Spatiotemporal Control of Gene Expression in Mammalian Cells and in Mice Using the LightOn System

Xianjun Chen1, Xue Wang1, Zengmin Du1, Zhengcai Ma1, Yi Yang1

1 Synthetic Biology and Biotechnology Laboratory, State Key Laboratory of Bioreactor Engineering, School of Pharmacy, East China University of Science and Technology, Shanghai, China
Publication Name:  Current Protocols in Chemical Biology
Unit Number:   
DOI:  10.1002/9780470559277.ch120267
Online Posting Date:  June, 2013
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

A light‐switchable transgene system could be a powerful optogenetic tool for the precise manipulation of spatiotemporal gene expression in multicellular organisms. We have developed the LightOn system, which consists of a single chimeric protein (GAVPO) that can homodimerize and bind to promoters upon exposure to blue light, activating transcription of a target gene. This article describes protocols for precise control of gene expression in mammalian cells and mice using the LightOn system. These protocols can be carried out in an ordinary laboratory, as both liposome‐mediated transfection and hydrodynamic tail vein injection are routine methods that can easily transfer the LightOn system to mammalian cells and mouse liver, respectively. The illumination equipment can also be easily obtained. The LightOn system can provide a robust, convenient means to control the expression of a gene of interest, with unprecedented temporal and spatial accuracy in manipulating an extremely broad range of biological processes. Curr. Protoc. Chem. Biol. 5:111‐129 © 2013 by John Wiley & Sons, Inc.

Keywords: LightOn system; light induced; gene expression; mammalian cell; mice

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Induction of Gene Expression in Mammalian Cells Using the LightOn System
  • Basic Protocol 2: Induction of Gene Expression in Mice Using the LightOn System
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Induction of Gene Expression in Mammalian Cells Using the LightOn System

  Materials
  • pG5luc (Promega)
  • pGLuc‐basic (NEB)
  • Primers and templates for desired vectors (Table 12.2.6700)
  • Pfu DNA polymerase
  • PrimeSTAR HS DNA polymerase (Takara)
  • pcDNA3.1/Hygro(+) (Invitrogen)
  • CloneEZ PCR cloning kit (Genescript)
  • pEGFP‐N1(Clontech)
  • MutaBEST kit (Takara)
  • E. coli host strain (e.g., DH5α)
  • Plasmid extraction kit (e.g., Tiangen).
  • HEK293 cells
  • Complete medium with serum, e.g., high‐glucose (4.5 g/liter) DMEM, phenol‐red‐free, supplemented with 10% fetal bovine serum, 37°C
  • Penicillin‐streptomycin solution (100×) (10,000 units penicillin, 10,000 units streptomycin; Hyclone)
  • Lipofectamine 2000 (Invitrogen)
  • Dulbecco's phosphate buffered saline (DPBS; Hyclone)
  • Lysis buffer (see recipe)
  • Fibronectin (Merck)
  • Tissue culture plasticware including 12‐well plates and 20‐mm glass‐bottom dishes (Corning)
  • 37°C CO 2 incubator (Thermo Scientific)
  • Aluminum foil
  • Red (620 nm to 630 nm) LED lamp
  • Blue (460 nm to 470 nm) LED lamp
  • Electrical timing relay
  • Transparent glass, custom‐made to replace one of the metal incubator trays
  • Silica gel
  • Luminometer (Sanwa, LX‐2)
  • Neutral density filters (Tianya)
  • Adobe Photoshop or other illustration software
  • 3M laser transparency film (3M)
  • UV glue or other transparent liquid adhesive
  • Opaque cloth
  • In‐Vivo Multispectral Imaging System FX (Kodak) with 550‐nm excitation and 600‐nm emission filters for mCherry
    Table 2.2.1   MaterialsTemplates and Primers Used in Constructing the Reporter Vectors and pGAVPO

    DNA fragment Template Primer (5′‐3′)
    poly(A)–5×UAS G‐TATA pG5luc vector (Promega) Forward GCGTTTTGCGCTGCTTCGCGAATATTAAGGTACGGGAGGTACTTGGA
    Reverse GGTGGCCAAGCTTACTTAGATCGCAGATCTAGAGTGAGGACGAACGC
    Gluc pGLuc‐basic (NEB) Forward GCGATCTAAGTAAGCTTGGCCACCATGGGAGTCAAAGTTCTGTT
    Reverse ATCGTCTTTGTAGTCGGATCCGTCACCACCGGCCCCCTTGATCTT
    FLAG Primer annealing Forward GATCCGACTACAAAGACGATGACGACAAGGATTACAAGGATGACGATGATAAAT
    Reverse CTAGATTTATCATCGTCATCCTTGTAATCCTTGTCGTCATCGTCTTTGTAGTCG
    mCherry Synthesis a Forward CTTAAGCTTGCCACCATGGTGAGCAAGGGCGAG
    Reverse CAAGGATCCCTACTTGTACAGCTCGTCCATG
    Fluc pG5luc vector (Promega) Forward Reverse CCCAAGCTTCACCATGGAAGACGCCAAAAACATCCCGGATCCTTACACGGCGATCTTTCCGC
    Insulin Synthesis a Forward AGTAAGCTTGCCACCATGGCCCTGTGGATG
    Reverse GTCGGATCCAGCGCTAATTGCAGTAGTTCTC
    New MCS region Primer annealing Forward AGCTTGAGCTCTGTACAACCGGTAGCGCTG
    Reverse GATCCAGCGCTACCGGTTGTACAGAGCTCA
    Cre Synthesis a Forward AGTAAGCTTCACCATGCCCAAAAAGAAACGGAAG
    Reverse TCCAGCGCTCTAATCGCCATCTTCCAGCAGGCGC
    VIVID (37‐186) cDNA of Neurospora crassa Forward AGATCCATCGCCACCAGATCTCATACGCTCTACGCTCCCG
    Reverse AGCGTAATCTGGAACATCGTATGGGTACTGCAGTTCCG
    TTTCGCACTGGAAAC
    Gal4 (1‐65) pBIND (Promega) Forward CTTTTAGCGCTATGAAGCTACTGTCTTCTATCGAACA
    Reverse AGATCTGGTGGCGATGGATCTTTCCAGTCTTTCTAGCCTTGATTC
    p65 (286‐550) cDNA of HEK293 b Forward CATACGATGTTCCAGATTACGCTGAATTCCAGTACCTGCCAGATAC
    Reverse CCCTGTACATTACTTGTCATCATCGTCTTTGTAG

     aCommercially synthesized gene.
     bCan also be isolated from the GeneSwitch system (http://www.geneswitch.com/index.html).

Basic Protocol 2: Induction of Gene Expression in Mice Using the LightOn System

  Materials
  • Mice
    • For experiments other than those involving Cre recombinase: 4‐week‐old (∼20 g body weight) ICR or Chinese Kunming mice
    • For light‐induced Cre recombinase experiments: 129S4‐Gt(ROSA)26Sortm1Sor/J transgenic mice
  • Ringer's solution (147 mM NaCl, 4 mM KCl, 1.13 mM CaCl 2), autoclaved and filtered through a 0.22‐µm sterile filter
  • pU5‐GOI reporter vectors (see protocol 1)
  • pGAVPO vector (see protocol 1)
  • 8% sodium sulfide
  • Reagents for mCherry detection in whole livers or sections
    • pcDNA3.1‐mCherry vector, containing the mCherry gene driven by a CMV promoter (see protocol 1)
    • PBS (Amresco)
    • Optimal cutting temperature compound (OCT, Qiagen), for imaging sections
  • Reagents for light‐induced Fluc expression
    • pcDNA3.1‐Fluc, containing the Fluc gene driven by a CMV promoter (see protocol 1)
    • Ether (Sinopharm Chemical Reagent Co.)
    • D‐luciferin (Sigma‐Aldrich)
  • Reagents for detection of Gluc expression
    • 50 mM EDTA (Amresco)
    • Gaussia luciferase assay kit (New England Biolabs)
  • Reagents for detection of Cre recombinase expression
    • PBS (Amresco)
    • 4% paraformaldehyde
    • LacZ wash buffer: 2 mM MgCl 2, 0.01% sodium deoxycholate, 0.02% Nonidet P‐40 (all from Sinopharm) in PBS
    • LacZ staining buffer: 35 mM potassium ferrocyanide (Sinopharm), 35 mM potassium ferricyanide (Sinopharm), 1 mg/ml Xgal (5‐bromo‐4‐chloro‐3‐indolyl‐D‐galactoside; Amresco)
  • Reagents for induction of insulin expression
    • Streptozotocin (STZ; Sigma‐Aldrich)
    • 100 mM sodium citrate (pH 4.5)/150 mM NaCl
    • 20% sucrose
    • pGAVPO(C108S) (see protocol 1)
  • Electric shaver
  • Cages with glass bottoms (Fig. F)
  • 40‐W blue LED
  • 40‐W constant current power supply for LED
  • Radiator for LED lamp
  • Fan, for cooling the illuminated cage
  • Equipment for mCherry detection in whole livers or sections
    • In‐Vivo Multispectral System FX (Kodak) with excitation filters ranging from 500 nm to 620 nm with 10‐nm intervals, and a 670‐nm emission filter
    • CareStream Multispectral software
    • Microtome cryostat HM525 (Thermo Scientific)
    • Nikon Plan 4×, 0.10 NA objective microscope with green excitation light
  • Equipment for detection of light‐induced Fluc expression
    • In‐vivo Multispectral System FX (Kodak)
  • Equipment for detection of Gluc expression
    • 384‐well white tissue culture plate
  • Equipment for detection of Cre recombinase expression
    • Nikon DX ED Aspherical ∞‐0.28 m/0.29 ft Φ52 camera (Nikon)
  • Equipment for induction of insulin expression
    • Accu‐Chek Integra glucose meter (Roche)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Bacchus, W. and Fussenegger, M. 2011. The use of light for engineered control and reprogramming of cellular functions. Curr. Opin. Biotechnol. 5:695‐702.
   Berdyyeva, T.K. and Reynolds, J.H. 2009. The dawning of primate optogenetics. Neuron 62:159‐160.
   Berkner, K.L. 1992. Expression of heterologous sequences in adenoviral vectors. Curr. Top. Microbiol. Immunol. 158:39‐66.
   Braselmann, S., Graninger, P., and Busslinger, M. 1993. A selective transcriptional induction system for mammalian cells based on Gal4‐estrogen receptor fusion proteins. Proc. Natl. Acad. Sci. U.S.A. 90:1657‐1661.
   Cambridge, S.B., Davis, R.L., and Minden, J.S. 1997. Drosophila mitotic domain boundaries as cell fate boundaries. Science 277:825‐828.
   Cambridge, S.B., Geissler, D., Calegari, F., Anastassiadis, K., Hasan, M.T., and Stewart, A.F. 2009. Doxycycline‐dependent photoactivated gene expression in eukaryotic systems. Nat. Methods 6:527‐531.
   Carter, B.J. 1992. Adeno‐associated virus vectors. Curr. Opin. Biotechnol. 3:533‐539.
   Choate, K.A. and Khavari, P.A. 1997. Direct cutaneous gene delivery in a human genetic skin disease. Hum. Gene Ther. 8:1659‐1665.
   Deisseroth, K. 2011. Optogenetics. Nat. Methods 8:26‐29.
   Dower, W.J., Miller, J.F., and Ragsdale, C.W. 1988. High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 16:6127‐6145.
   Fenno, L., Yizhar, O., and Deisseroth, K. 2011. The development and application of optogenetics. Annu. Rev. Neurosci. 34:389‐412.
   Fussenegger, M., Morris, R.P., Fux, C., Rimann, M., von Stockar, B., Thompson, C.J., and Bailey, J.E. 2000. Streptogramin‐based gene regulation systems for mammalian cells. Nat. Biotechnol. 18:1203‐1208.
   Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W., and Bujard, H. 1995. Transcriptional activation by tetracyclines in mammalian cells. Science 268:1766‐1769.
   He, C.X., Shi, D., Wu, W.J., Ding, Y.F., Feng, D.M., Lu, B., Chen, H.M., Yao, J.H., Shen, Q., Lu, D.R., and Xue, J.L. 2004. Insulin expression in livers of diabetic mice mediated by hydrodynamics‐based administration. World J. Gastroenterol. 10:567‐572.
   Hickman, M.A., Malone, R.W., Lehmann‐Bruinsma, K., Sih, T.R., Knoell, D., Szoka, F.C., Walzem, R., Carlson, D.M., and Powell, J.S. 1994. Gene expression following direct injection of DNA into liver. Hum. Gene Ther. 5:1477‐1483.
   Kennedy, M.J., Hughes, R.M., Peteya, L.A., Schwartz, J.W., Ehlers, M.D., and Tucker, C.L. 2010. Rapid blue‐light‐mediated induction of protein interactions in living cells. Nat. Methods 7:973‐975.
   Lee, J., Natarajan, M., Nashine, V.C., Socolich, M., Vo, T., Russ, W.P., Benkovic, S.J., and Ranganathan, R. 2008. Surface sites for engineering allosteric control in proteins. Science 322:438‐442.
   Leighton, B., Kowalchuk, J.M., Challiss, R.A., and Newsholme, E.A. 1988. Circadian rhythm in sensitivity of glucose metabolism to insulin in rat soleus muscle. Am. J. Physiol. 255:E41‐E45.
   Levskaya, A., Chevalier, A.A., Tabor, J.J., Simpson, Z.B., Lavery, L.A., Levy, M., Marcotte, E.M., and Voigt, C.A. 2005. Synthetic biology: Engineering Escherichia coli to see light. Nature 438:441‐442.
   Liu, F., Song, Y.K., and Liu, D. 1999. Hydrodynamics‐based transfection in animals by systemic administration of plasmid DNA. Gene Ther. 6:1258‐1266.
   Luker, K.E., Smith, M.C., Luker, G.D., Gammon, S.T., Piwnica‐Worms, H., and Piwnica‐Worms, D. 2004. Kinetics of regulated protein‐protein interactions revealed with firefly luciferase complementation imaging in cells and living animals. Proc. Natl. Acad. Sci. U.S.A. 101:12288‐12293.
   Meyer, K.B., Thompson, M.M., Levy, M.Y., Barron, L.G., and Szoka, F.C. Jr. 1995. Intratracheal gene delivery to the mouse airway: Characterization of plasmid DNA expression and pharmacokinetics. Gene Ther. 2:450‐460.
   Miller, A.D., Miller, D.G., Garcia, J.V., and Lynch, C.M. 1993. Use of retroviral vectors for gene transfer and expression. Methods Enzymol. 217:581‐599.
   Miller, G. 2006. Optogenetics. Shining new light on neural circuits. Science 314:1674‐1676.
   Minden, J., Namba, R., Mergliano, J., and Cambridge, S. 2000. Photoactivated gene expression for cell fate mapping and cell manipulation. Sci. STKE 2000:l1.
   Morgan, S.A. and Woolley, G.A. 2010. A photoswitchable DNA‐binding protein based on a truncated GCN4‐photoactive yellow protein chimera. Photochem. Photobiol. Sci. 9:1320‐1326.
   Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F.H., Verma, I.M., and Trono, D. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272:263‐267.
   Pham, E., Mills, E., and Truong, K. 2011. A synthetic photoactivated protein to generate local or global Ca(2+) signals. Chem. Biol. 18:880‐890.
   Rudic, R.D., McNamara, P., Curtis, A.M., Boston, R.C., Panda, S., Hogenesch, J.B., and Fitagerald, G.A. 2004. BMAL1 and CLOCK, two essential components of the circadian clock, are involved in glucose homeostasis. PLoS Biol. 2:e377.
   Seipel, K., Georgiev, O., and Schaffner, W. 1992. Different activation domains stimulate transcription from remote (‘enhancer’) and proximal (‘promoter’) positions. EMBO J. 11:4961‐4968.
   Shimizu‐Sato, S., Huq, E., Tepperman, J.M., and Quail, P.H. 2002. A light‐switchable gene promoter system. Nat. Biotechnol. 20:1041‐1044.
   Strickland, D., Moffat, K., and Sosnick, T.R. 2008. Light‐activated DNA binding in a designed allosteric protein. Proc. Natl. Acad. Sci. U.S.A. 105:10709‐10714.
   Strickland, D., Yao, X., Gawlak, G., Rosen, M.K., Gardner, K.H., and Sosnick, T.R. 2010. Rationally improving LOV domain‐based photoswitches. Nat. Methods 7:623‐626.
   Tabor, J.J., Salis, H.M., Simpson, Z.B., Chevalier, A.A., Levskaya, A., Marcotte, E.M., Voigt, C.A., and Ellington, A.D. 2009. A synthetic genetic edge detection program. Cell 137:1272‐1281.
   Tabor, J.J., Levskaya, A., and Voigt, C.A. 2011. Multichromatic control of gene expression in Escherichia coli. J. Mol. Biol. 405:315‐324.
   Tannous, B.A. 2009. Gaussia luciferase reporter assay for monitoring biological processes in culture and in vivo. Nat. Protoc. 4:582‐591.
   Tyszkiewicz, A.B. and Muir, T.W. 2008. Activation of protein splicing with light in yeast. Nat. Methods 5:303‐305.
   Vallejo, A.N., Pogulis, R.J., and Pease, L.R. 2008. PCR mutagenesis by overlap extension and gene SOE. CSH Protoc. 2008:pdb prot4861.
   Wang, X., He, L., Wu, Y.I., Hahn, K.M., and Montell, D.J. 2010. Light‐mediated activation reveals a key role for Rac in collective guidance of cell movement in vivo. Nat. Cell Biol. 12:591‐597.
   Wang, X., Chen, X., and Yang, Y. 2012. Spatiotemporal control of gene expression by a light‐switchable transgene system. Nat. Methods 9:266‐269.
   Wang, Y., O'Malley, B.W. Jr., Tsai, S.Y., and O'Malley, B.W. 1994. A regulatory system for use in gene transfer. Proc. Natl. Acad. Sci. U.S.A. 91:8180‐8184.
   Weber, W., Fux, C., Daoud‐el Baba, M., Keller, B., Weber, C.C., Kramer, B.P., Heinzen, C., Aubel, D., Bailey, J.E., and Fussenegger, M. 2002. Macrolide‐based transgene control in mammalian cells and mice. Nat. Biotechnol. 20:901‐907.
   Weber, W., Rimann, M., Spielmann, M., Keller, B., Daoud‐El Baba, M., and Aubel, D. 2004. Gas‐inducible transgene expression in mammalian cells and mice. Nat. Biotechnol. 22:1440‐1444.
   Wright, S. 1986. Recombinant DNA technology and its social transformation, 1972‐1982. Osiris 2:303‐360.
   Wurdinger, T., Badr, C., Pike, L., de Kleine, R., Weissleder, R., Breakefield, X.O., and Tannous, B.A. 2008. A secreted luciferase for ex vivo monitoring of in vivo processes. Nat. Methods 5:171‐173.
   Yamamoto, H., Nagai, K., and Nakagawa, H. 1987. Role of SCN in daily rhythms of plasma glucose, FFA, insulin and glucagon. Chronobiol. Int. 4:483‐491.
   Yazawa, M., Sadaghiani, A.M., Hsueh, B., and Dolmetsch, R.E. 2009. Induction of protein‐protein interactions in live cells using light. Nat. Biotechnol. 27:941‐945.
   Ye, H., Daoud‐El Baba, M., Peng, R.W., and Fussenegger, M. 2011. A synthetic optogenetic transcription device enhances blood‐glucose homeostasis in mice. Science 332:1565‐1568.
   Yizhar, O., Fenno, L.E., Davidson, T.J., Mogri, M., and Deisseroth, K. 2011. Optogenetics in neural systems. Neuron 71:9‐34.
   Zoltowski, B.D. and Crane, B.R. 2008. Light activation of the LOV protein vivid generates a rapidly exchanging dimer. Biochemistry 47:7012‐7019.
   Zoltowski, B.D., Schwerdtfeger, C., Widom, J., Loros, J.J., Bilwes, A.M., Dunlap, J.C., and Crane, B.R. 2007. Conformational switching in the fungal light sensor Vivid. Science 316:1054‐1057.
Key References
   Shimizu‐Sato et al., 2002. See above.
  Describes a method that uses red and far‐red light to control the “on” and “off” expression, respectively, in yeast cells.
   Yazawa et al., 2009. See above.
  Describes a method that uses plant photoreceptors FKF1 and GIGANTEA to induce gene expression under blue light.
   Kennedy et al., 2010. See above.
  Describes a method that uses plant photoreceptors cryptochrome 2 and CIB1 to induce gene expression under blue light.
   Ye et al., 2011. See above.
  Describes a synthetic optogenetic transcription device that can induce gene expression using blue light.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library