Design, Synthesis, and Application of the Trimethoprim‐Based Chemical Tag for Live‐Cell Imaging

Chaoran Jing1, Virginia W. Cornish1

1 Department of Chemistry, Columbia University, New York, New York
Publication Name:  Current Protocols in Chemical Biology
Unit Number:   
DOI:  10.1002/9780470559277.ch130019
Online Posting Date:  June, 2013
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Over the past decade, chemical tags have been developed to complement the use of fluorescent proteins in live‐cell imaging. Chemical tags retain the specificity of protein labeling achieved with fluorescent proteins through genetic encoding, but provide smaller, more robust tags and modular use of organic fluorophores with high photon output and tailored functionalities. The trimethoprim‐based chemical tag (TMP‐tag) was initially developed based on the high affinity interaction between E. coli dihydrofolate reductase and the antibiotic trimethoprim and was subsequently rendered covalent and fluorogenic via proximity‐induced protein labeling reactions. To date, the TMP‐tag is one of the few chemical tags that enable intracellular protein labeling and high‐resolution live‐cell imaging. Here we describe the general design, chemical synthesis, and application of TMP‐tag for live‐cell imaging. Alternate protocols for synthesizing and using the covalent and the fluorogenic TMP‐tags are also included. Curr. Protoc. Chem. Biol. 5:131‐155 © 2013 by John Wiley & Sons, Inc.

Keywords: chemical tag; fluorescence microscopy; live‐cell imaging; protein label

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Synthesis and Application of Noncovalent TMP‐Tag for Live‐Cell Imaging
  • Alternate Protocol 1: Synthesis and Application of Covalent TMP‐Tag for Live‐Cell Imaging
  • Alternate Protocol 2: Synthesis and Application of Fluorogenic TMP‐Tag for Live‐Cell Imaging
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Synthesis and Application of Noncovalent TMP‐Tag for Live‐Cell Imaging

  Materials
  • Hydrobromic acid (HBr)
  • Trimethoprim (Sigma‐Aldrich, cat. no. T7883)
  • Sodium hydroxide (NaOH)
  • Millipore‐purified water
  • Ammonium hydroxide (28% in water, w/w)
  • Anhydrous N,N‐dimethylformamide (DMF) in sure‐seal bottle
  • Potassium carbonate (K 2CO 3)
  • Ethyl 5‐bromovalerate
  • Compressed Ar
  • Brine (saturated NaCl water solution)
  • Ethyl acetate
  • Methanol (MeOH) for chromatography
  • Dichloromethane (DCM) for chromatography
  • Silica gel
  • Deuterated methanol (CD 3OD); used to take NMR spectra
  • Hydrochloric acid (HCl)
  • Deuterated dimethyl sulfoxide (DMSO‐d6); used to take NMR spectra
  • Propane flame
  • Boc‐1‐amino‐4,7,10‐trioxa‐13‐tridecanamine (BocNH‐PEG‐NH 2), CAS: 194920‐62‐2
  • Benzotriazol‐1‐yl‐oxytripyrrolidinophosphonium hexafluorophosphate (PyBOP)
  • N,N‐Diisopropylethylamine (DIEA)
  • Trifluoroacetic acid (TFA)
  • Atto655‐NHS ester (Sigma‐Aldrich, cat. no. 76245)
  • Acetonitrile (MeCN) for HPLC
  • Dimethyl sulfoxide (DMSO)
  • Phosphate‐buffered saline (PBS; see recipe)
  • PCR primers:
    • Forward: 5′ACGTCACCGGTCGCCACCATGGTGGGTTCTGGTGGTTCTGGTATCAGTCTGATTGCGGCG3′
    • Reverse: 5′ACGTCGCGGCCGCTTTAGTGATGGTGATGGTGATGCCGCCGCTCCAGAATCT3′
  • H2B‐GFP vector (Addgene, cat. no. 11680)
  • AgeI and NotI restriction endonucleases
  • Agarose for electrophoresis
  • QIAquick Gel Extraction kit (Qiagen, cat. no. 28704)
  • T4 DNA ligase
  • E. coli (TG1) competent cells (Lucigen, cat. no. 60502)
  • LB agar plates with 50 mg/liter kanamycin
  • Plasmid mini‐prep and maxi‐prep kits (Qiagen, cat. nos. 27106 and 12663)
  • HEK 293T cells
  • Dulbecco's modified Eagle medium (DMEM; Invitrogen, cat. no. 11995)
  • Fetal bovine serum (FBS)
  • 100× penicillin/streptomycin solution
  • Cell transfection kit (e.g., Lipofectamine, Invitrogen; XtrmeGene, Roche; Fugene HD, Promega) including:
    • Transfection reagent
  • Trypsin (0.25%, EDTA)
  • LB media with 50 mg/liter Kanamycin
  • Anhydrous sodium sulfate (Na 2SO 4)
  • 50‐ to 500‐ml round‐bottomed flasks and rubber septa
  • Water‐cooled condensation tube
  • Hot plate magnetic stirrer with contact thermometer oil bath
  • Ice bath
  • Fritted filter funnel
  • pH papers
  • Rotary evaporator
  • Columns for chromatography
  • Electronic oven
  • Dual nitrogen‐vacuum manifold with vacuum pump
  • Gel electrophoresis apparatus and power supply
  • 37°C E.coli incubator
  • 37°C incubator supplied with 5% CO 2
  • 10‐cm petri dishes for tissue culture
  • 8‐well chambered coverslip
  • Fluorescence microscope
  • Imaging acquiring and processing software (e.g., LAS AF software)
NOTE: Appropriate personal protective equipment (e.g., gloves, laboratory coats, goggles, and fume hoods) must be used for all synthetic work.

Alternate Protocol 1: Synthesis and Application of Covalent TMP‐Tag for Live‐Cell Imaging

  • L‐Aspartic acid 4‐tert‐butyl ester (CAS no. 3057‐74‐7)
  • Sodium carbonate
  • Acryloyl chloride
  • Sodium bisulfate (NaHSO 4)
  • Compound 2 TMP‐OH (from the protocol 1, step 2)
  • tert‐butyl N‐(3‐iodopropyl)carbamate (CAS no. 167479‐01‐8)
  • Cesium carbonate
  • Reverse‐phase C18 silica gel
  • 1‐Ethyl‐3‐(3‐dimethyllaminopropyl)carbodiimide hydrochloride (EDCI)
  • 4‐Dimethylaminopyridine (DMAP)
  • 6‐Carboxyfluorescein N‐hydroxysuccinimide ester (6‐carboxyfluorescein‐NHS ester; CAS no. 92557‐81‐8)
  • Triethylamine
  • Pyridine
  • Isobutyric anhydride
  • Toluene

Alternate Protocol 2: Synthesis and Application of Fluorogenic TMP‐Tag for Live‐Cell Imaging

  • Compound 9 TMP‐NH 2 (from protocol 2, step 8)
  • N‐Boc‐propargylglycine
  • Hydroxybenzotriazole (HOBt)
  • 1‐Ethyl‐3‐(3‐dimethyllaminopropyl)carbodiimide hydrochloride (EDCI)
  • Atto520‐NHS ester
  • N‐(3‐aminopropyl)‐N‐methylaniline
  • Di‐tert‐butyl dicarbonate
  • Fast Corinth V salt
  • Sodium carbonate (Na 2CO 3)
  • 3‐(Chlorosulfonyl)benzoyl chloride
  • 2‐Azidoethanol
  • Ascorbic acid
  • CuSO 4⋅5H 2O
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Ando, T., Tsukiji, S., Tanaka, T., and Nagamune, T. 2007. Construction of a small‐molecule‐integrated semisynthetic split intein for in vivo protein ligation. Chem. Commun. 4995‐4997.
   Baccanari, D.P., Daluge, S., and King, R.W. 1982. Inhibition of dihydrofolate reductase: Effect of reduced nicotinamide adenine dinucleotide phosphate on the selectivity and affinity of diaminobenzylpyrimidines. Biochemistry 21:5068‐5075.
   Bloch, K.D. 2001. Digestion of DNA with restriction endonucleases. Curr. Protoc. Immunol. 2:10.8.1‐10.8.7.
   Cai, Y., Rossier, O., Gauthier, N.C., Biais, N., Fardin, M.A., Zhang, X., Miller, L.W., Ladoux, B., Cornish, V.W., and Sheetz, M.P. 2010. Cytoskeletal coherence requires myosin‐iia contractility. J. Cell Sci. 123:413‐423.
   Calloway, N.T., Choob, M., Sanz, A., Sheetz, M.P., Miller, L.W., and Cornish, V.W. 2007. Optimized fluorescent trimethoprim derivatives for in vivo protein labeling. Chembiochem 8:767‐774.
   Chalfie, M., Tu, Y., Euskirchen, G., Ward, W.W., and Prasher, D.C. 1994. Green fluorescent protein as a marker for gene expression. Science 263:802‐805.
   Chen, Z., Jing, C., Gallagher, S.S., Sheetz, M.P., and Cornish, V.W. 2012. Second‐generation covalent tmp‐tag for live cell imaging. J. Am. Chem. Soc. 134:13692‐13699.
   Czlapinski, J.L., Schelle, M.W., Miller, L.W., Laughlin, S.T., Kohler, J.J., Cornish, V.W., and Bertozzi, C.R. 2008. Conditional glycosylation in eukaryotic cells using a biocompatible chemical inducer of dimerization. J. Am. Chem. Soc. 130:13186‐13187.
   Dempsey, G.T., Vaughan, J.C., Chen, K.H., Bates, M., and Zhuang, X. 2011. Evaluation of fluorophores for optimal performance in localization‐based super‐resolution imaging. Nat. Methods 8:1027‐1036.
   Fernandez‐Suarez, M., Chen, T.S., and Ting, A.Y. 2008. Protein‐protein interaction detection in vitro and in cells by proximity biotinylation. J. Am. Chem. Soc. 130:9251‐9253.
   Gallagher, S.S., Sable, J.E., Sheetz, M.P., and Cornish, V.W. 2009. An in vivo covalent tmp‐tag based on proximity‐induced reactivity. ACS Chem. Biol. 4:547‐556.
   Giepmans, B.N., Adams, S.R., Ellisman, M.H., and Tsien, R.Y. 2006. The fluorescent toolbox for assessing protein location and function. Science 312:217‐224.
   Griffin, B.A., Adams, S.R., and Tsien, R.Y. 1998. Specific covalent labeling of recombinant protein molecules inside live cells. Science 281:269‐272.
   Heilemann, M., van de Linde, S., Mukherjee, A., and Sauer, M. 2009. Super‐resolution imaging with small organic fluorophores. Angew. Chem. Int. Ed. Engl. 48:6903‐6908.
   Heim, R., Prasher, D.C., and Tsien, R.Y. 1994. Wavelength mutations and posttranslational autoxidation of green fluorescent protein. Proc. Natl. Acad. Sci. U.S.A. 91:12501‐12504.
   Hoskins, A.A., Gelles, J., and Moore, M.J. 2011. New insights into the spliceosome by single molecule fluorescence microscopy. Curr. Opin. Chem. Biol. 15:864‐870.
   Jing, C. and Cornish, V.W. 2011. Chemical tags for labeling proteins inside living cells. Acc. Chem. Res. 44:784‐792.
   Jing, C. and Cornish, V.W. 2013. A fluorogenic TMC‐tag for high signal‐to‐background intracellular live cell imaging. ACS Chem. Biol., in press.
   Jones, S.A., Shim, S.H., He, J., and Zhuang, X. 2011. Fast, three‐dimensional super‐resolution imaging of live cells. Nat. Methods 8:499‐508.
   Kasper, R., Heilemann, M., Tinnefeld, P., and Sauer, M. 2007. Towards ultra‐stable fluorescent dyes for single‐molecule spectroscopy. European Conference on Biomedical Optics. Munich, Germany. Proc. SPIE, Vol. 6633.
   Keppler, A., Gendreizig, S., Gronemeyer, T., Pick, H., Vogel, H., and Johnsson, K. 2003. A general method for the covalent labeling of fusion proteins with small molecules in vivo. Nat. Biotechnol. 21:86‐89.
   Klein, T., Loschberger, A., Proppert, S., Wolter, S., van de Linde, S., and Sauer, M. 2011. Live‐cell dstorm with snap‐tag fusion proteins. Nat. Methods 8:7‐9.
   Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Immunol. 24:10.20.1‐10.20.10.
   Kunkel, T.A. 2001. Oligonucleotide‐directed mutagenesis without phenotypic selection. Curr. Protoc. Neurosci. 3:4.10.1‐4.10.6.
   Lavis, L.D. and Raines, R.T. 2008. Bright ideas for chemical biology. ACS Chem. Biol. 3:142‐155.
   Lohman, G.J., Tabor, S., and Nichols, N.M. 2011. DNA ligases. Curr. Protoc. Mol. Biol. 943:14.1‐3.14.7.
   Long, M.J., Pan, Y., Lin, H.C., Hedstrom, L., and Xu, B. 2011. Cell compatible trimethoprim‐decorated iron oxide nanoparticles bind dihydrofolate reductase for magnetically modulating focal adhesion of mammalian cells. J. Am. Chem. Soc. 133:10006‐10009.
   Longmire, M.R., Ogawa, M., Hama, Y., Kosaka, N., Regino, C.A., Choyke, P.L., and Kobayashi, H. 2008. Determination of optimal rhodamine fluorophore for in vivo optical imaging. Bioconjug. Chem. 19:1735‐1742.
   Miller, L.W., Cai, Y., Sheetz, M.P., and Cornish, V.W. 2005. In vivo protein labeling with trimethoprim conjugates: A flexible chemical tag. Nat. Methods 2:255‐257.
   Ormo, M., Cubitt, A.B., Kallio, K., Gross, L.A., Tsien, R.Y., and Remington, S.J. 1996. Crystal structure of the aequorea victoria green fluorescent protein. Science 273:1392‐1395.
   Rajapakse, H.E., Reddy, D.R., Mohandessi, S., Butlin, N.G., and Miller, L.W. 2009. Luminescent terbium protein labels for time‐resolved microscopy and screening. Angew. Chem. Int. Ed. Engl. 48:4990‐4992.
   Roth, B., Aig, E., Rauckman, B.S., Strelitz, J.Z., Phillips, A.P., Ferone, R., Bushby, S.R., and Sigel, C.W. 1981. 2,4‐diamino‐5‐benzylpyrimidines and analogues as antibacterial agents. 5. 3′,5′‐dimethoxy‐4′‐substituted‐benzyl analogues of trimethoprim. J. Med. Chem. 24:933‐941.
   Shaner, N.C., Patterson, G.H., and Davidson, M.W. 2007. Advances in fluorescent protein technology. J. Cell Sci. 120:4247‐4260.
   Tsien, R.Y. 1998. The green fluorescent protein. Annu. Rev. Biochem. 67:509‐544.
   Voytas, D. 2001. Agarose gel electrophoresis. Curr. Protoc. Immunol. 2:10.4.1‐10.4.8.
   Wombacher, R., Heidbreder, M., van de Linde, S., Sheetz, M.P., Heilemann, M., Cornish, V.W., and Sauer, M. 2010. Live‐cell super‐resolution imaging with trimethoprim conjugates. Nat. Methods 7:717‐719.
   Xu, J. 2005. Preparation, culture, and immortalization of mouse embryonic fibroblasts. Curr. Protoc. Mol. Biol. 70:28.1.1‐28.1.8.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library