Assessing Mitochondrial Redox Status by Flow Cytometric Methods: Vascular Response to Fluid Shear Stress

Rongsong Li1, Nelson Jen1, Fei Yu1, Tzung K. Hsiai1

1 Cardiovascular Engineering Research, Department of Biomedical Engineering and Cardiology, School of Medicine and School of Engineering, University of Southern California, Los Angeles, California
Publication Name:  Current Protocols in Cytometry
Unit Number:  Unit 9.37
DOI:  10.1002/0471142956.cy0937s58
Online Posting Date:  October, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Mitochondria are an important source of superoxide production contributing to physiological and pathological responses, including vascular oxidative stress that is relevant to cardiovascular diseases. Vascular oxidative stress is intimately linked with pro‐inflammatory states and atherosclerosis. Oxidized low‐density lipoprotein (OxLDL) modulates intracellular redox status and induces apoptosis in endothelial cells. Hemodynamic, specifically, fluid shear stress imparts both biomechanical and metabolic effects on vasculature. Mitochondria are an important source of superoxide production contributing to vascular oxidative stress with relevance to cardiovascular diseases. We hereby present biophysical and biochemical approaches, including fluorescence‐activated cell sorting, to assess the dynamics of vascular redox status. Curr. Protoc. Cytom. 58:9.37.1‐9.37.14. © 2011 by John Wiley & Sons, Inc.

Keywords: flow cytometry; oxidative stress; shear stress; mitochondrial redox status

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Assessing Mitohcondrrial Redox Status in Response to Fluid Shear Stress
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Assessing Mitohcondrrial Redox Status in Response to Fluid Shear Stress

  Materials
  • Bovine (BAEC) or human aortic endothelial cells (HAEC)
  • High glucose (4.5 g/liter) DMEM (Invitrogen)
  • Heat‐inactivated fetal bovine serum (Hyclone)
  • 100 U/ml L‐glutamine‐penicillin‐streptomycin (Sigma)
  • JNK inhibitor SP600125 (10 µM) or NADPH oxidase inhibitor apocynin (1 mM) or anti‐oxidant N‐acetyl cysteine (NAC, 5 mM; Sigma)
  • siRNA target sequence for bovine JNK1: 5′‐CATGGAGCTCATGGATGCAAA‐TCTT‐3′ (30 nM)
  • siRNA target sequence for bovine JNK2: 5′‐CATGAAAGAATGTCCTACCTTCTTT‐3′. (30 nM)
  • Negative control siRNA (Qiagen)
  • Lipofectamine RNAiMAX (Invitrogen)
  • Rotenone (Sigma)
  • Oligomycin (Alexora)
  • FCCP [carbonylcyanide‐4‐(trifluoromethoxy)‐phenylhydrazone; Sigma]
  • Cyclosporin‐A (Sigma)
  • MnTMPyP (Alexora)
  • Cationic fluorescent dye, tetramethylrhodamine methyl ester (TMRM+; Molecular Probes)
  • Dulbecco's phosphate‐buffered saline (DPBS; Invitrogen)
  • Trypsin/EDTA (Invitrogen)
  • MitoSOX Red (Invitrogen)
  • Dulbecco's phosphate‐buffered saline supplemented with 2% FBS (Hyclone)
  • 2% Paraformaldehyde
  • Glass slides (5 cm2; BD Bioscience)
  • 37°C, 5% CO 2 incubator
  • FACS Caliber system (BD Biosciences)
  • Flow cytometer (e.g., BD LSR II, BD Biosciences)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Beltran, B., Mathur, A., Duchen, M.R., Erusalimsky, J.D., and Moncada, S. 2000. The effect of nitric oxide on cell respiration: A key to understanding its role in cell survival or death. Proc. Natl. Acad. Sci. U.S.A. 97:14602‐14607.
   Cassarino, D.S., Swerdlow, R.H., Parks, J.K., Parker, W.D. Jr., and Bennett, J.P. Jr. 1998. Cyclosporin A increases resting mitochondrial membrane potential in SY5Y cells and reverses the depressed mitochondrial membrane potential of Alzheimer's disease cybrids. Biochem. Biophys. Res. Comm. 248:168‐173.
   Chacon, E., Reece, J.M., Nieminen, A.L., Zahrebelski, G., Herman, B., and Lemasters, J.J. 1994. Distribution of electrical potential, pH, free Ca2+, and volume inside cultured adult rabbit cardiac myocytes during chemical hypoxia: A multiparameter digitized confocal microscopic study. Biophys. J. 66:942‐952.
   Chen, L.B. 1988. Mitochondrial membrane potential in living cells. Annu. Rev. Cell Biol. 4:155‐181.
   Cheng, J., Cui, R., Chen, C.H., and Du, J. 2007. Oxidized low‐density lipoprotein stimulates p53‐dependent activation of proapoptotic Bax leading to apoptosis of differentiated endothelial progenitor cells. Endocrinology 148:2085‐2094.
   Cominacini, L., Pasini, A.F., Garbin, U., Evangelista, S., Crea, A.E., Tagliacozzi, D., Nava, C., Davoli, A., and LoCascio, V. 2002. Zofenopril inhibits the expression of adhesion molecules on endothelial cells by reducing reactive oxygen species. Am. J. Hypertension 15:891‐895.
   Cortese, J.D. 1999. Rat liver GTP‐binding proteins mediate changes in mitochondrial membrane potential and organelle fusion. Am. J. Physiol. 276:C611‐620.
   Davidson, S.M. and Duchen, M.R. 2007. Endothelial mitochondria: Contributing to vascular function and disease. Circ. Res. 100:1128‐1141.
   De Keulenaer, G.W., Chappell, D.C., Ishizaka, N., Nerem, R.M., Alexander, R.W., and Griendling, K.K. 1998. Oscillatory and steady laminar shear stress differentially affect human endothelial redox state: Role of a superoxide‐producing NADH oxidase. Circ. Res. 82:1094‐1101.
   de Nigris, F., Franconi, F., Maida, I., Palumbo, G., Anania, V., and Napoli, C. 2000. Modulation by [alpha]‐and [gamma]‐tocopherol and oxidized low‐density lipoprotein of apoptotic signaling in human coronary smooth muscle cells. Biochem. Pharmacol. 59:1477‐1487.
   Deng, T., Zhang, L., Ge, Y., Lu, M., and Zheng, X. 2009. Redistribution of intracellular calcium and its effect on apoptosis in macrophages: Induction by oxidized LDL. Biomed. Pharmacother. 63:267‐274.
   Dimmeler, S., Haendeler, J., Galle, J., and Zeiher, A.M. 1997. Oxidized low‐density lipoprotein induces apoptosis of human endothelial cells by activation of CPP32‐like proteases: A mechanistic clue to the ‘response to injury’ hypothesis. Circulation 95:1760‐1763.
   Duchen, M.R., Surin, A., and Jacobson, J. 2003. Imaging mitochondrial function in intact cells. Biophotonics B 361:353‐389.
   Ehrenberg, B., Farkas, D.L., Fluhler, E.N., Lojewska, Z., and Loew, L.M. 1987. Membrane potential induced by external electric field pulses can be followed with a potentiometric dye. Biophys. J. 51:833‐837.
   Floryk, D. and Houstek, J. 1999. Tetramethyl rhodamine methyl ester (TMRM) is suitable for cytofluorometric measurements of mitochondrial membrane potential in cells treated with digitonin. Bioscience Reports 19:27‐34.
   Forman, H.J. and Azzi, A. 1999. Production of reactive oxygen species in mitochondria and age‐associated pathophysiology: A reality check. In Understanding the Process of Aging: The Roles of Mitochondria, Free Radicals and Antioxidants (L.P.E. Cadenas, ed.) pp. 73‐94. Marcel Dekker, New York.
   Gorlach, A., Brandes, R.P., Nguyen, K., Amidi, M., Dehghani, F., and Busse, R. 2000. A gp91phox containing NADPH oxidase selectively expressed in endothelial cells is a major source of oxygen radical generation in the arterial wall. Circ. Res. 87:26‐32.
   Griendling, K.K. and FitzGerald, G.A. 2003. Oxidative stress and cardiovascular injury: Part II: Animal and human studies. Circulation 108:2034‐2040.
   Gutierrez, J., Ballinger, S.W., Darley‐Usmar, V.M., and Landar, A. 2006. Free radicals, mitochondria, and oxidized lipids: The emerging role in signal transduction in vascular cells. Circ. Res. 99:924‐932.
   Harada‐Shiba, M., Kinoshita, M., Kamido, H., and Shimokado, K. 1998. Oxidized low density lipoprotein induces apoptosis in cultured human umbilical vein endothelial cells by common and unique mechanisms. J. Biol. Chem. 273:9681‐9687.
   Harrison, D., Griendling, K., Landmesser, U., Hornig, B., and Drexler, H. 2003. Role of oxidative stress in atherosclerosis. Am. J. Cardiol. 91:7‐11.
   Hausenloy, D.J. and Yellon, D.M. 2003. The mitochondrial permeability transition pore: Its fundamental role in mediating cell death during ischaemia and reperfusion. J. Molec. Cell. Cardiol. 35:339‐341.
   Hsiai, T.K., Cho, S.K., Reddy, S., Hama, S., Navab, M., Demer, L.L., Honda, H.M., and Ho, C.M. 2001. Pulsatile flow regulates monocyte adhesion to oxidized lipid‐induced endothelial cells. Arterioscler. Thromb. Vasc. Biol. 21:1770‐1776.
   Hsiai, T.K., Hwang, J., Barr, M.L., Correa, A., Hamilton, R., Alavi, M., Rouhanizadeh, M., Cadenas, E., and Hazen, S.L. 2007. Hemodynamics influences vascular peroxynitrite formation: Implication for low‐density lipoprotein apo‐B‐100 nitration. Free Radic. Biol. Med. 42:519‐529.
   Hwang, J., Ing, M.H., Salazar, A., Lassèque, B., Griendling, K., Navab, M., Sevanian, A., and Hsiai, T.K. 2003a. Pulsatile versus oscillatory shear stress regulates NADPH oxidase subunit expression—Implication for native LDL oxidation. Circ. Res. 93:1225‐1232.
   Hwang, J.N., Saha, A., Boo, Y.C., Sorescu, G.P., McNally, J.S., Holland, S.M., Dikalov, S., Giddens, D.P., Griendling, K.K., Harrison, D.G., and Jo, H. 2003b. Oscillatory shear stress stimulates endothelial production of O2‐ from p47phox‐dependent NAD(P)H oxidases leading to monocyte adhesion. Free Radic. Biol. Med. 35:S26‐S26.
   Inoue, N., Ramasamy, S., Fukai, T., Nerem, R.M., and Harrison, D.G. 1996. Shear stress modulates expression of Cu/Zn superoxide dismutase in human aortic endothelial gels. Circ. Res. 79:32‐37.
   Korshunov, S.S., Skulachev, V.P., and Starkov, A.A. 1997. High protonic potential actuates a mechanism of production of reactive oxygen species in mitochondria. FEBS Lett. 416:15‐18.
   Ku, D.N., Giddens, D.P., Zarins, C.K.,and Glagov, S. 1985. Pulsatile flow and atherosclerosis in the human carotid bifurcation. Positive correlation between plaque location and low oscillating shear stress. Arteriosclerosis 5:293‐302.
   Kudo, S., Morigaki, R., Saito, J., Ikeda, M., Oka, K., and Tanishita, K. 2000. Shear‐stress effect on mitochondrial membrane potential and albumin uptake in cultured endothelial cells. Biochem. Biophys. Res. Comm. 270:616‐621.
   Lee, I., Bender, E., and Kadenbach, B. 2002. Control of mitochondrial membrane potential and ROS formation by reversible phosphorylation of cytochrome c oxidase. Molec. Cell. Biochem. 234:63‐70.
   Li, H.L., Wang, A.B., Zhang, R., Wei, Y.S., Chen, H.Z., She, Z.G., Huang, Y., Liu, D.P., and Liang, C.C. 2006. A20 inhibits oxidized low‐density lipoprotein‐induced apoptosis through negative Fas/Fas ligand‐dependent activation of caspase‐8 and mitochondrial pathways in murine RAW264.7 macrophages. J. Cell. Physiol. 208:307‐318.
   Li, R., Beebe, T., Cui, J., Rouhanizadeh, M., Ai, L., Wang, P., Gundersen, M., Takabe, W., and Hsiai, T.K. 2009. Pulsatile shear stress increased mitochondrial membrane potential: Implication of Mn‐SOD. Biochem. Biophys. Res. Comm. 388:406‐412.
   Liberman, E.A., Topaly, V.P., Tsofina, L.M., Jasaitis, A.A., and Skulachev, V.P. 1969. Mechanism of coupling of oxidative phosphorylation and membrane potential of mitochondria. Nature 222:1076‐1078.
   Liu, X., Zhao, J., Xu, J., Zhao, B., Zhang, Y., Zhang, S., and Miao, J. 2009. Protective effects of a benzoxazine derivative against oxidized LDL‐induced apoptosis and the increases of integrin [beta] 4, ROS, NF‐[kappa] B and P53 in human umbilical vein endothelial cells. Bioorg. Med. Chem. Lett. 19:2896‐2900.
   Loew, L.M., Tuft, R.A., Carrington, W., and Fay, F.S. 1993. Imaging in five dimensions: time‐dependent membrane potentials in individual mitochondria. Biophys. J. 65:2396‐2407.
   Martinet, W. and Kockx, M.M. 2001. Apoptosis in atherosclerosis: Focus on oxidized lipids and inflammation. Curr. Opin. Lipidol. 12:535‐541.
   Mitchell, J.W. and Thomas, J.A. 1979. Role of ATP in phosphorylation of bovine heart glycogen synthase. Federation Proc. 38:480‐480.
   Navab, M., Berliner, J.A., Watson, A.D., Hama, S.Y., Territo, M.C., Lusis, A.J., Shih, D.M., Van Lenten, B.J., Frank, J.S., Demer, L.L., Edwards, P.A., and Fogelman, A.M. 1996. The yin and yang of oxidation in the development of the fatty streak. A review based on the 1994 George Lyman Duff Memorial Lecture. Arterioscl. Thromb. Vasc. Biol. 16:831‐842.
   Nicholls, D.G. 2006. Simultaneous monitoring of ionophore‐ and inhibitor‐mediated plasma and mitochondrial membrane potential changes in cultured neurons. J. Biol. Chem. 281:14864‐14874.
   Nisoli, E., Clementi, E., Carruba, M.O., and Moncada, S. 2007. Defective mitochondrial biogenesis—A hallmark of the high cardiovascular risk in the metabolic syndrome? Circ. Res. 100:795‐806.
   Robinson, K.M., Janes, M.S., Pehar, M., Monette, J.S., Ross, M.F., Hagen, T.M., Murphy, M.P., and Beckman, J.S. 2006. Selective fluorescent imaging of superoxide in vivo using ethidium‐based probes. Proc. Natl. Acad. Sci. U.S.A. 103:15038‐15043.
   Scaduto, R.C. and Grotyohann, L.W. 1999. Measurement of mitochondrial membrane potential using fluorescent rhodamine derivatives. Biophys. J. 76:469‐477.
   Senior, A.E. 1988. ATP synthesis by oxidative‐phosphorylation. Physiolog. Rev. 68:177‐231.
   Sorescu, G.P., Song, H., Tressel, S.L., Hwang, J., Dikalov, S., Smith, D.A., Boyd, N.L., Platt, M.O., Lassèque, B., Griendling, K.K., and Jo, H. 2004. Bone morphogenic protein 4 produced in endothelial cells by oscillatory shear stress induces monocyte adhesion by stimulating reactive oxygen species production from a nox1‐based NADPH oxidase. Circ. Res. 95:773‐779.
   Stocker, R. and Keaney, J.F. Jr. 2004. Role of oxidative modifications in atherosclerosis. Physiolog. Rev. 84:1381‐1478.
   Storz, P. 2007. Mitochondrial ROS—Radical detoxification, mediated by protein kinase D. Trends Cell Biol. 17:13‐18.
   Ward, M.W., Rego, A.C., Frenquelli, B.G., and Nicholls, D.G. 2000. Mitochondrial membrane potential and glutamate excitotoxicity in cultured cerebellar granule cells. J. Neurosci. 20:7208‐7219.
   Zmijewski, J.W., Moellering, D.R., Le Goffe, C., Landar, A., Ramachandran, A., and Darley‐Usmar, V.M. 2005. Oxidized LDL induces mitochondrially associated reactive oxygen/nitrogen species formation in endothelial cells.” Am. J. Physiol. Heart Circ. Physiol. 289:H852‐H861.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library