Detection of Extracellular Vesicles Using Proximity Ligation Assay with Flow Cytometry Readout—ExoPLA

Liza Löf1, Linda Arngården1, Tonge Ebai1, Ulf Landegren1, Ola Söderberg2, Masood Kamali‐Moghaddam1

1 Department of Immunology, Genetics & Pathology, Science for Life Laboratory, Uppsala University, Uppsala, 2 Department of Pharmaceutical Biosciences, Uppsala University, Uppsala
Publication Name:  Current Protocols in Cytometry
Unit Number:  Unit 4.8
DOI:  10.1002/cpcy.22
Online Posting Date:  July, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Extracellular vesicles (EVs) are continuously released by most cells, and they carry surface markers of their cells of origin. Found in all body fluids, EVs function as conveyers of cellular information, and evidence implicates them as markers of disease. These characteristics make EVs attractive diagnostic targets. However, detection and characterization of EVs is challenging due to their small size. We've established a method, called ExoPLA, that allows individual EVs to be detected and characterized at high specificity and sensitivity. Based on the in situ proximity ligation assay (in situ PLA), proximal oligonucleotide‚Äźconjugated antibodies bound to their targets on the surfaces of the EVs allow formation of circular products that can be fluorescently labeled by rolling circle amplification. The intense fluorescent signals produced in this assay allow detection and enumeration of individual EVs by flow cytometry. We describe the procedures for ExoPLA, along with expected results and troubleshooting. ¬© 2017 by John Wiley & Sons, Inc.

Keywords: ExoPLA; exosomes; extracellular vesicles; flow cytometry; proximity ligation assay

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: ExoPLA for Detection and Characterization of Individual Extracellular Vesicles
  • Support Protocol 1: Preparation of Proximity Probes by Copper‐Free Click Conjugation
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: ExoPLA for Detection and Characterization of Individual Extracellular Vesicles

  Materials
  • Oligonucleotide‐conjugated antibodies (see protocol 2Support Protocol and Table 4.8.1), i.e., EV capture and proximity probes
  • 5′‐biotin‐conjugated oligonucleotide to bind EV‐capture antibody to magnetic beads
  • T1 streptavidin‐coated Dynabeads magnetic beads (Thermo Fisher Scientific)
  • 1× phosphate buffered saline (PBS), pH 7.4, filter sterilized
  • PBS supplemented with 0.05% Tween‐20 (PBST)
  • Bovine serum albumin (BSA; New England Biolabs)
  • Purified extracellular vesicles (EVs), see Löf et al. ( )
  • Odyssey blocking buffer (LICOR)
  • 1× Tris‐buffered saline (pH 7.4) supplemented with 0.05% Tween‐20 (TBST)
  • Goat serum (Life Technologies)
  • Sonicated salmon sperm DNA (Thermo Fisher Scientific)
  • Circularization oligonucleotides (see Table 4.8.2)
  • Tag‐specific oligonucleotides (see Table 4.8.2)
  • Ligation buffer (see recipe)
  • T4 DNA ligase (Fermentas)
  • Uracil‐DNA glycosylase enzyme (UNG; Fermentas)
  • Uracil‐DNA glycosylase buffer (Fermentas)
  • Phi29 polymerase (Fermentas)
  • RCA buffer (see recipe)
  • 1.5‐ml microcentrifuge tubes or 0.2‐ml PCR strips
  • DynaMag‐2 Magnet and DynaMag‐96 Side Mahermo Fisher Scientific, cat. nos. 12321D and 12331D)
  • Rotator (Giant Bio PTR‐30 360‐degree vertical multifunctional rotator)
NOTE: Throughout the protocol, reaction volumes are 50 μl per sample unless stated otherwise. All bead washes are performed three times in 1× TBST. Each wash is initiated by forming a bead pellet by introducing a magnet on the outside of the tube. When a bead pellet is formed after 30 sec, the liquid is removed and new solution is added. Make sure the beads are never allowed to become dry.
Table 4.8.1   MaterialsOligonucleotides Conjugated to AntibodiesOligonucleotides Used in ExoPLA

Name of antibody‐oligonucleotide conjugate Antibody DNA sequence (5′to 3′)
Capturing antibody/UNG digestion oligonucleotide 1 Purified mouse anti‐human CD63 antibodies
  • 5′‐azide‐AAAAACGAUUCGAGAACGUGAC
  • UGCCAUGCCAGCUCGUACUAUCGAATA
  • ATCGTACCCT
Proximity probe type 1 Monoclonal rat anti‐human DPPIV/CD26 5′‐azide‐GACGCTAATAGTTAAGACGCTT
Proximity probe type 2a Polyclonal goat anti‐human Neprilysin/CD10
  • 5′‐azide‐AAAAAAAAAATATGACAGAACAT
  • ACGGTCTCGCAGATCGCTTAGACACTCTT
Proximity probe type 2b Monoclonal mouse anti‐human CD13/Thy1
  • 5′‐azide‐AAAAAAAAAATATGACAGAACGG
  • ACGATCATCCAGCACTAGTAGACACTCTT
Proximity probe type 2c Polyclonal goat anti‐human Cathepsin B
  • 5′‐azide‐AAAAAAAAAATATGACAGAACCG
  • GGCGACATAAGCAGATACTAGACACTCTT
Description DNA sequence (5′to 3′)
Release UNG digestion oligonucleotide/CD63 capturing oligonucleotide 5′‐azide‐AAAAACGAUUCGAGAACGUGACUGCCAUGCCAGCUCGUACUAUCGAATAATCGTACCCT
Release UNG digestion oligonucleotide 5′‐biotin‐CGAUAGUACGAGCUGGCAUGGCAGUCACGUUCUCGAAUCGUUUU
Tag‐specific oligonucleotide for CD10/CD114 5′‐phosphate‐AGCGATCTGCGAGACCGTAT
Tag‐specific oligonucleotide for CD13/Thy1 5′‐phosphate‐CTAGTGCTGGATGATCGTCC
Tag‐specific oligonucleotide for Cathepsin B 5′‐phosphate‐GTATCTGCTTATGTCGCCCG
Short circularization oligonucleotide 5′‐phosphate‐GTTCTGTCATATTTAAGCGTCTTAA
Long circularization oligonucleotide 5′‐phosphate‐CTATTAGCGTCCAGTGAATGCGAGTCCGTCTAAGAGAGTAGTACAGCAGCCGTCAAGAGTGTCTA
Tag‐specific detection oligonucleotide for CD10/CD114 5′‐Cy5‐AGCGATCTGCGAGACCGTATUUUU
Tag‐specific detection oligonucleotide for CD13/Thy1 5′‐Pacific Blue‐CTAGTGCTGGATGATCGTCCUUUU
Tag‐specific detection oligonucleotide for Cathepsin B 5′‐Cy3‐GTATCTGCTTATGTCGCCCGUUUU

Table 4.8.2   MaterialsOligonucleotides Conjugated to AntibodiesOligonucleotides Used in ExoPLA

Name of antibody‐oligonucleotide conjugate Antibody DNA sequence (5′to 3′)
Capturing antibody/UNG digestion oligonucleotide 1 Purified mouse anti‐human CD63 antibodies
  • 5′‐azide‐AAAAACGAUUCGAGAACGUGAC
  • UGCCAUGCCAGCUCGUACUAUCGAATA
  • ATCGTACCCT
Proximity probe type 1 Monoclonal rat anti‐human DPPIV/CD26 5′‐azide‐GACGCTAATAGTTAAGACGCTT
Proximity probe type 2a Polyclonal goat anti‐human Neprilysin/CD10
  • 5′‐azide‐AAAAAAAAAATATGACAGAACAT
  • ACGGTCTCGCAGATCGCTTAGACACTCTT
Proximity probe type 2b Monoclonal mouse anti‐human CD13/Thy1
  • 5′‐azide‐AAAAAAAAAATATGACAGAACGG
  • ACGATCATCCAGCACTAGTAGACACTCTT
Proximity probe type 2c Polyclonal goat anti‐human Cathepsin B
  • 5′‐azide‐AAAAAAAAAATATGACAGAACCG
  • GGCGACATAAGCAGATACTAGACACTCTT
Description DNA sequence (5′to 3′)
Release UNG digestion oligonucleotide/CD63 capturing oligonucleotide 5′‐azide‐AAAAACGAUUCGAGAACGUGACUGCCAUGCCAGCUCGUACUAUCGAATAATCGTACCCT
Release UNG digestion oligonucleotide 5′‐biotin‐CGAUAGUACGAGCUGGCAUGGCAGUCACGUUCUCGAAUCGUUUU
Tag‐specific oligonucleotide for CD10/CD114 5′‐phosphate‐AGCGATCTGCGAGACCGTAT
Tag‐specific oligonucleotide for CD13/Thy1 5′‐phosphate‐CTAGTGCTGGATGATCGTCC
Tag‐specific oligonucleotide for Cathepsin B 5′‐phosphate‐GTATCTGCTTATGTCGCCCG
Short circularization oligonucleotide 5′‐phosphate‐GTTCTGTCATATTTAAGCGTCTTAA
Long circularization oligonucleotide 5′‐phosphate‐CTATTAGCGTCCAGTGAATGCGAGTCCGTCTAAGAGAGTAGTACAGCAGCCGTCAAGAGTGTCTA
Tag‐specific detection oligonucleotide for CD10/CD114 5′‐Cy5‐AGCGATCTGCGAGACCGTATUUUU
Tag‐specific detection oligonucleotide for CD13/Thy1 5′‐Pacific Blue‐CTAGTGCTGGATGATCGTCCUUUU
Tag‐specific detection oligonucleotide for Cathepsin B 5′‐Cy3‐GTATCTGCTTATGTCGCCCGUUUU

 aU represents 2′‐O‐methyl‐RNA Uracil.
 bAll oligonucleotides are purchased from Integrated DNA Technologies.

Support Protocol 1: Preparation of Proximity Probes by Copper‐Free Click Conjugation

  Materials
  • DBCO‐NHS ester (Sigma‐Aldrich, cat no. 761532), bifunctional crosslinker
  • Dimethyl sulfoxide (DMSO) (Sigma)
  • Antibodies (see Table 4.8.1), in amine‐free buffer, pH 7.4
  • 5′‐azide‐oligonucleotides (see Table 4.8.1)
  • 1 M Tris·Cl, pH 8.0
  • 1× PBS, pH 7.4 ( appendix 2A)
  • BSA (New England Biolabs)
  • Sodium azide
  • Zeba desalting column (Thermo Fisher Scientific, cat. no. 89882)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Andaloussi, M. I., Breakefield, X. O., Breakefield, Xo., Wood, M. J. A., & Wood, M. J. (2013). Extracellular vesicles: Biology and emerging therapeutic opportunities. Nature Reviews Drug Discovery, 12(5), 347–357. doi: 10.1038/nrd3978.
  Andre, F., Schartz, N., Movassagh, M., Flament, C., Pautier, P., Morice, P., … Zitvogel, L. (2002). Malignant effusions and immunogenic tumour‐derived exosomes. Lancet, 360(9329), 295–305. doi: 10.1016/S0140‐6736(02)09552‐1.
  Arraud, N., Gounou, C., Turpin, D., & Brisson, A. (2016). Fluorescence triggering: A general strategy for enumerating and phenotyping extracellular vesicles by flow cytometry. Cytom Part A, 89(2), 184–195. doi: 10.1002/cyto.a.22669.
  Arraud, N., Linares, R., Tan, S., Gounou, C., Pasquet, J. M., Mornet, S., & Brisson, A. R. (2014). Extracellular vesicles from blood plasma: Determination of their morphology, size, phenotype and concentration. Journal of Thrombosis and Haemostasis, 12(5), 614–627. doi: 10.1111/jth.12554.
  Bang, C., & Thum, T. (2012). Exosomes: New players in cell‐cell communication. The International Journal of Biochemistry & Cell Biology, 44(11), 2060–2064. doi: 10.1016/j.biocel.2012.08.007.
  Bard, M. P., Hegmans, J., Hemmes, A., Luider, T., Willemsen, R., Severijnen, L., … Lambrecht, B. N. (2004). Proteomic analysis of exosomes isolated from human malignant pleural effusions. American Journal of Respiratory Cell and Molecular Biology, 31(1), 114–121. doi: 10.1165/rcmb.2003‐0238OC.
  Freyssinet, J. M. (2003). Cellular microparticles: What are they bad or good for? Journal of Thrombosis and Haemastasis, 1, 1655–1662.
  Leuchowius, K.‐J., Clausson, C.‐M., Grannas, K., Erbilgin, Y., Botling, J., Zieba, A., … Söderberg, O. (2013). Parallel visualization of multiple protein complexes in individual cells in tumor tissue. Molecular & Cellular Proteomics, 12(6), 1563–1571. doi: 10.1074/mcp.O112.023374.
  Leuchowius, K. J., Weibrecht, I., Landegren, U., Gedda, L., & Soderberg, O. (2009). Flow cytometric in situ proximity ligation analyses of protein interactions and post‐translational modification of the epidermal growth factor receptor family. Cytometry Part A, 75A(10), 833–839. doi: 10.1002/cyto.a.20771.
  Löf, L., Ebai, T., Dubois, L., Wik, L., Ronquist, K. G., Nolander, O., … Kamali‐Moghaddam, M. (2016). Detecting individual extracellular vesicles using a multicolor in situ proximity ligation assay with flow cytometric readout. Scientific Reports, 6, 34358. doi:10.1038/srep34358.
  Soderberg, O., Gullberg, M., Jarvius, M., Ridderstrale, K., Leuchowius, K. J., Jarvius, J., … Landegren, U. (2006). Direct observation of individual endogenous protein complexes in situ by proximity ligation. Nature Methods, 3(12), 995–1000. doi: 10.1038/nmeth947.
  van der Pol, E., Coumans, F. A. W., Grootemaat, A. E., Gardiner, C., Sargent, I. L., Harrison, P., … Nieuwland, R. (2014). Particle size distribution of exosomes and microvesicles determined by transmission electron microscopy, flow cytometry, nanoparticle tracking analysis, and resistive pulse sensing. Journal of Thrombosis and Haemostasis, 12(7), 1182–1192. doi: 10.1111/jth.12602.
  Yanez‐Mo, M., Siljander, P. R., Andreu, Z., Zavec, A. B., Borras, F. E., Buzas, E. I., … De Wever, O. (2015). Biological properties of extracellular vesicles and their physiological functions. Journal of Extracellular Vesicles, 4(14), 27066. doi: 10.3402/jev.v4.27066.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library