Quantitative Analysis of Cellular Senescence in Culture and In Vivo

Jing Zhao1, Heike Fuhrmann‐Stroissnigg1, Aditi U. Gurkar1, Rafael R. Flores1, Akaitz Dorronsoro1, Donna B. Stolz2, Claudette M. St. Croix2, Laura J. Niedernhofer1, Paul D. Robbins1

1 Department of Metabolism and Aging, The Scripps Research Institute, Jupiter, Florida, 2 Department of Cell Biology, University of Pittsburgh School of Medicine, Pittsburgh
Publication Name:  Current Protocols in Cytometry
Unit Number:  Unit 9.51
DOI:  10.1002/cpcy.16
Online Posting Date:  January, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Cellular senescence refers to the irreversible growth arrest of normally dividing cells in response to various types of stress. Cellular senescence is induced by telomere shortening due to repeated cell division, which causes a DNA damage response, as well as genotoxic, oxidative, and inflammatory stress. Strong mitogenic signaling, such as oncogene activation, also drives cells into a senescent state. Senescent cells express a specific subset of genes, termed the senescence‐associated secretory phenotype (SASP), including pro‐inflammatory factors, growth factors, and matrix metalloproteinases, which together promote non‐cell autonomous, secondary senescence. Clearance of senescent cells that accumulate with age improves health span, implicating cellular senescence as a contributing factor to the aging process. Thus, there is a need for methods to identify and quantify cellular senescence, both in cultured cells and in vivo. Here, methods for the most well‐characterized and widely used senescent assays are described, from cell morphology and senescence‐associated β‐galactosidase (SA‐βgal) staining to nuclear biomarkers, SASP, and altered levels of tumor suppressors. © 2017 by John Wiley & Sons, Inc.

Keywords: senescence; aging; biomarkers; cell signaling

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Assessment of Senescence‐Associated β‐Galactosidase (SA‐βgal) Activity in Culture, In Vivo, and Parametrial and Perigonadal Fat
  • Support Protocol 1: Fluorescence‐Based C12FDG Senescence and Cell Death Protocol for Flow Analysis
  • Basic Protocol 2: Measurement of the Expression of Biomarkers of Senescence by Quantitative Real‐Time Polymerase Chain Reaction (qRT‐PCR) In Vivo
  • Alternate Protocol 1: Measurement of the Expression of Biomarkers of Senescence by Quantitative Real‐Time Polymerase Chain Reaction (qRT‐PCR) In Vitro
  • Basic Protocol 3: Assessment of Senescent Cells by Cell Morphology
  • Basic Protocol 4: Measurement of Lamin B and γH2AX by Immunofluorescence
  • Basic Protocol 5: Immunoblot DNA Damage Response (DDR) Proteins—p53, p21, and γH2AX
  • Basic Protocol 6: Assessment of Senescence‐Associated Secretory Phenotype (SASP) Proteins in Supernatants From In Vitro Culture
  • Alternate Protocol 2: Assessment of Senescence‐Associated Secretory Phenotype (SASP) Proteins in Serum/Plasma Samples
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Assessment of Senescence‐Associated β‐Galactosidase (SA‐βgal) Activity in Culture, In Vivo, and Parametrial and Perigonadal Fat

  Materials
  • Cells in 6‐well plates, freshly harvested tissues (e.g., liver, kidney, or pancreas), or freshly harvested adipose tissue
  • 1× phosphate‐buffered saline (PBS)
  • Fixative (see recipe for cell cultures and adipose tissue)
  • SA‐βgal staining solution (Table 9.51.1; mix well and adjust pH)
  • Methanol
  • Hoechst 33342 solution (Life Technologies, cat. no. H1399)
  • 10% buffered formalin phosphate (for tissues, e.g., liver, kidney, or pancreas)
  • 30% (w/v) sucrose solution
  • O.C.T compound
  • VECTASHIELD antifade mounting medium with DAPI
  • 37°C lab oven
  • pH meter
  • Bright‐field microscope
  • 15‐ or 50‐ml tubes (Falcon)
  • Whatman qualitative filter paper
  • Tissue‐Tek cryomold
  • Leica CM1950 cryostat
  • Fisherbrand Superfrost Plus microscope slides
  • Coverslips
Table 9.1.1   MaterialsSA‐βgal Staining Solution

Reagent Volume (ml)
20 mg/ml X‐gal in N,N‐dimethylformamide 1
0.2 M citric acid/Na phosphate buffer (see recipe) 4
100 mM potassium ferrocyanide (see recipe) 1
100 mM potassium ferricyanide (see recipe) 1
5 M sodium chloride (NaCl) in water (see recipe) 0.6
1 M magnesium chloride (MgCl 2⋅6H 2O) in water (see recipe) 0.04
Water 12.4

CAUTION: Potassium ferrocyanide and N,N‐dimethylformamide are toxic and should be handled with extra caution (wear gloves, laboratory coat, and goggles) and discarded into an appropriate waste container.

Support Protocol 1: Fluorescence‐Based C12FDG Senescence and Cell Death Protocol for Flow Analysis

  Materials
  • Cells seeded in 6‐well culture plates
  • 0.1 mM bafilomycin A1 (see recipe)
  • Cell culture medium
  • C 12FDG working solution (see recipe)
  • 0.25% trypsin/EDTA solution (Gibco)
  • PE‐Annexin V Apoptosis Detection Kit I (see recipe)
  • 37°C incubator
  • 5‐ml FACS tubes
  • Vortexer
  • BD LSR2 (Becton Dickinson) cytometer with BD FACS Diva software or equivalent
  • FlowJo analysis software or equivalent

Basic Protocol 2: Measurement of the Expression of Biomarkers of Senescence by Quantitative Real‐Time Polymerase Chain Reaction (qRT‐PCR) In Vivo

  Materials
  • Fresh tissue (e.g., liver, kidney, or fat)
  • Liquid nitrogen
  • TRI reagent solution (ThermoFisher)
  • Chloroform
  • Isopropanol
  • Ethanol 200 proof (molecular biology grade): to prepare 75% ethanol, mix 30 ml of 100% ethanol with 10 ml DEPC‐treated, RNase‐free water, store at −20°C
  • DEPC‐treated water (nuclease‐free)
  • SuperScript VILO master mix (ThermoFisher)
  • Platinum SYBR green qPCR SuperMix‐UDG with ROX (ThermoFisher)
  • Primers are as follows:
  • Cdkn1a (p21) forward: GTCAGGCTGGTCTGCCTCCG
  • Cdkn1a (p21) reverse: CGGTCCCGTGGACAGTGAGCAG
  • Cdkn2a (p16) forward: CCCAACGCCCCGAACT
  • Cdkn2a (p16) reverse: GCAGAAGAGCTGCTACGTGAA
  • Actb (β‐actin) forward: GATGTATGAAGGCTTTGGTC
  • Actb (β‐actin) reverse: TGTGCACTTTTATTGGTCTC
  • FastPrep‐24TM 5G
  • Homogenizer (MP Biomedicals)
  • 2.5‐ml microcentrifuge tubes
  • 1.7‐ml microcentrifuge tubes (Eppendorf)
  • 2‐ml lysing matrix D tissue homogenizing microtubes (MP Biomedicals, cat. no. 6913‐500)
  • Refrigerated microcentrifuge
  • Vortexer
  • Fine‐tip pipettes
  • NanoDrop 2000 spectrophotometer or equivalent
  • Thermal cycler
  • MicroAmp Fast 96‐well reaction plate and MicroAmp optical adhesive film kit (ABI)
  • StepOnePlus real‐time PCR system (ABI)
CAUTION: TRI reagent and chloroform are toxic or corrosive reagents. Extra caution is needed while handling these reagents. Working in a fume hood and wearing a laboratory coat, gloves, and safety goggles are recommended.

Alternate Protocol 1: Measurement of the Expression of Biomarkers of Senescence by Quantitative Real‐Time Polymerase Chain Reaction (qRT‐PCR) In Vitro

  Materials
  • Cells seeded on coverslip‐bottomed culture slides (e.g., Lab‐Tek) or culture dishes (e.g., MatTek Corp.)
  • Immersion oil
  • Microscope stage heater
  • Inverted microscope equipped with high numerical aperture (NA), 60× objective and DIC capabilities (analyzer and prisms) (Watkins and St. Croix, )

Basic Protocol 3: Assessment of Senescent Cells by Cell Morphology

  Materials
  • Cells
  • 1× PBS, ice cold
  • 2% paraformaldehyde (PFA)
  • Washing solution (see recipe)
  • Blocking/permeabilization solution (see recipe)
  • Primary antibody: anti‐Lamin B1 antibody (ab16048, rabbit polyclonal from Abcam) or mouse anti‐γH2AX Phospho S‐139 (1:1000, Millipore)
  • Antibody dilution buffer (see recipe)
  • Secondary‐anti‐mouse IgG (H + L), F(ab')2 fragment (Alexa Fluor 488 conjugate)
  • DAPI‐VECTASHIELD antifade mounting medium with DAPI
  • 4‐ or 8‐well chamber culture slides (Falcon)
CAUTION: Paraformaldehyde is toxic, use only in fume hood.

Basic Protocol 4: Measurement of Lamin B and γH2AX by Immunofluorescence

  Materials
  • Cultured cells or tissue
  • 1× PBS, ice cold
  • RIPA lysis buffer (see recipe), ice cold
  • Bradford reagent
  • Loading buffer (see recipe)
  • 4% to 12% gradient gel (Invitrogen)
  • Precision protein ladder (Bio‐Rad)
  • MES running buffer (see recipe)
  • Tris‐glycine transfer buffer (see recipe)
  • Ponceau S staining buffer (see recipe)
  • Tris‐buffered saline with Tween 20 (TBST) buffer (see recipe)
  • Blocking buffer: 5% milk in TBST
  • Antibody dilution buffer: 3% bovine serum albumin (BSA) in TBST
  • Primary antibody:
    • p53: mouse anti‐p53 (1:900, Cell Signaling)
    • p21: rabbit anti‐p21 (1:450, Abcam)
    • γH2AX: mouse anti‐γH2AX Phospho S‐139 (1:1000, Millipore)
  • Tubulin (loading control): rabbit anti‐tubulin (1:7500, Abcam)
  • Secondary‐anti‐rabbit HRP antibody (1:3000, Invitrogen) or anti‐mouse HRP (1:3000, Cell Signaling)
  • Cell scraper, cold
  • 1.7‐ml microcentrifuge tubes, cold
  • Vortexer
  • Sonicator
  • Refrigerated and benchtop microcentrifuges
  • Tissue homogenization tubes (MP Biomedical, cat. no. 6913‐500) and tissue homogenizer
  • 90°C heat block
  • Gel apparatus and power source
  • Nitrocellulose membrane

Basic Protocol 5: Immunoblot DNA Damage Response (DDR) Proteins—p53, p21, and γH2AX

  Materials
  • Cultured cells
  • Vials
  • Centrifuge

Basic Protocol 6: Assessment of Senescence‐Associated Secretory Phenotype (SASP) Proteins in Supernatants From In Vitro Culture

  Materials
  • Blood sample
  • Anti‐coagulant (e.g., ethylenediaminetetraacetic acid [EDTA], heparin, and sodium citrate)
  • Poly‐L‐coated beads
  • Centrifuge
  • 0.22‐μm nylon membranes
  • 1.5‐ml polypropylene tubes
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Acosta, J.C., Snijders, A.P., and Gil, J. 2013. Unbiased characterization of the senescence‐associated secretome using SILAC‐based quantitative proteomics. Methods Mol. Biol. 965:175‐184. doi: 10.1007/978‐1‐62703‐239‐1_11.
  Baker, D.J., Jin, F., and van Deursen, J.M. 2008a. The yin and yang of the Cdkn2a locus in senescence and aging. Cell Cycle 7:2795‐2802. doi: 10.4161/cc.7.18.6687.
  Baker, D.J., Perez‐Terzic, C., Jin, F., Pitel, K.S., Niederländer, N.J., Jeganathan, K., Yamada, S., Reyes, S., Rowe, L., Hiddinga, H.J., Eberhardt, N.L., Terzic, A., and van Deursen, J.M. 2008b. Opposing roles for p16Ink4a and p19Arf in senescence and ageing caused by BubR1 insufficiency. Nat. Cell Biol. 10:825‐836. doi: 10.1038/ncb1744.
  Baker, D.J., Wijshake, T., Tchkonia, T., LeBrasseur, N.K., Childs, B.G., van de Sluis, B., Kirkland, J.L., and van Deursen, J.M. 2011. Clearance of p16Ink4a‐positive senescent cells delays ageing‐associated disorders. Nature 479:232‐236. doi: 10.1038/nature10600
  Baker, D.J., Childs, B.G., Durik, M., Wijers, M.E., Sieben, C.J., Zhong, J., Saltness, R.A., Jeganathan, K.B., Verzosa, G.C., Pezeshki, A., Khazaie, K., Miller, J.D., and van Deursen, J.M. 2016. Naturally occurring p16Ink4a‐positive cells shorten healthy lifespan. Nature 530:184‐189. doi: 10.1038/nature16932.
  Beausejour, C.M., Krtolica, A., Galimi, F., Narita, M., Lowe, S.W., Yaswen, P., and Campisi, J. 2003. Reversal of human cellular senescence: Roles of the p53 and p16 pathways. EMBO J. 22:4212‐4222. doi: 10.1093/emboj/cdg417.
  Benhamed, M., Herbig, U., Ye, T., Dejean, A., and Bischof, O. 2012. Senescence is an endogenous trigger for microRNA‐directed transcriptional gene silencing in human cells. Nat. Cell Biol. 14:266‐275. doi: 10.1038/ncb2443.
  Bernardes de Jesus, B. and Blasco, M.A. 2012. Assessing cell and organ senescence biomarkers. Circ. Res. 111:97‐109. doi: 10.1161/CIRCRESAHA.111.247866.
  Bianchi, M.E. 2007. DAMPs, PAMPs and alarmins: All we need to know about danger. J. Leukoc. Biol. 81:1‐5. doi: 10.1189/jlb.0306164.
  Brown, J.P., Wei, W., and Sedivy, J.M. 1997. Bypass of senescence after disruption of p21CIP1/WAF1 gene in normal diploid human fibroblasts. Science 277:831‐834. doi: 10.1126/science.277.5327.831.
  Campisi, J. and d'Adda di Fagagna, F. 2007. Cellular senescence: When bad things happen to good cells. Nat. Rev. Mol. Cell Biol. 8:729‐740. doi: 10.1038/nrm2233.
  Carnero, A. 2013. Markers of cellular senescence. Methods Mol. Biol. 965:63‐81. doi: 10.1007/978‐1‐62703‐239‐1_4.
  Chang, J., Wang, Y., Shao, L., Laberge, R.M., Demaria, M., Campisi, J., Janakiraman, K., Sharpless, N.E., Ding, S., Feng, W., Luo, Y., Wang, X., Aykin‐Burns, N., Krager, K., Ponnappan, U., Hauer‐Jensen, M., Meng, A., and Zhou, D. 2016. Clearance of senescent cells by ABT263 rejuvenates aged hematopoietic stem cells in mice. Nat. Med. 22:78‐83. doi: 10.1038/nm.4010.
  Choudhury, A.R., Ju, Z., Djojosubroto, M.W., Schienke, A., Lechel, A., Schaetzlein, S., Jiang, H., Stepczynska, A., Wang, C., Buer, J., Lee, H.W., von Zglinicki, T., Ganser, A., Schirmacher, P., Nakauchi, H., and Rudolph, K.L. 2007. Cdkn1a deletion improves stem cell function and lifespan of mice with dysfunctional telomeres without accelerating cancer formation. Nat. Genet. 39:99‐105. doi: 10.1038/ng1937.
  Collado, M., Gil, J., Efeyan, A., Guerra, C., Schuhmacher, A.J., Barradas, M., Benguría, A., Zaballos, A., Flores, J.M., Barbacid, M., Beach, D., and Serrano M. 2005. Tumor biology: Senescence in premalignant tumors. Nature 436:642. doi: 10.1038/436642a.
  Coppe, J.P., Desprez, P.Y., Krtolica, A., and Campisi, J. 2010a. The senescence‐associated secretory phenotype: The dark side of tumor suppression. Annu. Rev. Pathol. 5:99‐118. doi: 10.1146/annurev‐pathol‐121808‐102144.
  Coppe, J.P., Patil, C.K., Rodier, F., Krtolica, A., Beauséjour, C.M., Parrinello, S., Hodgson, J.G., Chin, K., Desprez, P.Y., and Campisi, J. 2010b. A human‐like senescence‐associated secretory phenotype is conserved in mouse cells dependent on physiological oxygen. PloS One 5:e9188. doi: 10.1371/journal.pone.0009188.
  Coppe, J.P., Patil, C.K., Rodier, F., Sun, Y., Muñoz, D.P., Goldstein, J., Nelson, P.S., Desprez, P.Y., and Campisi, J. 2008. Senescence‐associated secretory phenotypes reveal cell‐nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6:2853‐2868. doi: 10.1371/journal.pbio.0060301.
  Davalos, A.R., Kawahara, M., Malhotra, G.K., Schaum, N., Huang, J., Ved, U., Beausejour, C.M., Coppe, J.P., Rodier, F., and Campisi J. 2013. p53‐dependent release of Alarmin HMGB1 is a central mediator of senescent phenotypes. J. Cell Biol. 201:613‐629. doi: 10.1083/jcb.201206006.
  de Jager, W., Prakken, B.J., Bijlsma, J.W., Kuis, W., and Rijkers, G.T. 2005. Improved multiplex immunoassay performance in human plasma and synovial fluid following removal of interfering heterophilic antibodies. J. Immunol. Methods 300:124‐135. doi: 10.1016/j.jim.2005.03.009.
  de Jager, W., Bourcier, K., Rijkers, G.T., Prakken, B.J., and Seyfert‐Margolis, V. 2009. Prerequisites for cytokine measurements in clinical trials with multiplex immunoassays. BMC Immunol. 10:1471‐2172 (Electronic):52. doi: 10.1186/1471‐2172‐10‐52.
  Debacq‐Chainiaux, F., Erusalimsky, J.D., Campisi, J., and Toussaint, O. 2009. Protocols to detect senescence‐associated beta‐galactosidase (SA‐[beta]gal) activity, a biomarker of senescent cells in culture and in vivo. Nat. Protoc. 4:1798‐1806. doi: 10.1038/nprot.2009.191.
  Dimri, G.P., Lee, X., Basile, G., Acosta, M., Scott, G., Roskelley, C., Medrano, E.E., Linskens, M., Rubelj, I., and Pereira‐Smith, O. 1995. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc. Natl. Acad. Sci. U.S.A. 92:9363‐9367. doi: 10.1073/pnas.92.20.9363.
  Eming, S.A., Martin, P., and Tomic‐Canic, M. 2014. Wound repair and regeneration: Mechanisms, signaling, and translation. Sci. Transl. Med. 6:265r266. doi: 10.1126/scitranslmed.3009337.
  Ernst Keller, H. and Watkins, S. 2001. Contrast enhancement in light microscopy. Curr. Protoc. Cytom. 63:2.1.1‐2.1.9. doi: 10.1002/0471142956.cy0201s63.
  Finkel, T. and Holbrook, N.J. 2000. Oxidants, oxidative stress and the biology of ageing. Nature 408:239‐247. doi: 10.1038/35041687.
  Franceschi, C. and Campisi J. 2014. Chronic inflammation (inflammaging) and its potential contribution to age‐associated diseases. J. Gerontol. A Biol. Sci. Med. Sci. 69:S4‐S9. doi: 10.1093/gerona/glu057.
  Frasca, D. and Blomberg, B.B. 2016. Inflammaging decreases adaptive and innate immune responses in mice and humans. Biogerontology 17:7‐19. doi: 10.1007/s10522‐015‐9578‐8.
  Freund, A., Patil, C.K., and Campisi, J. 2011. p38MAPK is a novel DNA damage response‐independent regulator of the senescence‐associated secretory phenotype. EMBO J. 30:1536‐1548. doi: 10.1038/emboj.2011.69.
  Freund, A., Orjalo, A.V., Desprez, P.Y., and Campisi, J. 2010. Inflammatory networks during cellular senescence: Causes and consequences. Trends Mol. Med. 16:238‐246. doi: 10.1016/j.molmed.2010.03.003.
  Freund, A., Laberge, R.M., Demaria, M., and Campisi, J. 2012. Lamin B1 loss is a senescence‐associated biomarker. Mol. Biol. Cell 23:2066‐2075. doi: 10.1091/mbc.E11‐10‐0884.
  Ghosal, G. and Chen J. 2013. DNA damage tolerance: A double‐edged sword guarding the genome. Trans. Cancer Res. 2:107‐129. doi: 10.3978/j.issn.2218‐676X.2013.04.01
  Gire, V., Roux, P., Wynford‐Thomas, D., Brondello, J.M., and Dulic, V. 2004. DNA damage checkpoint kinase Chk2 triggers replicative senescence. EMBO J. 23:2554‐2563. doi: 10.1038/sj.emboj.7600259.
  Hayflick, L. 1965. The limited in vitro lifetime of human diploid cell strains. Exp. Cell Res. 37:614‐636. doi: 10.1016/0014‐4827(65)90211‐9.
  Hayflick, L. and Moorhead, P.S. 1961. The serial cultivation of human diploid cell strains. Exp. Cell Res. 25:585‐621. doi: 10.1016/0014‐4827(61)90192‐6.
  Irvine, K.M., Skoien, R., Bokil, N.J., Melino, M., Thomas, G.P., Loo, D., Gabrielli, B., Hill, M.M., Sweet, M.J., Clouston, A.D., and Powell, E.E. 2014. Senescent human hepatocytes express a unique secretory phenotype and promote macrophage migration. World J. Gastroenterol. 20:17851‐17862. doi: 10.3748/wjg.v20.i47.17851.
  Kang, T.W., Yevsa, T., Woller, N., Hoenicke, L., Wuestefeld, T., Dauch, D., Hohmeyer, A., Gereke, M., Rudalska, R., Potapova, A., Iken, M., Vucur, M., Weiss, S., Heikenwalder, M., Khan, S., Gil, J., Bruder, D., Manns, M., Schirmacher, P., Tacke, F., Ott, M., Luedde, T., Longerich, T., Kubicka, S., and Zender, L. 2011. Senescence surveillance of pre‐malignant hepatocytes limits liver cancer development. Nature 479:547‐551. doi: 10.1038/nature10599.
  Keogh, M.‐C., Kim, J.A., Downey, M., Fillingham, J., Chowdhury, D., Harrison, J.C., Onishi, M., Datta, N., Galicia, S., Emili, A., Lieberman, J., Shen, X., Buratowski, S., Haber, J.E., Durocher, D., Greenblatt, J.F., and Krogan, N.J. 2006. A phosphatase complex that dephosphorylates [gamma]H2AX regulates DNA damage checkpoint recovery. Nature 439:497‐501. doi: 10.1038/nature04384.
  Krishnamurthy, J., Torrice, C., Ramsey, M.R., Kovalev, G.I., Al‐Regaiey, K., Su, L., and Sharpless, N.E. 2004. Ink4a/Arf expression is a biomarker of aging. J. Clin. Invest. 114:1299‐1307. doi: 10.1172/JCI22475.
  Krizhanovsky, V., Yon, M., Dickins, R.A., Hearn, S., Simon, J., Miething, C., Yee, H., Zender, L., and Lowe, S.W. 2008. Senescence of activated stellate cells limits liver fibrosis. Cell 134:657‐667. doi: 10.1016/j.cell.2008.06.049.
  Kuilman, T. and Peeper, D.S. 2009. Senescence‐messaging secretome: SMS‐ing cellular stress. Nat. Rev. Cancer 9:81‐94. doi: 10.1038/nrc2560.
  Kumar, M., Seeger, W., and Voswinckel, R. 2014. Senescence‐associated secretory phenotype and its possible role in chronic obstructive pulmonary disease. Am. J. Respir. Cell Mol. Biol. 51:323‐333. doi: 10.1165/rcmb.2013‐0382PS.
  Kurz, D.J., Decary, S., Hong, Y., and Erusalimsky, J.D. 2000. Senescence‐associated (beta)‐galactosidase reflects an increase in lysosomal mass during replicative ageing of human endothelial cells. J. Cell Sci. 113:3613‐3622.
  Lasry, A. and Ben‐Neriah, Y. 2015. Senescence‐associated inflammatory responses: Aging and cancer perspectives. Trends Immunol. 36:217‐228. doi: 10.1016/j.it.2015.02.009.
  Lavin, M.F. 2008. Ataxia‐telangiectasia: From a rare disorder to a paradigm for cell signaling and cancer. Nat. Rev. Mol. Cell Biol. 9:759‐769. doi: 10.1038/nrm2514.
  Lee, B.Y., Han, J.A., Im, J.S., Morrone, A., Johung, K., Goodwin, E.C., Kleijer, W.J., DiMaio, D., and Hwang, E.S. 2006. Senescence‐associated β‐galactosidase is lysosomal β‐galactosidase. Aging Cell 5:187‐195. doi: 10.1111/j.1474‐9726.2006.00199.x.
  Melk, A., Schmidt, B.M., Takeuchi, O., Sawitzki, B., Rayner, D.C., and Halloran, P.F. 2004. Expression of p16INK4a and other cell cycle regulator and senescence associated genes in aging human kidney. Kidney Int. 65:510‐520. doi: 10.1111/j.1523‐1755.2004.00438.x.
  Mishima, K., Handa, J.T., Aotaki‐Keen, A., Lutty, G.A., Morse, L.S., and Hjelmeland, L.M. 1999. Senescence‐associated beta‐galactosidase histochemistry for the primate eye. Invest. Ophthalmol. Vis. Sci. 40:1590‐1593.
  Passos, J.F., Nelson, G., Wang, C., Richter, T., Simillion, C., Proctor, C.J., Miwa, S., Olijslagers, S., Hallinan, J., Wipat, A., Saretzki, G., Rudolph, K.L., Kirkwood, T.B., and von Zglinicki, T. 2010. Feedback between p21 and reactive oxygen production is necessary for cell senescence. Mol. Syst. Biol. 6:347‐347. doi: 10.1038/msb.2010.5.
  Rodier, F. 2013. Detection of the senescence‐associated secretory phenotype (SASP). Methods Mol. Biol. 965:165‐173. doi: 10.1007/978‐1‐62703‐239‐1_10.
  Rodier, F. and Campisi, J. 2011. Four faces of cellular senescence. J. Cell Biol. 192:547‐556. doi: 10.1083/jcb.201009094.
  Salmon, E.D., von Lackum, K., and Canman, J.C. 2005. Proper alignment and adjustment of the light microscope. Curr. Protoc. Microbiol. 00:2A.1.1‐2A.1.31. doi: 10.1002/9780471729259.mc02a01s00
  Schmittgen, T.D. and Livak, K.J. 2008. Analyzing real‐time PCR data by the comparative C(T) method. Nat. Protoc. 3:1101‐1108. doi: 10.1038/nprot.2008.73.
  Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D., and Lowe, S.W. 1997. Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88:593‐602. doi: 10.1016/S0092‐8674(00)81902‐9.
  Shah, P.P., Donahue, G., Otte, G.L., Capell, B.C., Nelson, D.M., Cao, K., Aggarwala, V., Cruickshanks, H.A., Rai, T.S., McBryan, T., Gregory, B.D., Adams, P.D., and Berger, S.L. 2013. Lamin B1 depletion in senescent cells triggers large‐scale changes in gene expression and the chromatin landscape. Genes Dev. 27:1787‐1799. doi: 10.1101/gad.223834.113.
  Shiloh, Y. and Ziv, Y. 2013. The ATM protein kinase: Regulating the cellular response to genotoxic stress, and more. Nat. Rev. Mol. Cell Biol. 14:197‐210. doi: 10.1038/nrm3546.
  Shimi, T., Butin‐Israeli, V., Adam, S.A., Hamanaka, R.B., Goldman, A.E., Lucas, C.A., Shumaker, D.K., Kosak, S.T., Chandel, N.S., and Goldman, R.D. 2011. The role of nuclear lamin B1 in cell proliferation and senescence. Genes Dev. 25:2579‐2593. doi: 10.1101/gad.179515.111.
  Stewart, S.A. and Weinberg, R.A. 2002. Senescence: Does it all happen at the ends? Oncogene 21:627‐630. doi: 10.1038/sj.onc.1205062.
  Storer, M., Mas, A., Robert‐Moreno, A., Pecoraro, M., Ortells, M.C., Di Giacomo, V., Yosef, R., Pilpel, N., Krizhanovsky, V., Sharpe, J., and Keyes, W.M. 2013. Senescence is a developmental mechanism that contributes to embryonic growth and patterning. Cell 155:1119‐1130. doi: 10.1016/j.cell.2013.10.041.
  Tchkonia, T., Zhu, Y., van Deursen, J., Campisi, J., and Kirkland, J.L. 2013. Cellular senescence and the senescent secretory phenotype: Therapeutic opportunities. J. Clin. Invest. 123:966‐972. doi: 10.1172/JCI64098.
  Tuck, M.K., Chan, D.W., Chia, D., Godwin, A.K., Grizzle, W.E., Krueger, K.E., Rom, W., Sanda, M., Sorbara, L., Stass, S., Wang, W., and Brenner, D.E. 2009. Standard operating procedures for serum and plasma collection: Early detection research network consensus statement standard operating procedure integration working group. J. Proteome Res. 8:113‐117. doi: 10.1021/pr800545q.
  van Deursen, J.M. 2014. The role of senescent cells in ageing. Nature 509:439‐446. doi: 10.1038/nature13193.
  Watkins, S.C. and St. Croix, C.M. 2001. Building a live cell microscope: What you need and how to do it. Curr. Protoc. Cytom. 65:2.21.1‐2.21.10. doi: 10.1002/0471142956.cy0221s65
  Yamada, S. and Maruyama, I. 2007. HMGB1, a novel inflammatory cytokine. Clin. Chim. Acta 375:36‐42. doi: 10.1016/j.cca.2006.07.019.
  Zhu, Y., Tchkonia, T., Fuhrmann‐Stroissnigg, H., Dai, H.M., Ling, Y.Y., Stout, M.B., Pirtskhalava, T., Giorgadze, N., Johnson, K.O., Giles, C.B., Wren, J.D., Niedernhofer, L.J., Robbins, P.D., and Kirkland, J.L. 2016. Identification of a novel senolytic agent, navitoclax, targeting the Bcl‐2 family of anti‐apoptotic factors. Aging Cell 15:428‐435. doi: 10.1111/acel.12445.
  Zhu, Y., Tchkonia, T., Pirtskhalava, T., Gower, A.C., Ding, H., Giorgadze, N., Palmer, A.K., Ikeno, Y., Hubbard, G.B., Lenburg, M., O'Hara, S.P., LaRusso, N.F., Miller, J.D., Roos, C.M., Verzosa, G.C., LeBrasseur, N.K., Wren, J.D., Farr, J.N., Khosla, S., Stout, M.B., McGowan, S.J., Fuhrmann‐Stroissnigg, H., Gurkar, A.U., Zhao, J., Colangelo, D., Dorronsoro, A., Ling, Y.Y., Barghouthy, A.S., Navarro, D.C., Sano, T., Robbins, P.D., Niedernhofer, L.J., and Kirkland, J.L. 2015. The Achilles’ heel of senescent cells: From transcriptome to senolytic drugs. Aging Cell 14:644‐658. doi: 10.1111/acel.12344.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library