5‐ml tubes
  • Rotator
  • UV transilluminator
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )
NOTE: The plasmids and more information on their cDNA sequences and enzyme sites may be obtained upon request from the authors' laboratory (e‐mail: ).

Basic Protocol 2: Imaging Endogenous RNA Using Genetically Engineered Fluorescent Probes

  Materials
  • HeLa cells
  • DMEM with 10% FBS
  • Plasmids: GN‐mPUM1, mPUM2‐GC, mPUM2‐VC, and MTS‐DsRed‐Ex, cloned into a mammalian expression vector, pcDNA3.1 (+) (Invitrogen) (Fig. )
  • Lipofectamine 2000 (Invitrogen)
  • DAPI (Invitrogen)
  • MitoTracker (Invitrogen)
  • HBSS (Sigma) containing 5% FBS (Invitrogen)
  • 10‐cm culture dishes
  • 37°C cell culture incubator
  • 3.5‐cm glass‐bottom dish
  • Inverted fluorescence microscope, IX71 (Olympus), equipped with 100×, 1.40‐NA oil objective, a 100‐W mercury arc lamp for illumination and 50‐W xenon lamp for bleaching with a double lamp‐house system
  • EM‐CCD camera (iXon, ANDOR Technology) to acquire cell images
  • MetaMorph software
NOTE: The plasmids and more information on their cDNA sequences and enzyme sites may be obtained upon request from the authors' laboratory (e‐mail: ).
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Bertrand, E., Chartrand, P., Schaefer, M., Shenoy, S.M., Singer, R.H., and Long, R.M. 1998. Localization of ASH1 mRNA particles in living yeast. Mol. Cell 2:437‐445.
   Beverly, S.M. 2001. Enzymatic Amplification of RNA by PCR (RT‐PCR). Curr. Protoc. Mol. Biol. 56:15.5.1‐15.5.6.
   Bonifacino, J.S., Dell'Angelica, E.C., and Springer, T.A. 2001. Immunoprecipitation. Curr. Protoc. Mol. Biol. 48:10.16.1‐10.16.29.
   Buratowski, S. and Chodosh, L. A. 2001. Mobility shift DNA‐binding assay using gel electrophoresis. Curr. Protoc. Mol. Biol. 36:12.2.1‐12.2.11.
   Cheong, C.G. and Hall, T.M. 2006. Engineering RNA sequence specificity of Pumilio repeats. Proc. Natl. Acad. Sci. U.S.A. 103:13635‐13639.
   Emanuelsson, O. and von Heijne, G. 2001. Prediction of organelle targeting signals. Biochim. Biophys. Acta 1541:114‐119.
   Hegeman, A.D., Brown, J.S., and Lomax, M.I. 1995. Sequence of the cDNA for the heart/muscle isoform of mouse cytochrome c oxidase subunit VIII. Biochim. Biophys. Acta 1261:311‐314.
   Hu, C.D. and Kerppola, T.K. 2003. Simultaneous visualization of multiple protein interactions in living cells using multicolor fluorescence complementation analysis. Nat. Biotechnol. 21:539‐545.
   Lu, G., Dolgner, S.J., and Hall, T.M. 2009. Understanding and engineering RNA sequence specificity of PUF proteins. Curr. Opin. Struct. Biol. 19:110‐115.
   Miller, M.T., Higgin, J.J., and Hall, T.M. 2008. Basis of altered RNA‐binding specificity by PUF proteins revealed by crystal structures of yeast Puf4p. Nat. Struct. Mol. Biol. 15:397‐402.
   Nagai, T., Ibata, K., Park, E.S., Kubota, M., Mikoshiba, K., and Miyawaki, A. 2002. A variant of yellow fluorescent protein with fast and efficient maturation for cell‐biological applications. Nat. Biotechnol. 20:87‐90.
   Ozawa, T., Nogami, S., Sato, M., Ohya, Y., and Umezawa, Y. 2000. A fluorescent indicator for detecting protein‐protein interactions in vivo based on protein splicing. Anal. Chem. 72:5151‐5157.
   Ozawa, T., Sako, Y., Sato, M., Kitamura, T., and Umezawa, Y. 2003. A genetic approach to identifying mitochondrial proteins. Nat. Biotechnol. 21:287‐293.
   Ozawa, T., Natori, Y., Sato, M., and Umezawa, Y. 2007. Imaging dynamics of endogenous mitochondrial RNA in single living cells. Nat. Methods 4:413‐419.
   Tilsner, J., Linnik, O., Christensen, N.M., Bell, K., Roberts, I.M., Lacomme, C., and Oparka, K.J. 2009. Live‐cell imaging of viral RNA genomes using a Pumilio‐based reporter. Plant J. 57:758‐770.
   Tyagi, S. 2007. Splitting or stacking fluorescent proteins to visualize mRNA in living cells. Nat. Methods 4:391‐392.
   Tyagi, S. and Kramer, F.R. 1996. Molecular beacons: probes that fluoresce upon hybridization. Nat. Biotechnol. 14:303‐308.
   Voytas, D. 2001. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
   Wang, X., McLachlan, J., Zamore, P.D., and Hall, T.M. 2002. Modular recognition of RNA by a human pumilio‐homology domain. Cell 110:501‐512.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library