Building Larger YACs by Recombination

Gary A. Silverman1

1 Children's Hospital and Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 5.13
DOI:  10.1002/0471142905.hg0513s05
Online Posting Date:  May, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Despite the relatively large cloning capacity of YACs, many genomic regions or individual genes are not cloned intact, but are represented as a collection of overlapping clones or contigs. Fortunately, the relatively high frequency and fidelity of homologous recombination in Saccharomyces cerevisiae can be used to reconstruct intact genes within a single clone by splicing together overlapping DNA segments. This unit describes two protocols for carrying out such homologous recombination; one relies on the meiotic phase of the yeast cycle, while the other utilizes the mitotic phase of the yeast life cycle.Despite the relatively large cloning capacity of YACs, many genomic regions or individual genes are not cloned intact.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Construction of YACS by Meiotic Recombination
  • Support Protocol 1: Spheroplast Transformation with a Gel‐Purified YAC to Introduce a YAC into a Strain of the Opposite Mating Type
  • Support Protocol 2: Selection of Diploids Based on Genotype
  • Support Protocol 3: Selection of Diploids Based on Morphology
  • Support Protocol 4: Selection of Diploids by Mating‐Type PCR
  • Alternate Protocol 1: Construction of YACS by Mitotic Recombination
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Construction of YACS by Meiotic Recombination

  Materials
  • YAC‐bearing yeast strains of known mating type
  • Haploid yeast strain of opposite mating type (Table 5.13.1)
    Table 5.3.1   MaterialsGenotypes of Selected Saccharomyces cerevisiae Strains

    Strain Mating type Partial gentoype Reference
    AB1380 a MATa trp1 ura3‐52 ade2‐1 his5 lys2‐1 can1‐100 ψ+ Burke et al. ( )
    AB1610 MATα trp5‐2 ura3‐52 ade2‐1 lys2‐1 can1‐100 met4‐1 leu1‐12 Riles and Olson ( )
    YPH252 MATα trp1‐Δ1 his3‐Δ200 ade2‐101 leu2‐Δ1 lys2‐801 Sikorski and Hieter ( )
    YM2062 MATα ura3‐52 ade2‐101 his3‐Δ200 lys2‐801 Flick and Johnston ( )
    ACY16 MATα trp1‐Δ1 ura3‐52 ade2‐1 lys2‐1 can1‐100 leu2‐Δ1 Cellini et al. ( )
    YS58 MATα trp1‐789 ura3‐52 his4‐519 leu2‐3,112 Den Dunnen et al. ( )
    GFC117 MATα trp1 ura3 ade2‐1 lys2‐1 can1‐100 met4‐1 leu1‐12 Rotomondo and Carle ( )

     aSeveral laboratories have determined that AB1380 is Thr and Ile. These growth requirements can be satisfied by adding threonine and isoleucine to CM medium or by using AHC medium.
  • Acid‐hydrolyzed casein (AHC) medium and plates (unit 5.5)
  • Yeast extract peptone dextrose (YPD) medium and plates (unit 5.5)
  • recipeSporulation medium and plates (see recipe)
  • 0.5 mg zymolyase (ICN Biomedicals)/ml 1 M sorbitol (prepare fresh) or 1% to 25% (v/v) glusulase (NEN Research Products; store ≤6 months at 4°C) in water
  • Sterile distilled water
  • recipeDissection medium (see recipe) in 100‐mm petri plates
  • recipeComplete minimal (CM) dropout medium and plates (see recipe)
  • 30°C dry incubator
  • Inoculating loop, sterile
  • Phase‐contrast microscope (optional)
  • Microscope with micromanipulator (Zeiss) and recipefiberoptic glass microneedles (see recipe)
  • Additional reagents and equipment for transfer of YACs to opposite mating type strain (see protocol 2), genetic selection of diploids (see protocol 3), morphological selection of diploids (see protocol 4), mating‐type PCR (see protocol 5), and pulsed‐field gel electrophoresis (unit 5.1)

Support Protocol 1: Spheroplast Transformation with a Gel‐Purified YAC to Introduce a YAC into a Strain of the Opposite Mating Type

  Materials
  • 10× PCR amplification buffer with 15 mM MgCl 2 ( appendix 2D) and without gelatin
  • 1.25 mM 4dNTP mix ( appendix 2D)
  • 50 µM universal MAT primer: 5′‐AGTCACATCAAGATCGTTTATGG‐3′
  • 50 µM MATα‐specific primer: 5′‐GCACGGAATATGGGACTACTTCG‐3′
  • 50 µM MATa‐specific primer: 5′‐ACTCCACTTCAAGTAAGAGTTTG‐3′
  • 5 U/µl Taq DNA polymerase
  • Mineral oil
  • recipe5× Ficoll loading buffer (see recipe)
  • Chloroform
  • 1.0% agarose gel
  • 0.5‐ml polypropylene microcentrifuge tubes
  • Round toothpicks, sterile
  • Thermal cycler
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7)

Support Protocol 2: Selection of Diploids Based on Genotype

  • Targeting vectors (Table 5.13.2)
  • HindIII, AatII, and XhoI restriction endonucleases and appropriate buffers
  • recipeCM −Trp −Lys +5‐FOA plates (see recipe)
  • recipeCM −Ura −Lys plates (see recipe)
  • STC buffer (unit 5.2)
  • 20% (w/v) polyethylene glycol (PEG) 6000 solution
  • SOS medium (unit 5.2)
  • recipeCM −Lys −Ura −Trp +SORB top agar (see recipe), 48°C
  • recipeCM −Lys −Ura −Trp +SORB plates (see recipe), 30°C
  • 15‐ml polypropylene centrifuge tubes
  • Centrifuge and GH‐3.8 rotor
  • Additional reagents and equipment for lithium acetate transformation of yeast (unit 5.7, protocol 3), preparing high‐molecular‐weight DNA in agarose blocks (unit 5.1), pulsed‐field gel electrophoresis (unit 5.1), Southern blotting and hybridization (unit 2.7 & unit 5.7), characterizing YACs by recombination with fragmentation vectors (unit 5.7, protocol 3), spheroplast transformation (unit 5.2, protocol 1), and introduction of YACs into same cell by mating (see protocol 1)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Brown, P.A. and Szostak, J.W. 1983. Yeast vectors with negative selection. Methods Enzymol. 101:278‐290.
   Burke, D.T., Carle, G.F., and Olson, M.V. 1987. Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science 236:806‐812.
   Cellini, A., Lacatena, R.M., and Tocchini‐Valentini, G.P. 1991. Detection of homologous recombination between yeast artificial chromosomes with overlapping inserts. Nucl. Acids Res. 19:997‐1000.
   Davies, N.P., Rosewell, I.R., and Brüggemann, M. 1992. Targeted alterations in yeast artificial chromosomes for inter‐species gene transfer. Nucl. Acids Res. 20:2693‐2698.
   Den Dunnen, J.T., Grootscholten, P.M., Dauwerse, J.G., Walker, A.P., Monaco, A.P., Butler, R., Anand, R., Coffey, A.J., Bentley, D.R., Steensma, H.Y., and Van Ommen, G.J.B. 1992. Reconstruction of the 2.4 Mb human DMD gene by homologous YAC recombination. Hum. Mol. Genet. 1:19‐28.
   Flick, J.S. and Johnston, M. 1990. Two systems of glucose repression of the GAL1 promoter in Saccharomyces cerevisiae. Mol. Cell. Biol. 10:4757‐4769.
   Green, E.D. and Olson, M.V. 1990. Chromosomal region of the cystic fibrosis gene in yeast artificial chromosomes: A model for human genome mapping. Science 250:94‐98.
   Hermanson, G.G., Hoekstra, M.F., McElligott, D.L., and Evans, G.L. 1991. Rescue of end fragments of yeast artificial chromosomes by homologous recombination in yeast. Nucl. Acids Res. 19:4943‐4948.
   Hugerat, Y., Spencer, F., Zenvirth, D., and Simchen, G. 1994. A versatile method for efficient YAC transfer between any two strains. Genomics 22:108‐117.
   Huxley, C., Green, E.D., and Dunham, I. 1990. Rapid assessment of S. cerevisiae mating type by PCR. Trends Genet. 6:236.
   Marchuk, D.A., Tavakkol, R., Wallace, M.R., Brownstein, B.H., Taillon‐Miller, P., Fong, C.T., Legius, E., Andersen, L.B., Glover, T.W., and Collins, F.S. 1992. A yeast artificial chromosome contig encompassing the type 1 neurofibromatosis gene. Genomics 13:672‐680.
   Markie, D., Ragoussis, J., Senger, G., Rowan, A., Sansom, D., Trowsdale, J., Sheer, D., and Bodmer, W.F. 1993. New vector for transfer of yeast artificial chromosomes to mammalian cells. Somatic Cell Mol. Genet. 19:161‐169.
   Pavan, W.J., Hieter, P., Sears, D., Burkhoff, A., and Reeves, R.H. 1991. High‐efficiency yeast artificial chromosome fragmentation vectors. Gene 106:125‐127.
   Ragoussis, J., Trowsdale, J., and Markie, D. 1992. Mitotic recombination of yeast artificial chromosomes. Nucl. Acids Res. 20:3135‐3138.
   Riles, L. and Olson, M.V. 1988. Nonsense mutations in essential genes of Saccharomyces cerevisiae. Genetics 11:601‐607.
   Riley, J.H., Morten, J.E.N., and Anand, R. 1992. Targeted integration of neomycin into yeast artificial chromosomes (YACs) for transfection into mammalian cells. Nucl. Acids Res. 20:2971‐2976.
   Roeder, G.S. and Stewart, S.E. 1988. Mitotic recombination in yeast. Trends Genet. 4:263‐267.
   Rothstein, R. 1991. Targeting, disruption, replacement, and allele rescue: Integrative DNA transformation in yeast. Methods Enzymol. 194:281‐301.
   Rotomondo, F. and Carle, G.F. 1994. Genetic selection of meiotic and mitotic recombinant yeast artificial chromosomes. Nucl. Acids Res. 22:1208‐1214.
   Russell, D.W., Jensen, R., Zoller, M.J., Burke, J., Errede, B., Smith, M., and Herskowitz, I. 1986. Structure of the Saccharomyces cerevisiae HO gene and analysis of its upstream regulatory region. Mol. Cell. Biol. 6:4281‐4294.
   Sears, D.D., Hegemann, J.H., and Hieter, P. 1992. Meiotic recombination and segregation of human‐derived artificial chromosomes in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U.S.A. 89:5296‐5300.
   Sikorski, R.S. and Hieter, P. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19‐27.
   Silverman, G.A., Reconstruction of large genomic segments of DNA by meiotic recombination between yeast artificial chromosomes. Methods Mol. Biol. Vol. 54. In press.
   Silverman, G.A., Green, E.D., Young, R.L., Jockel, J.I., Domer, P.H., and Korsmeyer, S.J. 1990. Meiotic recombination between yeast artificial chromosomes yields a single clone containing the entire BCL2 protooncogene. Proc. Natl. Acad. Sci. U.S.A. 87:9913‐9917.
   Silverman, G.A., Yang, E., Proffitt, J.H., Zutter, M., and Korsmeyer, S.J. 1993. Genetic transfer and expression of reconstructed yeast artificial chromosomes containing normal and translocated BCL2 proto‐oncogenes. Mol. Cell. Biol. 13:5469‐5478.
   Spencer, F., Hugerat, Y., Simchen, G., Hurko, O., Connelly, C., and Hieter, P. 1994. Yeast kar1 mutants provide an effective method for YAC transfer to new hosts. Genomics 22:118‐126.
   Srivastava, A.K. and Schlessinger, D. 1991. Vectors for inserting selectable markers in vector arms and human DNA inserts of yeast artificial chromosomes (YACs). Gene 103:53‐59.
Key References
   Guthrie, C. and Fink, G.R. 1991. Guide to yeast genetics and molecular biology. Methods Enzymol. 194:1‐933.
  Superb cookbook for methods in yeast genetics. A good laboratory reference.
   Reeves, R.H., Pavan, W.J., and Hieter, P. 1990. Modification and manipulation of mammalian DNA cloned as YACs. Genet. Anal. Tech. Appl. 7:107‐113.
  Describes the use of homologous recombination to analyze and modify YACs.
   Rose, M.D., Winston, F., and Hieter, P. 1990. Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  Concise descriptions of classical methods in yeast genetics. Excellent for beginners.
   Rothstein, R. 1991. See above.
  Excellent discussion of theory and application of homologous recombination in yeast.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library