Application of the PrimRglo Assay Chemistry to Multiplexed Bead Assays

Liang Fang1, Anna Weis1, Lawrence Kurniawan Wong1, David Che‐Cheng Yeh1, Richard Lai1, Simon Corrie2, Ross T. Barnard3

1 School of Chemistry and Molecular Biosciences, The University of Queensland, Brisbane, Queensland, 2 Australian Institute for Bioengineering and Nanotechnology, The University of Queensland, Brisbane, Queensland, 3 Australian Infectious Diseases Research Centre, School of Chemistry and Molecular Biosciences, The University of Queensland, Brisbane, Queensland
Publication Name:  Current Protocols in Cytometry
Unit Number:  Unit 13.13
DOI:  10.1002/0471142956.cy1313s69
Online Posting Date:  July, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

In this unit, we describe a multiplex microsphere quantitative PCR. The system is based on the use of two additional oligonucleotides within a single tube PCR reaction. The first oligonucleotide is modified with a single base pair mismatch and is otherwise equivalent to a universal sequence added to the forward PCR primer. Further, this first extra oligonucleotide is coupled to Luminex microspheres. The second additional oligonucleotide is designed to be complementary to the universal sequence, and is modified with the fluorescent dye Cy3. As the PCR reaction proceeds, the second oligonucleotide is able to bind to the microspheres. Thus, quantitative monitoring of PCR progress takes place. The microsphere‐mediated Cy3‐detection is measured using flow cytometry directly after the PCR reaction. This allows a flow cytometer analysis from up to 150 different spheres and, therefore, multiple genes in one reaction. The multiplex microsphere qPCR is demonstrated using three target genes from Influenza A and Neisseria meningitidis. The multiplex microsphere system will enable a higher degree of multiplexing than is possible with currently available qPCR systems. Curr. Protoc. Cytom. 69:13.13.1‐13.13.10. © 2014 by John Wiley & Sons, Inc.

Keywords: flow cytometry; microsphere; PCR; real‐time

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • The Multiplex‐Microsphere‐Quantitative PCR System
  • Strategic Planning
  • Basic Protocol 1: EDC Coupling of Oligonucleotides onto Microspheres
  • Basic Protocol 2: Multiplex‐Microsphere‐Quantitative PCR
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: EDC Coupling of Oligonucleotides onto Microspheres

  Materials
  • TM‐Am oligonucleotide (Integrated DNA Technologies; see Table 13.13.1)
  • DNase‐free water (Pfizer)
  • Luminex MicroPlex nonmagnetic microspheres (Luminex, cat. nos. LC10035‐YY, LC10030‐YY, and LC10052‐YY
  • MES, pH 4.5 (Sigma, cat. no. M2933)
  • EDC (Pierce Biotechnology)
  • Tween‐20 (Sigma, cat. no. P9416)
  • 10% SDS (Sigma, cat. no. L4522)
  • TE buffer: 10 mM Tris·Cl, 1 mM disodium EDTA, pH 8.0 (Sigma)
  • Vortex mixer
  • 1.7‐ml Corning low‐binding plastic microcentrifuge tubes
  • Centrifuge
  • Aluminum foil
Table 3.3.1   MaterialsList of Primer and Probe Sequences

Name Sequence Purpose 5' modification 3' modification
porA‐TM1‐FP CTTTAATCTCAATCAATACAAATCCGGCTCGTTTATCGGCTT porA forward primer NA NA
porA‐RP CGACAAAGGATTCCCTGTT porA PCR reverse primer NA NA
TM1‐Am CTTTAATCTCCATCAATACAAATC porA reporter complex forward oligo Amino group NA
TM1′‐Cy3 GATTTGTATTGATTGAGATTAAAG porA reporter complex reverse oligo Cy3 NA
ctrA‐TM2‐PFFP TGATTGTAGTATGTATTGATAAAGCCGCATTATTCTGCACCA ctrA forward primer NA NA
ctrA‐PRRP GCCTTTCTTCGATGGGCT ctrA PCR reverse primer NA NA
TM2‐Am TGATTGTATTATGTATTGATAAAG ctrA reporter complex forward oligo Amino group NA
TM2′‐Cy3 CTTTATCAATACATACTACAATCA ctrA reporter complex reverse oligo Cy3 NA
FluA‐TM3‐PFFP GATTGTAAGATTTGATAAAGTGTACTTCTAACCGAGGTCGAAACGTA FluA M forward primer NA NA
FluA‐PRRP GGTGACAGGATTGGTCTTGTCTTTA FluA M PCR reverse primer NA NA
TM3‐Am GATTGTAAGAGTTGATAAAGTGTA FluA M reporter complex forward oligo Amino group NA
TM3′‐Cy3 TACACTTTATCAAATCTTACAATC FluA M reporter complex reverse oligo Cy3 NA

 aThe nucleotide bolded and underlined indicates the position of the one base pair mismatch between the reporter forward and reverse oligonucleotides.
 bThe universal sequences are shown in italics to distinguish from the original PCR primer sequence.

Basic Protocol 2: Multiplex‐Microsphere‐Quantitative PCR

  Materials
  • 2× ABI Taqman Universal PCR Master Mix (Applied Biosystems)
  • PCR primers and probes for Influenza A matrix protein, N. meningitides ctrA gene N. meningitides porA genes (Integrated DNA Technologies; see Table 13.13.1)
  • PCR primers and reporter oligonucleotides for Influenza A matrix protein, N. meningitidis ctrA and N. meningitidis porA genes (Integrated DNA Technologies; see Table 13.13.1)
  • 50 mM MgCl 2 (Sigma)
  • 0.25 mM dNTP (Promega Australia)
  • Milli‐Q purified water (Merck Millipore)
  • 200‐μl PCR tubes
  • Benchtop vortex mixer
  • Benchtop microcentrifuge
  • Thermal Cycler, Rotor Gene‐6000 (Qiagen)
  • Thermal Cycler, Mastercycler “nexus” (Eppendorf AG)
  • 100‐microwell plates
  • Luminex 200 flow cytometer (Luminex)
  • 0.2‐ml microcentrifuge tubes (Eppendorf AG), sterile
  • Additional reagents and equipment for preparing plasmid DNA (see Holmes and Quigley, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Anonymous. 2013. MagPlex‐TAG Microspheres. http://www.luminexcorp.com/Products/ReagentsMicrospheres/MicroPlex_Microspheres/ (accessed 30 August, 2013).
  Bustin, S.A., Benes, V., Garson, J.A., Hellemens, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffll, M.W., Shipley, G.L., Vandesompele, J., and Wittwer, C.T. 2009. The MIQE guidelines: Minimum information for publication of quantitative real‐time PCR experiments. Clin. Chem. 55:611‐622.
  Dorak, M.T. 2006. Real‐time PCR. Taylor & Francis, New York.
  Holmes, D.S. and Quigley, M. 1981. A rapid boiling method for the preparation of bacterial plasmids. Anal. Biochem. 114:193‐197.
  Liang, F., Lai, R., Arora, N., Zhang, K.L., Yeh, C.‐C., Barnett, G.R., Voigt, P., Corrie, S.R., and Barnard, R.T. 2013. Multiplex–microsphere–quantitative polymerase chain reaction: Nucleic acid amplification and detection on microspheres. Anal. Biochem. 432:23‐30.
  Moller, S.G. and McPherson, M.J. 2006. PCR. Taylor & Francis, New York.
  Reynisson, E., Josefsen, M.H., Krause, M., and Hoorfar, J. 2006. Evaluation of probe chemistries and platforms to improve the detection limit of real‐time PCR. J. Microbiol. Methods 66:206‐216.
  Syvanen, A.C. 2001. Accessing genetic variation: Genotyping single nucleotide polymorphisms. Nat. Rev. Genetics 2:930‐942.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library