Manipulating Natural Product Biosynthetic Pathways via DNA Assembler

Zengyi Shao1, Huimin Zhao2

1 Department of Chemical and Biological Engineering, Iowa State University, Ames, Iowa, 2 Departments of Chemistry, Biochemistry, and Bioengineering, University of Illinois at Urbana‐Champaign, Urbana, Illinois
Publication Name:  Current Protocols in Chemical Biology
Unit Number:   
DOI:  10.1002/9780470559277.ch130191
Online Posting Date:  June, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

DNA assembler is an efficient synthetic biology method for constructing and manipulating biochemical pathways. The rapidly increasing number of sequenced genomes provides a rich source for discovery of gene clusters involved in synthesizing new natural products. However, both discovery and economical production are hampered by our limited knowledge in manipulating most organisms and the corresponding pathways. By taking advantage of yeast in vivo homologous recombination, DNA assembler synthesizes an entire expression vector containing the target biosynthetic pathway and the genetic elements needed for DNA maintenance and replication. Here we use the spectinabilin clusters originated from two hosts as examples to illustrate the guidelines of using DNA assembler for cluster characterization and silent cluster activation. Such strategies offer unprecedented versatility in cluster manipulation, bypass the traditional laborious strategies to elicit pathway expression, and provide a new platform for de novo cluster assembly and genome mining for discovering new natural products. Curr. Protoc. Chem. Biol. 6:65‐100 © 2014 by John Wiley & Sons, Inc.

Keywords: natural product; gene cluster; regulation of natural product biosynthesis; pathway engineering; synthetic biology; cryptic pathway; DNA assembler

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Characterization of the spn Gene Cluster via Direct Cloning
  • Basic Protocol 2: Reconstructing the Silent nor Gene Cluster from S. orinoci
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Characterization of the spn Gene Cluster via Direct Cloning

  Materials
  • S. spectabilis genomic DNA isolated using Wizard Genomic DNA Purification Kit (Promega)
  • FailSafe PCR 2×PreMix G (EPICENTRE Biotechnologies)
  • Primers (Table 13.1.9100)
  • Phusion DNA polymerase and GC Reaction buffer (New England Biolabs)
  • Dimethyl sulfoxide (DMSO)
  • dNTP premix containing 10 mM each nucleotide
  • Template plasmid pRS416 (New England Biolabs)
  • Template plasmid pAE4 (New England Biolabs)
  • QIAquick Gel Extraction Kit (Qiagen)
  • 3 M sodium acetate
  • 10 mg/ml glycogen
  • 100% ethanol
  • S. cerevisiae strain HZ848 or any auxotrophic S. cerevisiae strain (see annotation to step 5, below)
  • YPAD medium (see recipe)
  • 1 M sorbitol
  • SC‐Ura plates (see recipe)
  • SC‐Ura liquid medium (see recipe)
  • Zymoprep II kit (Zymo Research)
  • E. coli BW25141 cells or other E. coli strain (see annotation to step 10, below)
  • SOC medium (see recipe)
  • LB+Apr agar plates (see recipe)
  • 50 mg/ml apramycin (Apr)
  • LB liquid medium (see recipe)
  • QIAprep Miniprep Kit (Qiagen)
  • Restriction enzymes ApaLI, NotI, SacI, SspI, PacI, XhoI and corresponding 10× NEBuffers supplied with enzymes (New England Biolabs)
  • 100× BSA (New England Biolabs)
  • QIAquick Gel Extraction Kit (Qiagen)
  • E. coli WM6026 cells (details of strain construction can be obtained by request from the authors)
  • 38 mg/ml 2,6‐diaminopimelic acid (DAP; Sigma, cat. no. D1377)
  • Apramycin
  • LB+Apr+DAP plates (see recipe)
  • Streptomyces lividans spores (prepared as described in Tobias Kieser et al., )
  • R2‐sucrose agar plates (see recipe)
  • Nalidixic acid
  • ISP+Apr agar plates (see recipe)
  • MYG liquid medium (see recipe)
  • Ethyl acetate
  • Thermal cycler
  • Nanodrop microspectrophotometer (Thermo Fisher Scientific)
  • Incubator with shaker
  • Spectrophotometer for measurement of OD 600
  • Benchtop refrigerated centrifuge and microcentrifuge
  • 0.2 cm‐gap electroporation cuvette (Thermo Fisher Scientific), prechilled
  • Rotary evaporator
  • Agilent 1100 series LC/MSD XCT plus ion trap mass spectrometer
  • Agilent SB‐C18 reversed‐phase column
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )
Table 3.1.1   MaterialsPrimers Used for Assembling the spn Cluster

Construct Primer name Primer sequence (5′‐3′)
pZS‐SpnDEFJAGKH spn‐1‐for gtagaaacagacgaagaagctagctttgcactggattgcgcccctgctcacggacgcgga
spn‐1‐rev gaagtcgaagtcgacctcac
spn‐2‐for cgcccgggacgactcgatcc
spn‐2‐rev gggtgtggccgatgttggac
spn‐3‐for ctgcgcaagggcgagtgccg
spn‐3‐rev agggcgtcgaccgtcacgac
spn‐4‐for gacgtcaccctctactcccg
spn‐4‐rer tcacaggggttcgccgggca
spn‐5‐for ccggaggtgaagcacaccgg
spn‐5‐rev cacgtgatgaaaaggacccaggtggcacttttcgaatatttcacgcggcgccgaagcgca
SspI‐yeast‐for aatattcgaaaagtgccacctgggtc
PacI‐yeast‐rev ttaattaagtgagtttagtatacatgca
PacI‐E. coli‐for attataagtaaatgcatgtatactaaactcacttaattaatgtcatcacgatactgtgat
E. coli‐rev ggcccatgagttcggccacgtccgcgtccgtgagcaggggcgatctgctcacggtaactg
pZS‐Spn(H)A’(B) spn‐6‐for caaatacggcatcagttaccgtgagcagatcgttaattaaactcgcgccccaggcggtcg
spn‐6‐rev tacggcgagggactccacgg
spn‐7‐for ttggaggcgtggccgccacc
spn‐7‐rev catccggtcgtagaactccg
spn‐8‐for ggctcgccggagaccctcct
spn‐8‐rev cacgtgatgaaaaggacccaggtggcacttttcgaatattcccaggcggtctccaggagc
SspI‐yeast‐for aatattcgaaaagtgccacctgggtc
yeast‐rev gtgagtttagtatacatgca
E. coli‐for aaaactgtattataagtaaatgcatgtatactaaactcactgtcatcacgatactgtgat
PacI‐E. coli‐rev gcagcacctcctcgaccgcctggggcgcgagtttaattaacgatctgctcacggtaactg
pZS‐SpnBCILM spn‐9‐for caaatacggcatcagttaccgtgagcagatcgttaattaaatgcccgctggtgacgagag
spn‐9‐rev atgacgtggtccgcgagcca
spn‐10‐for ccgcccaccctcccgatcgt
spn‐10‐rev ctcgtggcggtccgcgacct
spn‐11‐for ttcgccgaggccgcgtccgt
spn‐11‐rev gggtcgccgagcgcggtgcc
spn‐12‐for gctggtggccctgcacctgg
spn‐12‐rev gcagcggctcctgccaggtg
spn‐13‐for ggccctcgtcttccagcacc
spn‐13‐rev ttatagcacgtgatgaaaaggacccaggtggcacttttcggcgctgcccgaggcggccgg
yeast‐for cgaaaagtgccacctgggtc
SspI‐yeast‐rev aatattgtgagtttagtatacatgca
SspI‐E. coli‐for gtattataagtaaatgcatgtatactaaactcacaatatttgtcatcacgatactgtgat
PacI‐E. coli‐rev gcctcgacgaacctctcgtcaccagcgggcatttaattaacgatctgctcacggtaactg
pZS‐SpnMutK spnK‐stop199‐rev cggtcgcggtgtccgggtccgtgccgaagagcgtgcgtcagtcgtcggcgaggcgccgca
spnK‐stop199‐for ggccgcgtccgcgggctcggcctgcatctgcggcgcctcgccgacgactgacgcacgctcttcggcac
pZS‐SpnBCIM spnM‐rev ttatagcacgtgatgaaaaggacccaggtggcacttttcgacgcgcgacctgccatccct
pZS‐SpnBCI spnI‐rev ttatagcacgtgatgaaaaggacccaggtggcacttttcgggcgactccggagcgtgtac
Master helper plasmid yeast‐for cgaaaagtgccacctgggtc
SspI‐yeast‐rev aatattgtgagtttagtatacatgca
SspI–Strep‐for gtattataagtaaatgcatgtatactaaactcacaatattatggcgcgccgacgtgctca
PacI‐Strep‐rev attagccatggcatcacagtatcgtgatgacattaattaacgcaatccagtgcaaagcta
PacI‐E.coli‐for gacgaagaagctagctttgcactggattgcgttaattaatgtcatcacgatactgtgatg
E. coli‐rev ttatagcacgtgatgaaaaggacccaggtggcacttttcgaccggtcgatctgctcacgg

Basic Protocol 2: Reconstructing the Silent nor Gene Cluster from S. orinoci

  Materials
  • Streptomyces griseus
  • RNeasy Mini Kit (Qiagen) containing buffers RLT, RW1, RPE, columns, and collection tubes
  • RNase‐free H 2O (available from most molecular biology suppliers)
  • TE buffer (see recipe)
  • Lysozyme
  • 2‐mercaptoethanol
  • 100% ethanol
  • Ambion 10× TURBO DNase Buffer, TURBO DNase, and inactivation reagent (Life Technology)
  • First‐strand cDNA Synthesis Kit (Roche Applied Science)
  • Dithiothreitol (DTT)
  • Transcriptor reverse transcriptase (Roche Applied Science)
  • Primers for real‐time PCR (designed and synthesized by Integrated DNA Technologies)
  • S. griseus and S. orinoci genomic DNA isolated using Wizard Genomic DNA Purification Kit (Promega)
  • SYBR Green PCR Master Mix (Life Technologies, cat. no. 4368577)
  • Restriction enzymes: AflII, NdeI, and AvrII and corresponding 10× buffers (New England Biolabs)
  • T4 DNA ligase and T4 DNA ligation buffer (New England Biolabs)
  • LB+Apr liquid medium (see recipe)
  • ϵ‐Caprolactam (Sigma, cat. no. C2204)
  • 3‐ to 4‐mm glass beads (Fisher Scientific, cat. no. 580024)
  • MicroAmp optical 384‐well reaction plate (Applied Biosystems)
  • 7900HT Fast Real‐Time PCR System (Applied Biosystems)
  • SDS2.4 software (Applied Biosystems)
  • Thermal cycler
  • Additional reagents and equipment for characterization of the spn gene cluster via direct cloning ( protocol 1) and XylE activity assay (Tobias Kieser et al., )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Abed, R.M., Dobretsov, S., and Sudesh, K. 2009. Applications of cyanobacteria in biotechnology. J. Appl. Microbiol. 106:1‐12.
  Ahmad, I., Shim, W.Y., Jeon, W.Y., Yoon, B.H., and Kim, J.H. 2012. Enhancement of xylitol production in Candida tropicalis by co‐expression of two genes involved in pentose phosphate pathway. Bioproc. Biosyst. Eng. 35:199‐204.
  Ahn, J., Hong, J., Lee, H., Park, M., Lee, E., Kim, C., Choi, E., Jung, J., and Lee, H. 2007. Translation elongation factor 1‐alpha gene from Pichia pastoris: Molecular cloning, sequence, and use of its promoter. Appl. Microbiol. Biotechnol. 74:601‐608.
  Baltz, R.H. 2010. Streptomyces and Saccharopolyspora hosts for heterologous expression of secondary metabolite gene clusters. J. Ind. Microbiol. Biotechnol. 37:759‐772.
  Bergmann, S., Schumann, J., Scherlach, K., Lange, C., Brakhage, A.A., and Hertweck, C. 2007. Genomics‐driven discovery of PKS‐NRPS hybrid metabolites from Aspergillus nidulans. Nat. Chem. Biol. 3:213‐217.
  Bibb, M.J. 2005. Regulation of secondary metabolism in streptomycetes. Curr. Opin. Microbiol. 8:208‐215.
  Bibb, M. and Hesketh, A. 2009. Analyzing the regulation of antibiotic production in streptomycetes. Methods Enzymol. 458:93‐116.
  Blodgett, J.A., Thomas, P.M., Li, G., Velasquez, J.E., van der Donk, W.A., Kelleher, N.L., and Metcalf, W.W. 2007. Unusual transformations in the biosynthesis of the antibiotic phosphinothricin tripeptide. Nat. Chem. Biol. 3:480‐485.
  Bode, H.B. and Muller, R. 2006. Analysis of myxobacterial secondary metabolism goes molecular. J. Ind. Microbiol. Biotechnol. 33:577‐588.
  Brakhage, A.A. and Schroeckh, V. 2011. Fungal secondary metabolites—strategies to activate silent gene clusters. Fungal Genet. Biol. 48:15‐22.
  Brakhage, A.A., Schuemann, J., Bergmann, S., Scherlach, K., Schroeckh, V., and Hertweck, C. 2008. Activation of fungal silent gene clusters: A new avenue to drug discovery. Prog. Drug Res. 66:1, 3‐12.
  Bull, A.T., Goodfellow, M., and Slater, J.H. 1992. Biodiversity as a source of innovation in biotechnology. Annu. Rev. Microbiol. 46:219‐252.
  Challis, G.L. 2008. Mining microbial genomes for new natural products and biosynthetic pathways. Microbiology 154:1555‐1569.
  Choi, Y.S., Johannes, T.W., Simurdiak, M., Shao, Z., Lu, H., and Zhao, H. 2010. Cloning and heterologous expression of the spectinabilin biosynthetic gene cluster from Streptomyces spectabilis. Mol. Biosyst. 6:336‐338.
  Cobb, R.E. and Zhao, H. 2012. Direct cloning of large genomic sequences. Nat. Biotechnol. 30:405‐406.
  Davies, J. 1999. Millennium bugs. Trends Cell Biol. 9:M2‐M5.
  Demain, A.L. 2006. From natural products discovery to commercialization: A success story. J. Ind. Microbiol. Biotechnol. 33:486‐495.
  Dewick, P.M. 2002. Medical natural products. A biosynthetic approach, 2nd ed. John Wiley and Sons, Chichester, U.K.
  Eliot, A.C., Griffin, B.M., Thomas, P.M., Johannes, T.W., Kelleher, N.L., Zhao, H., and Metcalf, W.W. 2008. Cloning, expression, and biochemical characterization of Streptomyces rubellomurinus genes required for biosynthesis of antimalarial compound FR900098. Chem. Biol. 15:765‐770.
  Felnagle, E.A., Rondon, M.R., Berti, A.D., Crosby, H.A., and Thomas, M.G. 2007. Identification of the biosynthetic gene cluster and an additional gene for resistance to the antituberculosis drug capreomycin. Appl. Environ. Microbiol. 73:4162‐4170.
  Feng, Z., Wang, L., Rajski, S.R., Xu, Z., Coeffet‐LeGal, M.F., and Shen, B. 2009. Engineered production of iso‐migrastatin in heterologous Streptomyces hosts. Bioorg. Med. Chem. 17:2147‐2153.
  Fu, J., Bian, X., Hu, S., Wang, H., Huang, F., Seibert, P.M., Plaza, A., Xia, L., Muller, R., Stewart, A.F., and Zhang, Y. 2012. Full‐length RecE enhances linear‐linear homologous recombination and facilitates direct cloning for bioprospecting. Nat. Biotechnol. 30:440‐446.
  Gibson, D.G., Benders, G.A., Andrews‐Pfannkoch, C., Denisova, E.A., Baden‐Tillson, H., Zaveri, J., Stockwell, T.B., Brownley, A., Thomas, D.W., Algire, M.A., Merryman, C., Young, L., Noskov, V.N., Glass, J.I., Venter, J.C., Hutchison, C.A., and Smith, H.O. 2008. Complete chemical synthesis, assembly, and cloning of a Mycoplasma genitalium genome. Science 319:1215‐1220.
  Gibson, D.G., Young, L., Chuang, R.Y., Venter, J.C., Hutchison, C.A., and Smith, H.O. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6:343‐345.
  Gomez, C., Horna, D.H., Olano, C., Palomino‐Schatzlein, M., Pineda‐Lucena, A., Carbajo, R.J., Brana, A.F., Mendez, C., and Salas, J.A. 2011. Amino acid precursor supply in the biosynthesis of the RNA polymerase inhibitor streptolydigin by Streptomyces lydicus. J. Bacteriol. 193:4214‐4223.
  Gross, H. 2007. Strategies to unravel the function of orphan biosynthesis pathways: Recent examples and future prospects. Appl. Microbiol. Biotechnol. 75:267‐277.
  Herai, S., Hashimoto, Y., Higashibata, H., Maseda, H., Ikeda, H., Omura, S., and Kobayashi, M. 2004. Hyper‐inducible expression system for streptomycetes. Proc. Natl. Acad. Sci. U.S.A. 101:14031‐14035.
  Herbert, R.B. 1989. The biosynthesis of secondary metabolites, 2nd ed. Chapman and Hall, London, U.K.
  Hong, W.K., Kim, C.H., Heo, S.Y., Luo, L., Oh, B.R., and Seo, J.W. 2010. Enhanced production of ethanol from glycerol by engineered Hansenula polymorpha expressing pyruvate decarboxylase and aldehyde dehydrogenase genes from Zymomonas mobilis. Biotechnol. Lett. 32:1077‐1082.
  Isaka, M., Jaturapat, A., Kramyu, J., Tanticharoen, M., and Thebtaranonth, Y. 2002. Potent in vitro antimalarial activity of metacycloprodigiosin isolated from Streptomyces spectabilis BCC 4785. Antimicrob. Agents Chemother. 46:1112‐1113.
  Ishiuchi, K., Nakazawa, T., Ookuma, T., Sugimoto, S., Sato, M., Tsunematsu, Y., Ishikawa, N., Noguchi, H., Hotta, K., Moriya, H., and Watanabe, K. 2012. Establishing a new methodology for genome mining and biosynthesis of polyketides and peptides through yeast molecular genetics. Chembiochem 13:846‐854.
  Ito, T., Roongsawang, N., Shirasaka, N., Lu, W., Flatt, P.M., Kasanah, N., Miranda, C., and Mahmud, T. 2009. Deciphering pactamycin biosynthesis and engineered production of new pactamycin analogues. Chembiochem 10:2253‐2265.
  Jia, Y.L., Li, S.K., Allen, G., Feng, S.Y., and Xue, L.X. 2012. A novel glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) promoter for expressing transgenes in the halotolerant alga Dunaliella salina. Curr. Microbiol. 64:506‐513.
  Kakinuma, K., Hanson, C.A., and Rinehart, K.L. Jr. 1976. Spectinabilin, a new nitro‐containing metabolite isolated from Streptomyces spectabilis. Tetrahedron 32:217‐222.
  Karray, F., Darbon, E., Nguyen, H.C., Gagnat, J., and Pernodet, J.L. 2010. Regulation of the biosynthesis of the macrolide antibiotic spiramycin in Streptomyces ambofaciens. J. Bacteriol. 192:5813‐5821.
  Kim, S.H., Lee, H.N., Kim, H.J., and Kim, E.S. 2011. Transcriptome analysis of an antibiotic downregulator mutant and synergistic Actinorhodin stimulation via disruption of a precursor flux regulator in Streptomyces coelicolor. Appl. Environ. Microbiol. 77:1872‐1877.
  Komatsu, M., Uchiyama, T., Omura, S., Cane, D.E., and Ikeda, H. 2010. Genome‐minimized Streptomyces host for the heterologous expression of secondary metabolism. Proc. Natl. Acad. Sci. U.S.A. 107:2646‐2651.
  Krasny, L., Vacik, T., Fucik, V., and Jonak, J. 2000. Cloning and characterization of the str operon and elongation factor Tu expression in Bacillus stearothermophilus. J. Bacteriol. 182:6114‐6122.
  Leadbetter, J.R. 2003. Cultivation of recalcitrant microbes: Cells are alive, well and revealing their secrets in the 21st century laboratory. Curr. Opin. Microbiol. 6:274‐281.
  Li, J.W.H. and Vederas, J.C. 2009. Drug discovery and natural products: End of an era or an endless frontier? Science 325:161‐165.
  Newman, D.J. and Cragg, G.M. 2012. Natural products as sources of new drugs over the 30 years from 1981 to 2010. J. Natural Prod. 75:311‐335.
  Nieselt, K., Battke, F., Herbig, A., Bruheim, P., Wentzel, A., Jakobsen, O.M., Sletta, H., Alam, M.T., Merlo, M.E., Moore, J., Omara, W.A., Morrissey, E.R., Juarez‐Hermosillo, M.A., Rodriguez‐Garcia, A., Nentwich, M., Thomas, L., Iqbal, M., Legaie, R., Gaze, W.H., Challis, G.L., Jansen, R.C., Dijkhuizen, L., Rand, D.A., Wild, D.L., Bonin, M., Reuther, J., Wohlleben, W., Smith, M.C., Burroughs, N.J., Martin, J.F., Hodgson, D.A., Takano, E., Breitling, R., Ellingsen, T.E., and Wellington, E.M. 2010. The dynamic architecture of the metabolic switch in Streptomyces coelicolor. BMC Genomics 11:10.
  Ohnishi, Y., Ishikawa, J., Hara, H., Suzuki, H., Ikenoya, M., Ikeda, H., Yamashita, A., Hattori, M., and Horinouchi, S. 2008. Genome sequence of the streptomycin‐producing microorganism Streptomyces griseus IFO 13350. J. Bacteriol. 190:4050‐4060.
  Omura, S., Ikeda, H., Ishikawa, J., Hanamoto, A., Takahashi, C., Shinose, M., Takahashi, Y., Horikawa, H., Nakazawa, H., Osonoe, T., Kikuchi, H., Shiba, T., Sakaki, Y., and Hattori, M. 2001. Genome sequence of an industrial microorganism Streptomyces avermitilis: Deducing the ability of producing secondary metabolites. Proc. Natl. Acad. Sci. U.S.A. 98:12215‐12220.
  Rodriguez, E., Hu, Z., Ou, S., Volchegursky, Y., Hutchinson, C.R., and McDaniel, R. 2003. Rapid engineering of polyketide overproduction by gene transfer to industrially optimized strains. J. Ind. Microbiol. Biotechnol. 30:480‐488.
  Schmitt‐John, T. and Engels, J.W. 1992. Promoter constructions for efficient secretion expression in Streptomyces lividans. Appl. Microbiol. Biotechnol. 36:493‐498.
  Shao, Z., Zhao, H., and Zhao, H. 2009. DNA assembler, an in vivo genetic method for rapid construction of biochemical pathways. Nucleic Acids Res. 37:e16.
  Shao, Z., Luo, Y., and Zhao, H. 2011. Rapid characterization and engineering of natural product biosynthetic pathways via DNA assembler. Mol. Biosyst. 7:1056‐1059.
  Shao, Z., Rao, G., Li, C., Abil, Z., Luo, Y., and Zhao, H. 2013. Refactoring the silent spectinabilin gene cluster using a plug‐and‐play scaffold. ACS Synth. Biol. 2:662‐669.
  Singh, S., Kate, B.N., and Banerjee, U.C. 2005. Bioactive compounds from cyanobacteria and microalgae: An overview. Crit. Rev. Biotechnol. 25:73‐95.
  Suarez, C.E., Norimine, J., Lacy, P., and McElwain, T.F. 2006. Characterization and gene expression of Babesia bovis elongation factor‐1alpha. Int. J. Parasitol. 36:965‐973.
  Tobias Kieser, M.J.B., Buttner, M.J., Chater, K.F., and Hopwood, D.A. 2000. Practical Streptomyces Genetics. John Innes Foundation, Norwich, U.K.
  Traitcheva, N. 2006. Molecular analysis of the neoaureothin biosynthesis gene cluster from Streptomyces orinoci HKI 0260: A model system for the evolution of bacterial polyketide synthases. Leibniz‐Institute for Natural Product Research and Infection Biology (HKI), Jena.
  van Wezel, G.P., McKenzie, N.L., and Nodwell, J.R. 2009. Applying the genetics of secondary metabolism in model actinomycetes to the discovery of new antibiotics. Methods Enzymol. 458:117‐141.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1–2.5A.9.
  Wagner, N., Osswald, C., Biener, R., and Schwartz, D. 2009. Comparative analysis of transcriptional activities of heterologous promoters in the rare actinomycete Actinoplanes friuliensis. J. Biotechnol. 142:200‐204.
  Wawrzyn, G.T., Bloch, S.E., and Schmidt‐Dannert, C. 2012. Discovery and characterization of terpenoid biosynthetic pathways of fungi. Methods Enzymol. 515:83‐105.
  Wendt‐Pienkowski, E., Huang, Y., Zhang, J., Li, B., Jiang, H., Kwon, H., Hutchinson, C.R., and Shen, B. 2005. Cloning, sequencing, analysis, and heterologous expression of the fredericamycin biosynthetic gene cluster from Streptomyces griseus. J. Am. Chem. Soc. 127:16442‐16452.
  Wilkinson, C.J., Hughes‐Thomas, Z.A., Martin, C.J., Bohm, I., Mironenko, T., Deacon, M., Wheatcroft, M., Wirtz, G., Staunton, J., and Leadlay, P.F. 2002. Increasing the efficiency of heterologous promoters in actinomycetes. J. Mol. Microbiol. Biotechnol. 4:417‐426.
  Wingler, L.M. and Cornish, V.W. 2011. Reiterative recombination for the in vivo assembly of libraries of multigene pathways. Proc. Natl. Acad. Sci. U.S.A. 108:15135‐15140.
  Woodyer, R.D., Shao, Z., Thomas, P.M., Kelleher, N.L., Blodgett, J.A., Metcalf, W.W., van der Donk, W.A., and Zhao, H. 2006. Heterologous production of fosfomycin and identification of the minimal biosynthetic gene cluster. Chem. Biol. 13:1171‐1182.
  Zerikly, M. and Challis, G.L. 2009. Strategies for the discovery of new natural products by genome mining. Chembiochem 10:625‐633.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library