MLPA and MAPH: Sensitive Detection of Deletions and Duplications

Johan T. den Dunnen1, Stefan J. White1

1 Human and Clinical Genetics, Leiden University Medical Center, Leiden, The Netherlands
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 7.14
DOI:  10.1002/0471142905.hg0714s51
Online Posting Date:  November, 2006
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The detection of quantitative changes in genomic DNA, i.e., deletions and duplications or so called Copy Number Variants (CNV), is an important element of a complete mutation screening strategy. However, because of practical difficulties, screening for quantitative changes in genomic DNA is often ignored. Hitherto, the techniques available were technically challenging and laborious and thus too costly to be applied on a routine basis. The development of MAPH (Multiplex Amplifiable Probe Hybridization) and more recently MLPA (Multiplex Ligation‚Äźdependent Probe Amplification) have revived interest in the detection of deletions and duplications, primarily due to the simplicity and flexibility of these two approaches. Compared to previous technologies, e.g., Southern blotting, fluorescence in situ hybridization (FISH), quantitative PCR (qPCR), and breakpoint PCR, they have some clear advantages, including high resolution, high throughput, amenability to multiplexing, and simplicity.

Keywords: deletion; duplication; copy number variation (CNV); diagnosis; genetic disease; chromosomal rearrangement

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Multiplex Amplifiable Probe Hybridization (MAPH)
  • Basic Protocol 2: Multiplex Ligation‐Dependent Probe Amplification (MLPA)
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Multiplex Amplifiable Probe Hybridization (MAPH)

  Materials
  • 0.25 to 1.0 µg/µl genomic DNA sample and positive and negative controls for duplication/deletion of interest
  • 1 M NaOH
  • Prehybridization solution (see recipe)
  • 1.0 mg/ml human Cot‐1 DNA
  • Probe mix: 100 to 500 pg/µl of each probe, in H 2O
  • 10 mg/ml herring sperm DNA
  • Blocker mix—20 µM each of the following primers:
    • MAPH‐F: 5′‐GGCCGCGGGAATTCGATT‐3′
    • MAPH‐R: 5′‐GCCGCGAATTCACTAGTG‐3′
  • 1.0 M NaH 2PO 4
  • Wash solution A: 1× SSC ( appendix 2D), prewarmed to 60°C
  • Wash solution B: 0.1× SSC ( appendix 2D)/0.1% (w/v) SDS, prewarmed to 60°C
  • 10× PCR buffer II (Applied Biosystems)
  • 25 mM MgCl 2
  • 10 mM dNTP mix: 10 mM each of dATP, dCTP, dGTP, and dTTP
  • 5 U/µl Taq DNA polymerase
  • PCR primers (one but not both should be fluorescently labeled for the second‐round PCR):
    • MAPH‐F: 5′‐GGCCGCGGGAATTCGATT‐3′
    • MAPH‐R: 5′‐GCCGCGAATTCACTAGTG‐3′
  • Formamide (Applied Biosystems)
  • Size standard for capillary electrophoresis (Applied Biosystems)
  • Nylon membrane (Hybond‐N+; Amersham)
  • 60°C water bath
  • Beaker with boiling water
  • 50‐ml conical polypropylene centrifuge tubes
  • Petri dish
  • 200‐µl PCR tubes, thin walled
  • Thermal cycler
  • 96‐well plates appropriate for capillary sequencer
  • 95°C heating block
  • Capillary sequencer (e.g., ABI3700 from Applied Biosystems)
  • Additional reagents and equipment for capillary electrophoresis (unit 7.12)

Basic Protocol 2: Multiplex Ligation‐Dependent Probe Amplification (MLPA)

  Materials
  • 5 to 100 µg/ml genomic DNA in TE buffer, pH 7.6 (see recipe for buffer)
  • MLPA reagents (MRC‐Holland; http://www.MLPA.com; to prevent problems it is essential to carefully mix the viscous 50% glycerol enzyme stocks with the dilution buffers according to the manufacturer's instructions):
    • SALSA probe mix (black‐cap tube)
    • MLPA buffer (yellow‐cap tube)
    • Ligase‐65 buffer A (transparent‐cap tube)
    • Ligase‐65 buffer B (white‐cap tube)
    • Ligase (brown‐cap tube)
    • 10× SALSA PCR buffer (red‐cap tube)
    • SALSA PCR primers (purple‐cap tube):
      • forward primer (labeled): 5′‐GGGTTCCCTAAGGGTTGGA‐3′
      • reverse primer (unlabeled): 5′‐GTGCCAGCAAGATCCAATCTAGA‐3′
    • SALSA enzyme dilution buffer (blue‐cap tube)
    • SALSA DNA polymerase (orange‐cap tube)
  • Formamide (Applied Biosystems)
  • Size standard for capillary electrophoresis (Applied Biosystems)
  • 200‐µl PCR tubes, thin‐walled
  • Thermal cycler
  • 96‐well plates appropriate for capillary sequencer
  • 95°C heating block
  • Capillary sequencer (the authors have used the ABI3700 and ABI3730 from Applied Biosystems)
  • Additional reagents and equipment for capillary electrophoresis (unit 7.12)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Aitman, T.J., Dong, R., Vyse, T.J., Norsworthy, P.J., Johnson, M.D., Smith, J., Mangion, J., Roberton‐Lowe, C., Marshall, A.J., Petretto, E., Hodges, M.D., Bhangal, G., Patel, S.G., Sheehan‐Rooney, K., Duda, M., Cook, P.R., Evans, J., Domin, J., Flint, J., Boyle, J.J., Pusey, C.D, and Cook, H.T. 2006. Copy number polymorphism in Fcgr3 predisposes to glomerulonephritis in rats and humans. Nature. 439:851‐855.
   Anthony, R.M., Schuitema, A.R., Chan, A.B., Boender, P.J., Klatser, P.R., and Oskam, L. 2003. Effect of secondary structure on single nucleotide polymorphism detection with a porous microarray matrix: Implications for probe selection. BioTechniques. 34:1082‐1089.
   Armour, J.A., Sismani, C., Patsalis, P.C., and Cross, G. 2000. Measurement of locus copy number by hybridisation with amplifiable probes. Nucleic Acids Res. 28:605‐609.
   Barrett, M.T., Scheffer, A., Ben Dor, A., Sampas, N., Lipson, D., Kincaid, R., Tsang, P., Curry, B., Baird, K., Meltzer, P.S., Yakhini, Z., Bruhn, L., and Laderman, S. 2004. Comparative genomic hybridization using oligonucleotide microarrays and total genomic DNA. Proc. Natl. Acad. Sci. U.S.A. 101:17765‐17770.
   Craig, J.E., Barnetson, R.A., Prior, J., Raven, J.L., and Thein, S.L. 1994. Rapid detection of deletions causing delta beta thalassemia and hereditary persistence of fetal hemoglobin by enzymatic amplification. Blood. 83:1673‐1682.
   Fredman, D., White, S.J., Potter, S., Eichler, E.E., Den Dunnen, J.T., and Brookes, A.J. 2004. Complex SNP‐related sequence variation in segmental genome duplications. Nat. Genet. 36:861‐866.
   Gonzalez, E., Kulkarni, H., Bolivar, H., Mangano, A., Sanchez, R., Catano, G., Nibbs, R.J., Freedman, B.I., Quinones, M.P., Bamshad, M.J., Murthy, K.K., Rovin, B.H., Bradley, W., Clark, R.A., Anderson, S.A., O'connell, R.J., Agan, B.K., Ahuja, S.S., Bologna, R., Sen, L., Dolan, M.J., and Ahuja, S.K. 2005. The influence of CCL3L1 gene‐containing segmental duplications on HIV‐1/AIDS susceptibility. Science. 307:1434‐1440.
   Harteveld, C.L., Voskamp, A., Phylipsen, M., Akkermans, N., Den Dunnen, J.T., White, S.J., and Giordano, P.C. 2005. High resolution characterization of 16p13.3 and 11p15.4 rearrangements causing alpha‐ and beta‐thalassemia by three‐color multiplex ligation‐dependent probe amplification. J. Med. Genet. 42:922‐931.
   Hogervorst, F.B.L., Nederlof, P.M., Gille, J.J., McElgunn, C.J., Grippeling, M., Pruntel, R., Regnerus, R., ven Welsem, T., ven Spaendonk, R., Menko, F.H., Kluijt, I., Dommering, C., Verhoef, S., Schouten, J.P., van't Veer, L.J., and Pals, G. 2003. Large genomic deletions and duplications in the BRCA1 gene identified by a novel quantitative method. Cancer Res. 63:1449‐1453.
   Hollox, E.J., Atia, T., Cross, G., Parkin, T., and Armour, J.A. 2002. High throughput screening of human subtelomeric DNA for copy number changes using multiplex amplifiable probe hybridisation (MAPH). J. Med. Genet. 39:790‐795.
   Iafrate, A.J., Feuk, L., Rivera, M.N., Listewnik, M.L., Donahoe, P.K., Qi, Y., Scherer, S.W., and Lee, C. 2004. Detection of large‐scale variation in the human genome. Nat. Genet. 36:949‐951.
   Koenig, M., Hoffman, E.P., Bertelson, C.J., Monaco, A.P., Feener, C.A., and Kunkel, L.M. 1987. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50:509‐517.
   Lalic, T., Vossen, R.H., Coffa, J., Schouten, J.P., Guc‐Scekic, M., Radivojevic, D., Djurisic, M., Breuning, M.H., White, S.J., and den Dunnen, J.T. 2005. Deletion and duplication screening in the DMD gene using MLPA. Eur. J. Hum. Genet. 13:1231‐1234.
   Lucito, R., Healy, J., Alexander, J., Reiner, A., Esposito, D., Chi, M., Rodgers, L, Brady, A., Sebat, J., Troge, J., West, J.A., Rostan, S., Nguyen, K.C., Powers, S., Ye, K.Q., Olshen, A., Venkatraman, E., Norton, L., and Wigler, M. 2003. Representational oligonucleotide microarray analysis: A high‐resolution method to detect genome copy number variation. Genome Res. 13:2291‐2305.
   Monaco, A.P., Bertelson, C.J., Liechti‐Gallati, S., Moser, H., and Kunkel, L.M. 1988. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics. 2:90‐95.
   Ogino, S. and Wilson, R.B. 2004. Spinal muscular atrophy: Molecular genetics and diagnostics. Expert Rev. Mol. Diagn. 4:15‐29.
   Peiffer, D.A., Le, J.M., Steemers, F.J., Chang, W., Jenniges, T., Garcia, F., Haden, K., Li, J., Shaw, C.A., Belmont, J., Cheung, S.W., Shen, R.M., Barker, D.L., and Gunderson, K.L. 2006. High‐resolution genomic profiling of chromosomal aberrations using Infinium whole‐genome genotyping. Genome Res. E‐pub Aug 9.
   Rosenberg, C., Navajas, L., Vagenas, D.F., Bakker, E., Vainzof, M., Passos‐Bueno, M.R., Takata, R.I., Van Ommen, G.J.B., Zatz, M., and den Dunnen, J.T. 1998. Clinical diagnosis of heterozygous dystrophin gene deletions by fluorescence in situ hybridization. Neuromuscul. Disord. 8:447‐452.
   Schouten, J.P., McElgunn, C.J., Waaijer, R., Zwijnenburg, D., Diepvens, F., and Pals, G. 2002. Relative quantification of 40 nucleic acid sequences by multiplex ligation‐dependent probe amplification. Nucleic Acids Res. 30:e57.
   Schwartz, M. and Duno, M. 2004. Improved molecular diagnosis of dystrophin gene mutations using the multiplex ligation‐dependent probe amplification method. Genet.Test. 8:361‐367.
   Slater, H.R., Bailey, D.K., Ren, H., Cao, M., Bell, K., Nasioulas, S., Henke, R., Choo, K.H., and Kennedy, G.C. 2005. High‐resolution identification of chromosomal abnormalities using oligonucleotide arrays containing 116,204 SNPs. Am. J. Hum. Genet. 77:709‐726.
   Slater, H.R., Bruno, D.L., Ren, H., Pertile, M., Schouten, J.P., and Choo, K.H. 2003. Rapid, high throughput prenatal detection of aneuploidy using a novel quantitative method (MLPA). J. Med. Genet. 40:907‐912.
   Tuzun, E., Sharp, A.J., Bailey, J.A., Kaul, R., Morrison, V.A., Pertz, L.M., Haugen, E., Hayden, H., Albertson, D., Pinkel, D., Olson, M.V., and Eichler, E.E. 2005. Fine‐scale structural variation of the human genome. Nat. Genet. 37:727‐732.
   Veltman, J.A., Fridlyand, J., Pejavar, S., Olshen, A.B., Korkola, J.E., DeVries, S., Carroll, P., Kuo, W.L., Pinkel, D., Albertson, D., Cordon‐Cardo, C., Jain, A.N., and Waldman, F.M. 2003. Array‐based comparative genomic hybridization for genome‐wide screening of DNA copy number in bladder tumors. Cancer Res. 63:2872‐2880.
   Vissers, L.E., Veltman, J.A., ven Kessel, A.G., and Brunner, H.G. 2005. Identification of disease genes by whole genome CGH arrays. Hum. Mol. Genet. 14 Spec No. 2:R215‐R223.
   White, S.J., Kalf, M., Liu, Q., Villerius, M., Engelsma, D., Kriek, M., Vollebregt, E., Bakker, E., Van Ommen, G.J.B., Breuning, M.H., and den Dunnen, J.T. 2002. Comprehensive detection of genomic duplications and deletions in the DMD gene, by use of multiplex amplifiable probe hybridization. Am. J. Hum. Genet. 71:365‐374.
   White, S.J., Vink, G.R., Kriek, M., Wuyts, W., Schouten, J.P., Bakker, E., Breuning, M.H., and den Dunnen, J.T. 2004. Two‐colour MLPA: Detecting genomic rearrangements in hereditary multiple exostoses. Hum. Mutat. 24:86‐92.
   White, S.J., Vissers, L.E.L.M., Geurts Van Kessel, A.H.M., Kalay, A., Lehesjoki, A.E., Giordano, P.C., Van De Vosse, E., Breuning, M.H., Brunner, H.G., den Dunnen, J.T., and Veltman, J.A. 2006a. DNA copy number estimations and frequencies of CNVs in five different ethnic populations. Submitted for publication.
   White, S.J., Aartsma‐Rus, A., Flanigan, K.M., Weiss, R.B., Kneppers, A.L.J., Lalic, T., Janson, A.A.M., Ginjaar, H.B., Breuning, M.H., and den Dunnen, J.T. 2006b. Duplications in the DMD gene. Hum. Mutat. 27:938‐945.
   Yau, S.C., Bobrow, M., Mathew, C.G., and Abbs, S.J. 1996. Accurate diagnosis of carriers of deletions and duplications in Duchenne/Becker muscular dystrophy by fluorescent dosage analysis. J. Med. Genet. 33:550‐558.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library