Isolation of Exons from Cloned DNA by Exon Trapping

Paul E. Nisson1, Paul C. Watkins2, David B. Krizman3

1 Life Technologies, Gaithersburg, Maryland, 2 Sequana Therapeutics, La Jolla, California, 3 National Center for Human Genome Research, Bethesda, Maryland
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 6.1
DOI:  10.1002/0471142905.hg0601s03
Online Posting Date:  May, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Exon trapping is an RNA polymerase chain reaction (PCR) method to clone expressed sequences or exons directly from mammalian genomic DNA. The basic protocol in this unit describes the method for trapping internal exons from cosmid clones and the second basic protocol describes trapping of 3 terminal exons. An describes 3 terminal exon trapping, which avoids subcloning of target DNA by ligating it to the vector for direct transfection. A describes a rapid cloning procedure using uracil DNA glycosylase.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Internal Exon Trapping from Cosmid Clones
  • Basic Protocol 2: 3′ Terminal Exon Trapping to Identify Genes in Cloned DNA
  • Alternate Protocol 1: 3′ Terminal Exon Trapping Using Direct Ligation/Transfection
  • Support Protocol 1: Cloning PCR Products with Uracil DNA Glycosylase
  • Reagents and Solutions
  • Commentary
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Internal Exon Trapping from Cosmid Clones

  MaterialsFor recipes, see in this unit (or cross‐referenced unit); for common stock solutions, see appendix 2D 2; for suppliers, see suppliers appendix.
  • Cosmid clones
  • 1 µg pSPL3 vector (Fig. ; GIBCO/BRL)
  • Restriction endonucleases: BstXI and one or more of the following for subcloning cosmids into pSPL3: BamHI, BglII, SstI, NotI, XhoI, XmaIII, PstI, and 10× buffers
  • 7.5 M ammonium acetate
  • 100% and 70% ethanol
  • TE buffer, pH 8.0
  • Calf intestine alkaline phosphatase (CIP)
  • 1 U/µl T4 DNA ligase (in Weiss units)
  • 5× T4 DNA ligase buffer ( appendix 2D; make 5× and substitute 25% PEG 8000 for BSA)
  • Transformation‐competent E. coli cells (CPMB UNIT )
  • LB medium and plates containing 100 µg/ml ampicillin (LB/ampicillin; appendix 2D)
  • COS‐7 cells (ATCC #CRL‐1651)
  • Complete DMEM/10%, 20%, and 0% FBS (37°C, appendix 3G)
  • Cationic lipid (e.g., LipofectACE; GIBCO/BRL)
  • Diethylpyrocarbonate (DEPC)‐treated H 2O (unit 7.1)
  • 20 µM oligonucleotide SA2: 5′‐ATCTCAGTGGTATTTGTGAGC‐3′
  • recipe5× first‐strand buffer (see recipe)
  • 0.1 M dithiothreitol (DTT)
  • 10 mM 4dNTP mix ( appendix 2D) in DEPC‐treated H 2O
  • 200 U/µl reverse transcriptase
  • 2 U/µl RNase H
  • 5 U/µl Taq DNA polymerase
  • 10× Taq DNA polymerase buffer: 500 mM KCl/ 100 mM Tris⋅Cl, pH 8.3 (store ≤18 months at −20°C)
  • 50 mM MgCl 2
  • 10 mM 4dNTP mix in sterile H 2O ( appendix 2D)
  • 20 µM oligonucleotide SD6: 5′‐TCTGAGTCACCTGGACAACC‐3′
  • Mineral oil
  • 20 µM oligonucleotide dUSA4: 5′‐CUACUACUACUACACCTGAGGAGTGAATTGGTCG‐3′
  • 20 µM oligonucleotide dUSD2: 5′‐CUACUACUACUAGTGAACTGCACTGTGACAAGCTGC‐3′
  • 2% agarose gel
  • 6‐well tissue culture plates with 3.5‐cm wells
  • 1.5‐ml polystyrene microcentrifuge tube, sterile
  • 0.5‐ml polypropylene microcentrifuge tubes
  • Thermal cycler
  • 42° and 55°C water baths
  • Additional reagents and equipment for phenol extraction and ethanol precipitation of DNA ( appendix 3C), E. coli transformation (CPMB UNIT ), alkaline lysis miniprep of plasmid DNA (unit 5.3 & CPMB UNIT ), mammalian cell culture ( appendix 3G), liposome‐mediated transfection CPMB UNIT ) or transfection by electroporation (CPMB UNIT ), total RNA isolation by the rapid guanidinium method (unit 10.4 & CPMB UNIT ), RNA quantitation ( appendix 3D), and agarose gel electrophoresis (unit 2.7)
NOTE: An Exon Trapping System kit which contains plasmids and many of the reagents and solutions necessary for this protocol is available from GIBCO/BRL.NOTE: All tissue culture incubations are performed in a humidified 37°C, 5% CO 2 incubator unless otherwise specified.

Basic Protocol 2: 3′ Terminal Exon Trapping to Identify Genes in Cloned DNA

  MaterialsFor recipes, see in this unit (or cross‐referenced unit); for common stock solutions, see appendix 2D; for suppliers, see suppliers appendix.
  • pTAG4 vector (Fig. ; GIBCO/BRL), purified by CsCl gradient (unit 5.3 & CPMB UNIT )
  • Restriction endonuclease that cuts within pTAG4 multiple cloning site (MCS): EcoRI, BamHI, BglII, BssHII, NheI, EagI, NotI, PstI, NarI, MluI, or SplI, and appropriate 10× buffer
  • Calf intestine alkaline phosphatase (CIP)
  • TE buffer, pH 8.0
  • Genomic target DNA: plasmid, cosmid, phage, P1, or YAC clones
  • β‐agarase
  • 4 M NaCl
  • 0.8% agarose gel
  • 5× T4 DNA ligase buffer (in Weiss units)
  • 1 U/ml T4 DNA ligase
  • Transformation‐competent E. coli cells (CPMB UNIT )
  • LB medium and plates containing 100 µg/ml ampicillin (LB/ampicillin; appendix 2D)
  • COS‐7 cells (ATCC #CRL‐1651)
  • Complete DMEM/20%, 10%, and 0% FBS ( appendix 2D)
  • Cationic lipid (e.g., LipofectACE, GIBCO/BRL)
  • Diethylpyrocarbonate (DEPC)‐treated H 2O (unit 7.1)
  • recipe10× DNase I buffer (see recipe)
  • 1 U/µl DNase I
  • 5 ng/µl oligonucleotide AP (adapter primer): 5′‐AAGGATCCGTCGACATCGATAATACGAC(T) 17‐3′
  • 20 mM EDTA, pH 8.0
  • H 2O, sterile
  • Mineral oil
  • recipe5× first‐strand buffer (see recipe)
  • 0.1 M dithiothreitol (DTT)
  • 25 mM 4dNTP mix in DEPC‐treated H 2O ( appendix 2D)
  • 200 U/µl Superscript II reverse transcriptase (GIBCO/BRL)
  • 2.6 U/µl RNase H
  • 10× Taq DNA polymerase buffer: 500 mM KCl/ 100 mM Tris⋅Cl, pH 8.3 (store <18 months at −20°C)
  • 25 mM MgCl 2
  • 50 µM oligonucleotide SV40P: 5′‐AGCTATTCCAGAAGTAGTGA‐3′
  • 50 µM oligonucleotide UAP: 5′‐CUACUACUACUAGTCGACATCGATAATACGAC‐3′
  • 5 U/µl Taq DNA polymerase
  • 50 µM oligonucleotide Ad2: 5′‐CAUCAUCAUCAUCAGTACTCTTGGATCGGA‐3′
  • 6‐well tissue culture plates with 3.5‐cm wells
  • 1.5‐ml polystyrene microcentrifuge tubes, sterile
  • 42°, 55°, and 70°C water baths
  • 0.5‐ml polypropylene microcentrifuge tubes
  • Thermal cycler
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7), purification of DNA using glass beads (CPMB UNIT ), alkaline lysis preparation of plasmid, cosmid, or P1 DNA (unit 5.3 & CPMB UNIT ) preparation of phage DNA( CPMB UNIT ), column purification of DNA (CPMB UNIT ), phenol extraction and ethanol precipitation of DNA ( appendix 3C), purification of YAC DNA by PFGE (unit 5.7), total RNA isolation by the rapid guanidinium method (unit 10.4 & CPMB UNIT ), and RNA quantitation ( appendix 3D)
NOTE: A kit containing pTAG4 and all the reagents and materials necessary to perform 3′ terminal exon trapping can be obtained from GIBCO/BRL.NOTE: Tissue culture incubations of COS‐7 cells should be carried out in a humidified, 5% CO 2, 37°C incubator.

Alternate Protocol 1: 3′ Terminal Exon Trapping Using Direct Ligation/Transfection

For recipes, see in this unit (or cross‐referenced unit); for common stock solutions, see appendix 2; for suppliers, see suppliers appendix.
  • NruI restriction endonuclease
  • 16°C water bath

Support Protocol 1: Cloning PCR Products with Uracil DNA Glycosylase

    For recipes, see in this unit (or cross‐referenced unit); for common stock solutions, see appendix 2; for suppliers, see suppliers appendix.
  • 25 ng/µl pAMP10 plasmid supplied as a linear molecule (GIBCO/BRL; Fig. )
  • 1 U/µl uracil DNA glycosylase (UDG)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403‐410.
   Andreadis, A., Nisson, P.E., Kosik, K.S., and Watkins, P.C. 1993. The exon trapping assay partly discriminates against alternatively spliced exons. Nucl. Acids. Res. 21:2217‐2221.
   Auch, D. and Reth, M. 1990. Exon trap cloning: Using PCR to rapidly detect and clone exons from genomic DNA fragments. Nucl. Acids Res. 18:6743‐6744.
   Buckler, A.J., Chang, D.D., Graw, S.L., Brook, J.D., Haber, D.A., Sharp, P.A., and Housman, D.E. 1991. Exon amplification: A strategy to isolate mammalian genes based on RNA splicing. Proc. Natl. Acad. Sci. U.S.A. 88:4005‐4009.
   Chomczynski, P. Sacchi, N. 1987. Single‐step method of RNA isolation by acid guanidinium thiocyanate‐phenol‐chloroform extraction. Anal. Biochem. 162:156‐159.
   Church, D.M., Stotler, C.J., Rutter, J.L., Murrell, J.R., Trofatter, J.A., and Buckler, A.J. 1994. Isolation of genes from complex sources of mammalian DNA using exon amplification. Nature Genet. 6:98‐105.
   Duyk, G.M., Kim, S., Myers, R.M., and Cox, D.R. 1990. Exon trapping: A genetic screen to identify candidate transcribed sequences in cloned mammalian genomic DNA. Proc. Natl. Acad. Sci. U.S.A. 87:8995‐8999.
   Frohman, M.A., Dush, M.A., and Martin, G.R. 1988. Rapid production of full‐length cDNAs from rare transcripts: Amplification using a single gene‐specific oligonucleotide primer. Proc. Natl. Acad. Sci. U.S.A. 85:8998‐9002.
   Gluzman, Y. 1981. SV40 transformed simian cells support the replication of early SV40 mutants. Cell 23:175‐182.
   Green, M. 1991. Biochemical mechanisms of constitutive and regulated pre‐mRNA splicing. Ann. Rev. Cell Biol. 7:559‐599.
   Hamaguchi, M., Sakamoto, H., Tsuruta, H., Sasaki, H., Muto, T., Sugimura, T., and Terada, M. 1992. Establishment of a highly sensitive and specific exon‐trapping system. Proc. Natl. Acad. Sci. U.S.A. 89:9779‐9783.
   Hawley‐Nelson, P., Ciccarone, V., Gebeyehu, G., Jessee, J., and Felgner, P.L. 1993. LIPOFECT AMINE reagent: A new, higher efficiency polycationic liposome transfection reagent. Focus 15:73‐79.
  The Huntington's Disease Research Collaborative. 1993. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's Disease chromosomes. Cell 72:971‐983.
   Krizman, D.B. and Berget, S.M. 1993. Efficient selection of 3′‐terminal exons from vertebrate DNA. Nucl. Acids Res. 21:5198‐5202.
   Nisson, P.E., Rashtchian, A., and Watkins, P.C. 1991. Rapid and efficient cloning of Alu‐PCR products using uracil DNA glycosylase. PCR Methods Appl. 1:120‐123.
   Nisson, P.E., Hadley, R.G., and Watkins, P.C. 1993. Finding and cloning genes directly from complex DNA by exon trapping. Focus 15:26‐31.
   Niwa, M. and Berget, S.M. 1991. Mutation of the AAUAAA polyadenylation signal depresses in vitro splicing of proximal but not distal introns. Genes & Dev. 5:2086‐2095.
   Niwa, M. and Berget, S.M. 1992. Are vertebrate exons scanned during splice‐site selection? Nature 360:277‐280.
   Robberson, B.L., Cote, G.J., and Berget, S.M. 1990. Exon definition may facilitate splice site selection in RNAs with multiple exons. Mol. Cell. Biol. 10:84‐94.
   Uberbacher, E.C. and Mural, R.J. 1991. Locating protein‐coding regions in human DNA sequences by a multiple sensor‐neural network approach. Proc. Natl. Acad. Sci. U.S.A. 88:11261‐11265.
Key Reference
   Church et al., 1994. See above.
  Describes use of the internal exon trapping method for cosmids.
   Green, M. 1991. Biochemical mechanisms of constitutive and regulated pre‐mRNA splicing. Ann. Rev. Cell Biol. 7:559‐599.
  Very good review of the splicing literature to help understand the basis behind the ability of pTAG4 to trap a 3′ terminal exon and pSpL3 to trap an internal exon.
   Krizman and Berget, 1993. See above.
  Original report of identifying genes from fragments of genomic DNA by 3′ terminal exon trapping.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library