Introduction of Large Insert DNA into Mammalian Cells and Embryos

Roger H. Reeves1, Deborah E. Cabin1, Bruce Lamb1

1 Johns Hopkins University School of Medicine, Baltimore, Maryland
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 5.12
DOI:  10.1002/0471142905.hg0512s30
Online Posting Date:  November, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit provides a set of protocols for introducing large insert DNA into cultured mammalian cells and embryos. Two different methods, spheroplast fusion and lipofection, are described for effecting transfer of YACs or gel‐purified YAC DNA into cells. Additional protocols discuss preparing and transferring BACs into cells by lipofection and into embryos by microinjection.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Introduction of Intact YACs into Mammalian Cells by Spheroplast Fusion
  • Alternate Protocol 1: Introduction of Gel‐Purified YAC DNA into Mammalian Cells by Lipofection
  • Support Protocol 1: Introduction of a Mammalian Selectable Marker into YACs by Homologous Recombination
  • Support Protocol 2: Rapid Estimation of DNA Concentration on Ethidium Bromide/Agarose Plates
  • Basic Protocol 2: Introduction of Bacterial Artificial Chromosomes (BAC or PAC) into Mammalian Cells and Mouse Embryos
  • Support Protocol 3: Optional Linearization and Gel Purification of BAC
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Introduction of Intact YACs into Mammalian Cells by Spheroplast Fusion

  Materials
  • Target cells: adherent mammalian cells in tissue culture (e.g., mouse ES cells)
  • SD dropout medium and plates: SD −Ura −Trp −His (unit 5.7; omit agar for liquid medium)
  • Yeast strain carrying YAC tagged with neo (G418‐resistance) selectable marker (see protocol 3)
  • 1 M sorbitol (store at room temperature)
  • recipeSCE solution (see recipe)
  • 20 mg/ml Zymolyase 20T (ICN Biomedicals) in recipeSCE solution
  • 10% (w/v) SDS (see appendix 2D for 20%)
  • ST solution: 1 M sorbitol/ 10 mM Tris⋅Cl, pH 7.5 ( appendix 2D)
  • PBS ( appendix 2D)
  • 0.05% trypsin/0.53 mM EDTA (Life Technologies)
  • Complete culture medium with serum appropriate to mammalian cells ( appendix 3G) with and without 200 to 800 µg/ml G418 (Life Technologies), room temperature
  • Culture medium appropriate to mammalian cells without additives or serum, room temperature
  • 50% (w/v) polyethylene glycol (PEG) 1500 (fusion‐tested; Boehringer Mannheim)
  • Appropriate PCR primers (Table 5.12.1)
    Table 5.2.1   MaterialsPCR Primers Used to Assess Integrity of YACs Before and After Transfer into Mammalian CellsProbes Used to Assess Integrity of YACs Before and After Transfer into Mammalian Cells

    Primers a Sequence Product size (bp)
    NEO1 5′‐GATTGCACGCAGGTTCTCCG‐3′ 654
    NEO2 5′‐CCAACGCTATGTCCTGATAG‐3′
    URA3A 5′‐AATGCACACGGTGTGGTG‐3′ 277
    URA3B 5′‐CGTCTCCCTTGTCATCTAAACC‐3′
    XIST1 5′‐GGGACCTAACTGTTGGCTTTATCAG‐3′ 203
    XIST2 5′‐GAAGTGAATTGAAGTTTTGGTCTAG‐3′
    Probe targets Plasmid Restriction endonucleases Size (kb) Reference
    TRP1 pYAC4 PstI/XbaI 0.6 Burke et al.,
    URA3 YEP24 HindIII 1.2 Botstein et al.,
    Acentric YAC arm pBR322 PvuII/SalI 1.4 Burke et al.,
    Centric YAC arm pBR322 PvuII/EcoRI 2.3 Burke et al.,
    neo pDC47 XbaI/EcoRI 0.8 D.E.C., unpub. observ.
    Alu element pDC47 BamHI 0.33 D.E.C., unpub. observ.
    LINE element pBP90 ClaI/NcoI 0.4 Pavan et al.,
    B1 element pB1con PstI/SstI 0.3 J. McKee‐Johnson, unpub. observ.
    Ty1 pJEF1271 XhoI 6 Eichinger and Boeke,

     aPCR reaction conditions—30 cycles: 95°C, 1 min; 60°C, 1 min; 72°C; 2 min.
  • Appropriate radiolabeled probes (Table 5.12.2; see appendix 3E for radiolabeling)
    Table 5.2.2   MaterialsPCR Primers Used to Assess Integrity of YACs Before and After Transfer into Mammalian CellsProbes Used to Assess Integrity of YACs Before and After Transfer into Mammalian Cells

    Primers a Sequence Product size (bp)
    NEO1 5′‐GATTGCACGCAGGTTCTCCG‐3′ 654
    NEO2 5′‐CCAACGCTATGTCCTGATAG‐3′
    URA3A 5′‐AATGCACACGGTGTGGTG‐3′ 277
    URA3B 5′‐CGTCTCCCTTGTCATCTAAACC‐3′
    XIST1 5′‐GGGACCTAACTGTTGGCTTTATCAG‐3′ 203
    XIST2 5′‐GAAGTGAATTGAAGTTTTGGTCTAG‐3′
    Probe targets Plasmid Restriction endonucleases Size (kb) Reference
    TRP1 pYAC4 PstI/XbaI 0.6 Burke et al.,
    URA3 YEP24 HindIII 1.2 Botstein et al.,
    Acentric YAC arm pBR322 PvuII/SalI 1.4 Burke et al.,
    Centric YAC arm pBR322 PvuII/EcoRI 2.3 Burke et al.,
    neo pDC47 XbaI/EcoRI 0.8 D.E.C., unpub. observ.
    Alu element pDC47 BamHI 0.33 D.E.C., unpub. observ.
    LINE element pBP90 ClaI/NcoI 0.4 Pavan et al.,
    B1 element pB1con PstI/SstI 0.3 J. McKee‐Johnson, unpub. observ.
    Ty1 pJEF1271 XhoI 6 Eichinger and Boeke,

  • Mouse Cot‐1 DNA (Life Technologies)
  • 20× SSC ( appendix 2D)
  • 100‐mm‐diameter and 24‐well tissue culture plates
  • 15‐ml glass culture tubes with caps
  • 30°C incubator with roller drum and shaker
  • 500‐ml Erlenmeyer culture flask with cap
  • Beckman TJ‐6 centrifuge with TH‐4 rotor and buckets (or equivalent)
  • Phase‐contrast microscope
  • Cloning cylinders (unit 3.2)
  • 65°C water bath
  • Additional reagents and equipment for mammalian cell culture and counting cells with a hemacytometer ( appendix 3G), isolating DNA from mammalian cells ( appendix 3B & CPMB UNIT ), PCR (e.g., CPMB ), agarose gel electrophoresis and Southern blotting (unit 2.7), preparation of metaphase spreads from cultured cells (optional; unit 8.4), chromosome banding (optional; unit 4.2), and karyotype analysis (optional; appendix 4A).
NOTE: All tissue culture incubations should be performed in a humidified 37°C, 5% CO 2 incubator unless otherwise specified.

Alternate Protocol 1: Introduction of Gel‐Purified YAC DNA into Mammalian Cells by Lipofection

  • PFGE gel slice (unit 5.7) containing intact YAC DNA with neo selectable marker (see protocol 3)
  • recipeDialysis buffer (see recipe)
  • 1 U/µl β‐agarase (New England BioLabs)
  • Lipofectin (Life Technologies) or other cationic lipid for DNA transfection (e.g., Transfectam, Promega)
  • Control DNA for optimizing lipofection (any neor plasmid expressed by the target cell, e.g., pDC47)
  • 40° and 65°C water baths
  • 35‐mm diameter tissue culture plates
  • 5‐ml polystrene tubes
  • Additional reagents and equipment for pulsed‐field gel electrophoresis (unit 5.7), agarose gel electrophoresis and Southern blot hybridization (unit 2.7), mammalian cell culture and trypsinization of cells ( appendix 3G), selection, cloning, expansion and analysis of transfectants (see protocol 1), and estimation of DNA concentration (see protocol 4)
NOTE: All tissue culture incubations should be performed in a humidified 37°C, 5% CO 2 incubator unless otherwise specified.

Support Protocol 1: Introduction of a Mammalian Selectable Marker into YACs by Homologous Recombination

  Materials
  • pDC47 (ATCC #87028) or other integrating plasmid with HIS3 selectable marker (see )
  • Appropriate restriction endonucleases and buffers for linearizing integrating plasmid (see and Fig. )
  • TE buffer, pH 7.5 ( appendix 2D)
  • Transformation‐competent YAC‐bearing yeast strain mutant in HIS3 gene (unit 5.7)
  • YPD medium (unit 5.5)
  • SD dropout plates and medium: SD −Ura −Trp and SD −Ura −Trp −His (unit 5.7; omit agar for liquid medium)
  • Radiolabeled probes for neo, URA3, TRP1, and repetitive elements (Table 5.12.2; see appendix 3E for radiolabeling)
  • ClaI, EcoRI, and other restriction endonucleases appropriate for analysis of transformation products (see Fig. )
  • 30°C incubator and shaker
  • Additional reagents and equipment for ethanol precipitation of DNA ( appendix 3C), characterization of YACs by recombination with fragmentation vectors (unit 5.7), preparation of agarose‐embedded high‐molecular‐weight yeast genomic DNA and PFGE (unit 5.1), agarose gel electrophoresis and Southern blotting and hybridization (unit 2.7), and repetitive‐element profile preparation (see protocol 1)

Support Protocol 2: Rapid Estimation of DNA Concentration on Ethidium Bromide/Agarose Plates

  Materials
  • 0.8% (w/v) agarose in H 2O
  • 10 mg/ml ethidium bromide ( appendix 2D) in H 2O
  • 1 µg/µl DNA stock solution (store frozen; can be thawed repeatedly if not contaminated)
  • Unknown DNA sample
  • 60‐mm diameter petri plates

Basic Protocol 2: Introduction of Bacterial Artificial Chromosomes (BAC or PAC) into Mammalian Cells and Mouse Embryos

  Materials
  • Selective plate
  • LB medium ( appendix 2D) with appropriate antibiotic
  • Selective medium
  • RNase A (Sigma)
  • Qiagen Midi‐prep kit (Qiagen) includes the following:
    • recipeP1 buffer (or see recipe)
    • recipeP2 buffer (or see recipe; before use, be sure SDS is throughouly resuspended. If it has precipitated, warm buffer to 37°C)
    • recipeP3 buffer (or see recipe), prechilled
    • Midi‐tip 100 columns
    • recipeQBT buffer (or see recipe)
    • recipeQC buffer (or see recipe)
    • recipeQF buffer (or see recipe), prewarmed to 65°C
  • Isopropanol
  • recipePronuclear injection buffer (PIB; see recipe)
  • Purified BAC DNA or PFGE gel slice containing linearized BAC DNA (unit 5.7, protocol 2, steps to , see below)
  • recipeDialysis buffer (see recipe)
  • 70% ethanol
  • Mammalian cells
  • Blasticidin (ICN Biomedical) dissolved in complete medium at 1 to 4 µg/µl to make a 1000× solution
  • 37°C incubator for bacterial culture
  • High‐speed centrifuge (e.g., Sorvall RC‐series with GSA rotor or equivalent)
  • 50‐ml high‐speed centrifuge tubes
  • 15‐ml Corex glass centrifuge tubes
  • Additional reagents and equipment needed for agarose gel electrophoresis, synthesis of radiolabeled probes and Southern blotting, and preparation of DNA from mammalian cells (unit 2.7), and for lipofection (see protocol 2)
CAUTION: Radiolabeled probes and ethidium bromide are hazardous; see appendix 2A for guidelines on handling, storage and disposal.

Support Protocol 3: Optional Linearization and Gel Purification of BAC

  Materials
  • BAC DNA (from protocol 5, step )
  • NotI or AscI restriction enzymes and appropriate buffers
  • Ethidium bromide
  • Gel loading buffer
  • recipeDialysis buffer (see recipe)
  • β‐agarase
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol
  • 24:1 (v/v) chloroform/isoamyl alcohol
  • 3 M sodium acetate ( appendix 2D)
  • 100% ethanol
  • PIB (see recipe)
  • 50‐ml conical tubes
  • 1.5‐ml microcentrifuge tubes
  • Additional reagents and equipment for pulsed‐field gel electrophoresis (unit 5.1), phenol‐chloroform extraction ( appendix 3D), and Southern blot analysis (unit 2.7)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Allshire, R.C., Cranston, G., Gosden, J.R., Maule, J.C., Hastie, N.D., and Fantes, P.A. 1987. A fission yeast chromosome can replicate autonomously in mouse cells. Cell 50:391‐403.
   Antoch, M.P., Song, E.J., Chang, A.M., Vitaterna, M.H., Zhao, Y., Wilsbacher, L.D., Sangoram, A.M., King, D.P., Pinto, L.H., and Takahashi, J.S. 1997. Functional identification of the mouse circadian Clock gene by transgenic BAC rescue. Cell 89:655‐667.
   Botstein, D., Falco, S.C., Stewart, S.E., Brennan, M., Schere, S., Stinchcomb, D.T., Struhl, K., and Davis, R.W. 1979. Sterile host yeasts (SHY): A eukaryotic system of biological containment for recombinant DNA experiments. Gene 8:17‐24.
   Burke, D., Carle, G., and Olson, M.V. 1987. Cloning of large segments of DNA into yeast by means of artificial chromosome vectors. Science 236:806‐812.
   Cabin, D.E., Hawkins, A., Griffin, C., and Reeves, R.H. 1995. YAC transgenic mice in the study of the genetic basis of Down syndrome. Progr. Clin. Biol. Res. 393:213‐226.
   Choi, T.K., Hollenbach, P.W., Pearson, B.E., Ueda, R.M., Weddell, G.N., Kurahara, C.G., Woodhouse, C.S., Kay, R.M., and Loring, J.F. 1993. Transgenic mice containing a human heavy chain immunoglobulin gene fragment cloned in a yeast artificial chromosome. Nature Genet. 4:117‐123.
   D'Urso, M., Zucchi, I., Ciccodicola, A., Palmieri, G., Abidi, F.E., and Schlessinger, D. 1990. Human glucose‐6‐phosphate dehydrogenase gene carried on a yeast artificial chromosome encodes active enzyme in monkey cells. Genomics 7:531‐534.
   Eichinger, D.J. and Boeke, J.D. 1988. The DNA intermediate in yeast Ty1 element transposition copurifies with virus‐like particles: Cell‐free Ty1 transposition. Cell 54:955‐966.
   Frengen, E., Zhao, B., Howe, S., Weichenhan, D., Osoegawa, K., Gjernes, E., Jessee, J., Prydz, H., Huxley, C., and de Jong, P.J. 2000. Modular bacterial artificial chromosome vectors for transfer of large inserts into mammalian cells. Genomics 68:118‐126.
   Gnirke, A., Barnes, T.S., Patterson, D., Schild, D., Featherstone, T., and Olson, M.V. 1991. Cloning and in vivo expression of the human GART gene using yeast artificial chromosomes. E.M.B.O. J. 10:1629‐1634.
   Green, L.L., Hardy, M.C., Maynard‐Curie, C.E., Tsuda, H., Louie, D.M., Mendex, M.J., Abderrahim, H., Noguchi, M., Smith, D.H., Zeng, Y., David, N.E., Sasai, H., Garza, D., Brenner, D.G., Hales, J.F., McGuinness, R.P., Capon, D.J., Klapholz, S., and Jakobovits, A. 1994. Antigen‐specific human monoclonal antibodies from mice engineered with human Ig heavy and light chain YACs. Nature Genet. 7:13‐21.
   Huxley, C., Hagino, Y., Schlessinger, D., and Olson, M.V. 1991. The human HPRT gene on a yeast artificial chromosome is functional when transferred to mouse cells by cell fusion. Genomics 9:742‐750.
   Jakobovits, A., Moore, A.L., Green, L., Vergara, G.J., Maynard‐Currie, C.G., Austin, A.H., and Klapholz, S. 1993. Germ‐line transmission and expression of a human‐derived yeast artificial chromosome. Nature 362:255‐258.
   Kelley, J.M., Field, C.E., Craven, M.B., Bocskai, D., Kim, U.J., Rounsley, S.D., and Adams, M.D. 1999. Hight thorughput direct end sequencing of BAC clones. Nucl. Acids Res. 27:1539‐1546.
   Lamb, B.T., Sisodia, S.S., Lawler, A.M., Slunt, H.H., Kitt, C.A., Kearns, W.G., Pearson, P.L., Price, D.L., and Gearhart, J.D. 1993. Introduction and expression of the 400 kilobase amyloid precursor protein gene in transgenic mice. Nature Genet. 5:22‐30.
   Pachnis, V., Pevny, L., Rothstein, R., and Constantini, F. 1990. Transfer of a yeast artificial chromosome carrying human DNA from Saccharomyces cerevisiae into mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 87:5109‐5113.
   Pavan, W.J., Hieter, P., and Reeves, R.H. 1990. Modification and transfer into an embryonal carcinoma cell line of a 360‐kilobase human‐derived yeast artificial chromosome. Mol. Cell. Biol. 10:4163‐4169.
   Schedl, A., Monoliu, L., Kelsey, G., and Schutz, G. 1993. A yeast artificial chromosome covering the tyrosinase gene confers copy number–dependent expression in transgenic mice. Nature 362:258‐261.
   Sikorski, R.S. and Hieter, P. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in S. cerevisiae. Genetics 122:19‐27.
   Soriano, P., Montgomery, C., Geske, R., and Bradley, A. 1991. Targeted disruption of the c‐src protooncogene leads to osteopetrosis in mice. Cell 64:693‐702.
   Strauss, W.M., Dausman, J., Beard, C., Johnson, C., Lawrence, J.B., and Jaenisch, R. 1993. Germ line transmission of a yeast artificial chromosome spanning the murine α1(I) collagen locus. Science. 259:1904‐1907.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library