SELMA: Selection with Modified Aptamers

J. Sebastian Temme1, Isaac J. Krauss1

1 Department of Chemistry, Brandeis University, Waltham, Massachusetts
Publication Name:  Current Protocols in Chemical Biology
Unit Number:   
DOI:  10.1002/9780470559277.ch140233
Online Posting Date:  June, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

In vitro selection of nucleic acid aptamers, coined SELEX, has led to the discovery of novel therapeutics and aided in the structural and mechanistic understanding of many ligand‐biomolecule interactions. A related method, selection with modified aptamers (SELMA), enables selection of DNA aptamers containing bases with a large modification that cannot undergo PCR. A key application of this method is the evolution of aptamers containing carbohydrate modifications. Carbohydrate‐binding proteins normally require several copies of the carbohydrate moiety for strong recognition. Whereas it may be difficult to rationally design synthetic scaffolds that cluster glycans in the optimal spacing and orientation for target recognition, SELMA furnishes glycoaptamers with highly optimized glycan clustering, achieving low‐nanomolar recognition. Although numerous applications can be envisioned, the protocols and discussions in this article describe procedures involved in applying SELMA to the discovery glycoDNAs that bind to the HIV broadly neutralizing antibody 2G12. © 2015 by John Wiley & Sons, Inc.

Keywords: SELMA; SELEX; HIV; in vitro aptamer selection; protein‐carbohydrate interaction

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Appending the Hairpin Structure to the Random Library (Form A to Form C)
  • Basic Protocol 2: Incorporation of Alkynyl Bases and Click Attachment of Carbohydrates (Form C to Form E)
  • Basic Protocol 3: Strand Displacement and Selection of Best Glycodna Binders (Form E to Form G)
  • Support Protocol 1: Confirmation of Hairpin Formation and Strand Displacement
  • Basic Protocol 4: Amplification of Selected Winners and Hairpin Regeneration (Form F to Form C N +1)
  • Basic Protocol 5: Subsequent Rounds of SELMA and Library Cloning
  • Basic Protocol 6: Synthesis and Analysis of Glycosylated Aptamers
  • Reagents and Solutions
  • Commentary
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Appending the Hairpin Structure to the Random Library (Form A to Form C)

  Materials
  • Oligonucleotides for SELMA (Integrated DNA Technologies), both urea PAGE purified:
  • Library: 5′‐CTTGTCGTCTCCTGTGTGCTTNNNNNNNNNNNNNNNNNNNNNNNNNCCCGTACCCGTTAAAACTCCACCTCATAACCGCA‐3′
  • Hairpin regeneration primer: 5′‐biotin‐CCCGTACCCGAATATAAAATAAAAATATAAAATATAAAATTGCGGTTATGAGGTGGAGTT‐3′
  • 5 U/μl DNA polymerase I, large (Klenow) fragment, with 10× NEBuffer 2 (New England Biolabs, cat. no. M0210)
  • 10 mM dNTP mix (see recipe)
  • 500 mM EDTA, pH 8.0
  • 60 mg/ml Sephadex G‐50 slurry in water (see recipe)
  • 20 U/μl exonuclease I (Exo I) and 10× buffer (New England Biolabs, cat. no. M0293)
  • 25:24:1 phenol/chloroform/isoamyl alcohol, saturated with 10 mM Tris, pH 8.0, 1 mM EDTA (Sigma, cat. no. P2069)
  • Stabilized chloroform
  • 3 M sodium acetate (NaOAc), pH 5.46
  • 100% and 70% (v/v) ethanol
  • Hydrophilic streptavidin magnetic beads (New England Biolabs, cat. no. S1421, 400 pmol ssDNA/mg)
  • 1× streptavidin binding/wash buffer (see recipe)
  • 100 mM NaOH (freshly prepared and titrated prior to use)
  • 1 M HCl
  • 1 M Tris·Cl, pH 8.0
  • 1.5‐ml microcentrifuge tubes
  • Thermal cycler
  • Mini‐spin columns without medium (e.g., USA Scientific, cat. no. 1415‐0600)
  • Magnetic rack
  • Tube rotator
  • NanoDrop spectrophotometer or equivalent

Basic Protocol 2: Incorporation of Alkynyl Bases and Click Attachment of Carbohydrates (Form C to Form E)

  Materials
  • ssDNA library Form C (see protocol 1)
  • BST DNA polymerase, large fragment, with 10× ThermoPol reaction buffer (New England Biolabs, M0275)
  • 10 mM EdUTP mix (see recipe)
  • Liquid nitrogen
  • Nitrogen gas
  • Argon gas (optional)
  • 100 mM HEPES‐KOH, pH 8.0, with 0.5% (v/v) Triton X‐100
  • 50 mM azide sugar (see recipe)
  • 10 mM CuSO 4 (see recipe)
  • 10 mM THPTA (see recipe)
  • (+)‐Sodium L‐ascorbate
  • Thermal cycler
  • Two 50‐ml, two‐neck, pear‐shaped flasks with ground‐glass joints and pointed bottom (e.g., Chemglass, cat. no. CG‐1558‐14)
  • Gas/vacuum manifold
  • 500‐μl tubes
  • SpeedVac concentrator
  • Rubber septum
  • Additional reagents and equipment for desalting (see protocol 1)

Basic Protocol 3: Strand Displacement and Selection of Best Glycodna Binders (Form E to Form G)

  Materials
  • Sephadex G‐50 slurry in binding buffer (see recipe)
  • Desalted, glycosylated dsDNA hairpin library Form E (see protocol 2)
  • 8 U/μl BST 2.0 WarmStart DNA polymerase with 10× ThermoPol reaction buffer (New England Biolabs, cat. no. M0538)
  • 10 μM forward primer: 5′‐TGCGGTTATGAGGTGGAGTT‐3′
  • 10 mM dNTP mix (see recipe)
  • Binding buffer + 0.02% Tween‐20 (see recipe)
  • 550 nM 2G12 antibody (Polymun Scientific)
  • Protein A magnetic beads (e.g., Dynabeads Protein A, Invitrogen Life Technologies, cat. no. 10001D)
  • Protein A elution buffer (see recipe)
  • Mini‐spin column without medium (e.g., USA Scientific, cat. no. 1415‐0600)
  • PCR tubes
  • Thermal cycler
  • 1.5‐ml low‐adhesion tubes (e.g., USA Scientific)
  • Rotator in 37°C incubator or room
  • Magnetic rack
  • Boiling water bath

Support Protocol 1: Confirmation of Hairpin Formation and Strand Displacement

  Additional Materials (also see Basic Protocols protocol 11, protocol 22, and protocol 33)
  • 10 U/μl mung bean nuclease with 10× reaction buffer (New England Biolabs, M0250)
  • 10% polyacrylamide gel in 1× Tris‐borate‐EDTA (TBE) electrophoresis buffer
  • Ethidium bromide or equivalent stain for polyacrylamide gels

Basic Protocol 4: Amplification of Selected Winners and Hairpin Regeneration (Form F to Form C N +1)

  Materials
  • Winners of selection (see protocol 3)
  • Phusion Hot Start II High‐Fidelity DNA polymerase with 5× HF Buffer (Thermo, cat no. F‐549)
  • 10 μM biotinylated forward primer: 5′‐biotin‐TGCGGTTATGAGGTGGAGTT‐3′
  • 10 μM reverse primer: 5′‐CTTGTCGTCTCCTGTGTGCTT‐3′
  • 10 mM dNTP mix (see recipe)
  • 6× loading buffer (see recipe)
  • 1.5% agarose gel containing ethidium bromide
  • Low‐molecular‐weight DNA ladder
  • 20 U/μl exonuclease I (Exo I; New England Biolabs, cat no. M0293)
  • 2× streptavidin binding/wash buffer (see recipe)
  • 10 μM library hairpin regeneration primer: 5′‐biotin‐CCCGTACCCGAATATAAAATAAAAATATAAAATATAAAATTGCGGTTATGAGGTGGAGTT‐3′
  • 200‐ and 500‐μl PCR tubes
  • Thermal cycler
  • Additional reagents and equipment for agarose gel electrophoresis, and for removing biotinylated DNA strands and regenerating the library (see protocol 1)

Basic Protocol 5: Subsequent Rounds of SELMA and Library Cloning

  Materials
  • Complementary oligo templates (where N is the random region or desired aptamer to be analyzed):
  • 5′‐CTTGTCGTCTCCTGTGTGCTTNNNNNNNNNNNNNNNNNNNNNNNNNCCCGTACCCG‐3′
  • Stem primer: 5′‐CGGGTACGGG‐3′
  • 5 U/μl DNA polymerase I, large (Klenow) fragment, with 10× NEBuffer 2 (New England Biolabs, cat. no. M0210)
  • 10 mM EdUTP mix (see recipe)
  • 12% urea polyacrylamide gel
  • Acridine orange staining solution
  • Thermal cycler
  • Additional reagents and equipment for desalting and ethanol precipitation (see protocol 1), for click glycosylation (see protocol 2), and for urea PAGE
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Apte, A. and Daniel, S. 2009. PCR primer design. Cold Spring Harbor Protoc. 2009:pdb.ip65.
   Calarese, D.A. , Scanlan, C.N. , Zwick, M.B. , Deechongkit, S. , Mimura, Y. , Kunert, R. , Zhu, P. , Wormald, M.R. , Stanfield, R.L. , Roux, K.H. , Kelly, J.W. , Rudd, P.M. , Dwek, R.A. , Katinger, H. , Burton, D.R. , and Wilson, I.A. 2003. Antibody domain exchange is an immunological solution to carbohydrate cluster recognition. Science 300:2065‐2071.
   Famulok, M. , Hartig, J.S. , and Mayer, G. 2007. Functional aptamers and aptazymes in biotechnology, diagnostics, and therapy. Chem. Rev. 107:3715‐3743.
   Gierlich, J. , Burley, G.A. , Gramlich, P.M.E. , Hammond, D.M. , and Carell, T. 2006. Click chemistry as a reliable method for the high‐density postsynthetic functionalization of alkyne‐modified DNA. Org. Lett. 8:3639‐3642.
   Gierlich, J. , Gutsmiedl, K. , Gramlich, P.M.E. , Schmidt, A. , Burley, G.A. , and Carell, T. 2007. Synthesis of highly modified DNA by a combination of PCR with alkyne‐bearing triphosphates and click chemistry. Chem. Eur. J. 13:9486‐9494.
   Gramlich, P.M.E. , Wirges, C.T. , Gierlich, J. , and Carell, T. 2008. Synthesis of modified DNA by PCR with alkyne‐bearing purines followed by a click reaction. Org. Lett. 10:249‐251.
   Ichida, J.K. , Zou, K. , Horhota, A. , Yu, B. , McLaughlin, L.W. , and Szostak, J.W. 2005. An in vitro selection system for TNA. J. Am. Chem. Soc. 127:2802‐2803.
   Julien, J.‐P. , Sok, D. , Khayat, R. , Lee, J.H. , Doores, K.J. , Walker, L.M. , Ramos, A. , Diwanji, D.C. , Pejchal, R. , Cupo, A. , Katpally, U. , Depetris, R.S. , Stanfield, R.L. , McBride, R. , Marozsan, A.J. , Paulson, J.C. , Sanders, R.W. , Moore, J.P. , Burton, D.R. , Poignard, P. , Ward, A.B. , and Wilson, I.A. 2013. Broadly neutralizing antibody PGT121 allosterically modulates CD4 binding via recognition of the HIV‐1 gp120 V3 base and multiple surrounding glycans. PLoS Pathog. 9:e1003342.
   Keefe, A.D. and Cload, S.T. 2008. SELEX with modified nucleotides. Curr. Opin. Chem. Biol. 12:448‐456.
   MacPherson, I.S. , Temme, J.S. , Habeshian, S. , Felczak, K. , Pankiewicz, K. , Hedstrom, L. , and Krauss, I.J. 2011. Multivalent glycocluster design through directed evolution. Angew. Chem. Int. Ed. 50:11238‐11242.
   Pejchal, R. , Doores, K.J. , Walker, L.M. , Khayat, R. , Huang, P.‐S. , Wang, S.‐K. , Stanfield, R.L. , Julien, J.‐P. , Ramos, A. , Crispin, M. , Depetris, R. , Katpally, U. , Marozsan, A. , Cupo, A. , Maloveste, S. , Liu, Y. , McBride, R. , Ito, Y. , Sanders, R.W. , Ogohara, C. , Paulson, J.C. , Feizi, T. , Scanlan, C.N. , Wong, C.‐H. , Moore, J.P. , Olson, W.C. , Ward, A.B. , Poignard, P. , Schief, W.R. , Burton, D.R. , and Wilson, I.A. 2011. A potent and broad neutralizing antibody recognizes and penetrates the HIV glycan shield. Science 334:1097‐1103.
   Rostovtsev, V.V. , Green, L.G. , Fokin, V.V. , and Sharpless, K.B. 2002. A stepwise Huisgen cycloaddition process: Copper(I)‐catalyzed regioselective “ligation” of azides and terminal alkynes. Angew. Chem. Int. Ed. 41:2596‐2599.
   Temme, J.S. , Drzyzga, M.G. , MacPherson, I.S. , and Krauss, I.J. 2013. Directed evolution of 2G12‐targeted nonamannose glycoclusters by SELMA. Chem. Eur. J. 19:17291‐17295.
   Temme, J.S. , MacPherson, I.S. , DeCourcey, J.F. , and Krauss, I.J. 2014. High temperature SELMA: Evolution of DNA‐supported oligomannose clusters which are tightly recognized by HIV bnAb 2G12. J. Am. Chem. Soc. 136:1726‐1729.
   Wang, L.‐X. 2013. Synthetic carbohydrate antigens for HIV vaccine design. Curr. Opin. Chem. Biol. 17:997‐1005.
   Woodman, M.E. 2008. Direct PCR of intact bacteria (colony PCR). Curr. Protoc. Microbiol. 9:A.3D.1‐A.3D.6.
   Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31:3406‐3415.
Internet Resources
   http://workbench.sdsc.edu/
  Biology WorkBench is a useful nucleic acid sequence database used for organizing and analyzing aptamer sequences.
   http://mfold.rna.albany.edu/?q=mfold
  The mfold web server offers nucleic acid secondary structure prediction algorithms.
   http://people.brandeis.edu/~kraussi/tools.html
  Provides an Excel file that is useful for predicting the multivalency profile of the starting library, and the video for running the click reaction under inert atmosphere.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library