Phage Selection of Peptide “Microantibodies”

Daisuke Fujiwara1, Ikuo Fujii1

1 Osaka Prefecture University, Osaka
Publication Name:  Current Protocols in Chemical Biology
Unit Number:   
DOI:  10.1002/9780470559277.ch130039
Online Posting Date:  October, 2013
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

A bioactive peptide capable of inhibiting protein‐protein interactions has the potential to be a molecular tool for biological studies and a therapeutic by disrupting aberrant interactions involved in diseases. We have developed combinatorial libraries of peptides with helix‐loop‐helix structure, from which the isolated peptides have the constrained structure to reduce entropy costs in binding, resulting in high binding affinities for target molecules. Previously, we designed a de novo peptide of helix‐loop‐helix structure that we termed a “microantibody.” Using the microantibody as a library scaffold, we have constructed a phage‐display library to successfully isolate molecular‐targeting peptides against a cytokine receptor (granulocyte colony‐stimulating factor receptor), a protein kinase (Aurora‐A), and a ganglioside (GM1). Protocols in this article describe a general procedure for the library construction and the library screening. Curr. Protoc. Chem. Biol. 5:171‐194 © 2013 by John Wiley & Sons, Inc.

Keywords: phage display; peptide; protein‐protein interaction; microantibody

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Construction of Phage‐Displayed Microantibody Libraries
  • Alternate Protocol 1: Construction of Phagemid Vector for Displaying Microantibodies on pIII Coat Proteins of Filamentous Phages―pComb3‐YT1stop
  • Support Protocol 1: Preparation of E. Coli Competent Cells
  • Support Protocol 2: Preparation of the VCSM13 Helper Phage Solution
  • Basic Protocol 2: Isolation of Microantibody‐Based Ligands for Target Moleclules
  • Basic Protocol 3: Identification of Favarable Clones Displaying Ligands Binding to the Target Protein: Phage Elisa
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Construction of Phage‐Displayed Microantibody Libraries

  Materials
  • QuikChange Site‐Directed Mutagenesis Kit (Stratagene/Agilent Technologies)
  • Oligonucleotide fragments for site‐directed mutagenesis:
    • 5′‐ATGGCCGAGCTCAAACTGCTCG‐3′
    • 5′‐CGAGCAGTTTGAGCTCGGCCATG‐3′
  • Primers for PCR amplification:
    • 5′‐GGAGGGGGTTCCTCGAGCGCAGGTGCGCCGGTGCCGTATCCGGATCCG‐3′
    • 5′‐AACAGTCTAACTAGTACGCGGTTCCAGCGGATCCGGATACGGCAC‐3′
    • 5′‐GAACTGGCAGCTCTGGAAGCGGAACTGGCGGCACTCGAAGGTGGCGGCGGTGGTGGCGGCAAGCTG‐3′
    • 5′‐GCCAGCTTTCAGAGCCGCCAGCTTAGCTTTCAGTGCAGCCAGCTTGCCGCCACC‐3′
    • 5′‐ATGGCGGAGCTCGCAGCTCTGGAAGCG‐3′
    • 5′‐ACCTGCGCTCGAGCCTTAGCCAGCTTTCAG‐3′
    • 5′‐GCTCTGGAAGCGGAACTGGCGGCACTCGAAGGT‐(NNK) 5,9‐GGCAAGCTGGCT‐3′
    • 5′‐GGAACCGCCTCCGGAGCCTCCGCCAGCTTTCAAAGCAGCTAAC TTAGCTTTCAGTGCAGCCAGCTTGCC‐3′
    • 5′‐GCGCACCTGCCTCGAGGAACCGCCTCCGGAGCCTCC‐3′
  • TaKaRa dNTP mix (2.5 mM each dNTP; cat. no. 4030)
  • Taq DNA polymerase and 10× buffer (TaKaRa Ex Taq Hot Start Version, TaKaRa, cat. no. RR006A)
  • QIAquick Gel Extraction Kit (Qiagen)
  • Restriction enzymes: SacI, XhoI, SpeI
  • 1 M NaCl
  • DNA ligation kit (Ligation High ver. 2, Toyobo, cat. no. LGK‐201)
  • XL1‐Blue subcloning‐grade chemically competent cells (Stratagene; see protocol 3)
  • SOC medium (see recipe)
  • LB medium (see recipe) with and without 100 µg/ml ampicillin and 10 µg/ml tetracycline (added from corresponding stock solutions; see reciperecipes)
  • LB agar plates (see recipe) containing 100 µg/ml ampicillin and 10 µg/ml tetracycline (added from corresponding stock solutions; see reciperecipes)
  • QIAprep Spin Miniprep Kit (Qiagen)
  • QIAquick PCR Purification Kit (Qiagen)
  • YT1stop fragment, encoding microantibody YT1 (AELAALEAELAALE‐G 7‐KLAALKAKLAALKA) and a stop codon (custom synthesized by dedicated oligonucleotide synthesis facility)
  • M13 reverse primer: 5′‐ACAGGAAACAGCTATGAC‐3′
  • XL1‐Blue electroporation‐competent cells (Stratagene; see protocol 3)
  • Ampicillin stock (see recipe)
  • VCSM13 interference‐resistant helper phage (Stratagene; see protocol 4)
  • TBST (see recipe)
  • SB medium (see recipe) containing 100 µg/ml ampicillin, 10 µg/ml tetracycline, 10 µg/ml kanamycin, and 0.1 M IPTG (added from corresponding stock solutions (see reciperecipes)
  • PEG/NaCl (see recipe)
  • Glycerol
  • SB medium (see recipe) containing 10 µg/ml tetracycline
  • Thermal cycler (e.g., GeneAmp PCR System 9700, Applied Biosystems)
  • 16°C and 42°C water bath
  • 0.1‐cm gap electroporation cuvette (BioRad)
  • Electroporation system (e.g., MicroPulser from BioRad)
  • Centrifuge (e.g., MX‐301, TOMY, http://www.digital‐biology.co.jp) and sterile centrifuge tubes
  • DNA sequencer (e.g., 3100‐Avant Genetic Analyzer, Applied Biosystems)
  • Additional reagents and equipment for PCR amplification (Kramer and Coen, ), agarose gel electrophoresis (Voytas, ), and colony PCR (Woodman, )

Alternate Protocol 1: Construction of Phagemid Vector for Displaying Microantibodies on pIII Coat Proteins of Filamentous Phages―pComb3‐YT1stop

  Additional Materials (also see protocol 1)
  • Restriction enzymes: NheI, XbaI, NcoI
  • Primers for PCR amplification:
    • 5′‐CCAGATGTGAGCTCGTGATGACCCAGACTCCA‐3′
    • 5′‐GCGCCGTCTAGAATTAACACTCATTCCTGTTGAA‐3′
    • 5′‐CAGGAAACAGCTATGAC‐3′
    • 5′‐GTTTTCCCAGTCACGAC‐3′

Support Protocol 1: Preparation of E. Coli Competent Cells

  Materials
  • XL1‐Blue cells (Stratagene)
  • LB medium (see recipe) with and without 10 µg/ml tetracycline
  • LB agar plate (see recipe) containing 10 µg/ml tetracycline
  • SOC medium (see recipe)
  • TB buffer (see recipe)
  • Dimethyl sulfoxide (DMSO)
  • 10% (v/v) glycerol, ice cold
  • 18°C water bath
  • 50‐ml conical polypropylene tubes (e.g., BD Falcon)
  • Centrifuge (e.g., MX‐301, TOMY, http://www.digital‐biology.co.jp)
  • 500‐ml centrifuge bottles
  • Centrifuge (e.g., himac CR22, Hitachi)

Support Protocol 2: Preparation of the VCSM13 Helper Phage Solution

  Materials
  • VCSM13 interference‐resistant helper phage (Stratagene)
  • SB medium (see recipe) containing 10 µg/ml tetracycline
  • Top agar (see recipe)
  • Base agar plate (see recipe)
  • PEG/NaCl (see recipe)
  • Additional reagents and equipment for PEG/NaCl precipitation ( protocol 1, steps 43 to 46) and titering of phages ( protocol 1, steps 47 to 50)

Basic Protocol 2: Isolation of Microantibody‐Based Ligands for Target Moleclules

  Materials
  • Anti‐GST antibody (GE Healthcare, cat no. 27‐4577‐01)
  • TBST (see recipe)
  • 1% (w/v) skim milk in 100 mM carbonate‐bicarbonate buffer, pH 8.6
  • Aurora kinase A, GST tagged (Aurora‐A; Carna Bioscience, https://www.carnabio.com/)
  • VCSM13 interference‐resistant helper phage (Stratagene) (see protocol 4)
  • 0.2 M glycine HCl, pH 2.0
  • XL1‐Blue cells (Stratagene)
  • Ampicillin stock (see recipe)
  • SB medium (see recipe) containing 10 µg/ml tetracycline
  • SB medium containing 100 µg/ml ampicillin, 10 µg/ml tetracycline, and 10 µg/ml kanamycin
  • PEG/NaCl (see recipe)
  • 96‐well microtiter plate (e.g., MaxiSorp, Nunc)
  • Shaker for 96‐well plate (e.g., DELFIA PLATE SHAKE, PerkinElmer)
  • Centrifuge (e.g., MX‐301, TOMY) and sterile 50‐ml centrifuge tubes
  • Additional reagents and equipment for titration of phages ( protocol 1, steps 47 to 50)

Basic Protocol 3: Identification of Favarable Clones Displaying Ligands Binding to the Target Protein: Phage Elisa

  Materials
  • Phage solution (inserted fragments from single colonies; protocol 5, step 20)
  • SB medium containing 100 µg/ml ampicillin and 10 µg/ml tetracycline VCSM13 interference‐resistant helper phage (Stratagene; see protocol 4)
  • Kanamycin stock (see recipe)
  • PEG/NaCl (see recipe)
  • 5′‐GAACTGGCAGCTCTGGAAGCGGAACTGGCGGCACTCGAAGGTGGCGGCGGTGGTGGCGGCAAGCTGGCT‐3′
  • TBST (see recipe)
  • Target protein: e.g., Aurora Kinase A (Aurora‐A; Carna Bioscience, https://www.carnabio.com/)
  • Anti‐E tag antibody (GE Healthcare, cat no. 27‐9412‐01)
  • Anti‐GST Antibody (GE Healthcare, cat no. 27‐4577‐01)
  • GST (gift from Carna Biosciences)
  • 1% (w/v) skim milk in TBST
  • HRP/Anti‐M13 monoclonal conjugate (GE Healthcare, cat no. 27‐9421‐010)
  • o‐Phenylenediamine dihydrochloride (e.g., SIGMAFAST OPD, Sigma)
  • 2 N H 2SO 4
  • Centrifuge (e.g., MX‐301, TOMY)
  • 96‐well microtiter plate (e.g., MaxiSorp, Nunc)
  • Microtiter plate reader (e.g., Benchmark, BioRad)
  • Additional reagents and equipment for colony PCR (Woodman, ), agarose gel electrophoresis (Voytas, ), and immobilization of target protein on to 96‐well plate ( protocol 5, steps 1 to 3)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

  Barbas, C.F. III, Kang, A.S., Lerner, R.A., and Benkovic, S.J. 1991. Assembly of combinatorial antibody libraries on phage surfaces: The gene III site. Proc. Natl. Acad. Sci. U.S.A. 88:7978‐7982.
  Barbas, C.F. III, Burton, D.R., Scott, J.K., and Silverman, G.J. 2001. Phage Display: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York.
  Fujii, I., Fukuyama, S., Iwabuchi, Y., and Tanimura, R. 1998. Evolving catalytic antibodies in a phage‐displayed combinatorial library. Nat. Biotechnol. 16:463‐467.
  Fujii, I., Takaoka, Y., Suzuki, K., and Tanaka, T. 2001. A conformationally purified α‐helical peptide library. Tetrahedron Lett. 42:3323‐3325.
  Fujiwara, D., Ye, Z., Gouda, M., Yokota, K., Tsumuraya, T., and Fujii, I. 2010. Selection of inhibitory peptides for Aurora‐A kinase from a phage‐displayed library of helix‐loop‐helix peptides. Bioorg. Med. Chem. Lett. 20:1776‐1778.
  Hoess, R.H. 2001. Protein design and phage display. Chem. Rev. 101:3205‐3218.
  Inoue, H., Nojima, H., and Okayama, H. 1990. High efficiency transformation of Escherichia coli with plasmids. Gene 96:23‐28.
  Kang, A.S., Barbas, C.F., Janda, K.M., Benkovic, S.J., and Lerner, R.A. 1991. Linkage of recognition and replication functions by assembling combinatorial antibody Fab libraries along phage surfaces. Proc. Natl. Acad. Sci. U.S.A. 88:4363‐4366.
  Kehoe, J.W. and Kay, B.K. 2005. Filamentous phage display in the new millennium. Chem. Rev. 105:4056‐4072.
  Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
  Matsubara, T., Iida, M., Tsumuraya, T., Fujii, I., and Sato, T. 2008. Selection of a carbohydrate‐binding domain with a helix‐loop‐helix structure. Biochemistry 47:6745‐6751.
  Smith, G.P. 1985. Filamentous fusion phage: Novel expression vectors that display cloned antigens on the virion surface. Science 228:1315‐1317.
  Suzuki, N. and Fujii, I. 1999. Optimization of the loop length of folding of a helix‐loop‐helix peptide. Tetrahedron Lett. 40:6013‐6017.
  Takahashi, N., Kakinuma, H., Liu, L., Nishi, Y., and Fujii, I. 2001. In vitro abzyme evolution to optimize antibody recognition for catalysis. Nat. Biotechnol. 19:563‐567.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Woodman, M.E. 2008. Direct PCR of intact bacteria (colony PCR). Curr. Protoc. Microbiol. 9:A.3D.1‐A.3D.6.
Internet Resources
  http://www.scripps.edu/mb/barbas/content/pcomb_images/updatepcomb_image.htm
  The original pComb 3 page, home of the world's first antibody Fab fragments displayed on phage.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library