Copy‐Number Variants Detection by Low‐Pass Whole‐Genome Sequencing

Zirui Dong1, Weiwei Xie2, Haixiao Chen2, Jinjin Xu2, Huilin Wang3, Yun Li2, Jun Wang2, Fang Chen2, Kwong Wai Choy4, Hui Jiang2

1 BGI‐Shenzhen, Shenzhen, 2 China National Genebank‐Shenzhen, BGI‐Shenzhen, Shenzhen, 3 Bao'an Maternal and Child Health Hospital, Shenzhen, 4 The Chinese University of Hong Kong‐Baylor College of Medicine Joint Center for Medical Genetics
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 8.17
DOI:  10.1002/cphg.43
Online Posting Date:  July, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Emerging studies have demonstrated that whole‐genome sequencing (WGS) is an efficient tool for copy‐number variants (CNV) detection, particularly in probe‐poor regions, as compared to chromosomal microarray analysis (CMA). However, the cost of testing is beyond economical for routine usage and the lengthy turn‐around time is not ideal for clinical implementation. In addition, the demand for computational resources also reduces the probability of clinical integration into each laboratory. Herein, a protocol providing CNV detection from low‐pass, whole‐genome sequencing (0.25×) in a clinical laboratory setting is described. The cost is reduced to less than $200 USD per sample and the turn‐around time is within an acceptable clinically workable time‐frame (7 days). © 2017 by John Wiley & Sons, Inc.

Keywords: copy‐number variants; low‐pass whole‐genome sequencing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: DNA Fragmentation and Library Construction
  • Basic Protocol 2: PCR Amplification and Measurement
  • Basic Protocol 3: Bioinformatic Pipeline
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: DNA Fragmentation and Library Construction

  Materials
  • DNA sample
  • 1% agarose gel (BioWest Agarose)
  • 10× T4 polynucleotide kinase buffer (Illumina)
  • dNTP mix (Invitrogen)
  • T4 DNA polymerase (Illumina)
  • T4 polynucleotide kinase (Illumina)
  • Klenow fragment (Illumina)
  • AMPure beads (Beckman Coulter)
  • Elution buffer (EB) (Qiagen)
  • 70% ethanol
  • 10× blue buffer (Enzymatics)
  • dATP (Enzymatics)
  • Klenow exonuclease (3′‐5′ exo‐) (Illumina)
  • 2× rapid ligation buffer (Illumina)
  • Index paired‐end (PE) adapter oligo mix (Illumina) (see Table 8.17.1)
  • T4 DNA ligase (Illumina)
  • DL2000 DNA marker (Takara Biotechnology)
  • Lambda HindIII (Takara Biotechnology)
  • SYBR Safe DNA gel stain (Thermo Fisher Scientific)
  • Ultrasonicator (e.g., Covaris S2, Covaris)
  • Electrophoresis system (Thermo Fisher Scientific)
  • Spectrophotometer (e.g., NanoDrop 2000, Thermo Scientific)
  • 100‐μl vials (Covaris, cat. no. 520052)
  • 1.5‐ and 2‐ml microcentrifuge tubes (Axygen, Corning)
  • Vortex‐5 (Haimen Kylin‐Bell Lab Instruments)
  • Magnetic separator (Dexter Magnetic Technologies)
  • 37°C water bath
  • ThermoMixer (Eppendorf)
Table 8.7.1   MaterialsGenomic DNA Oligonucleotide Sequences

Name of sequence Sequence
Barcoded adapters
TruSeq Universal Adapter: 5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
TruSeq Adapter, Index 1 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 2 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 3 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 4 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 5 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 6 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 7 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 8 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 9 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 10 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 11 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 12 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 13 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 14 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 15 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 16 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 18 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 19 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 20 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 21 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGGAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 22 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGTAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 23 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 25 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 27 5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGCCGTCTTCTGCTTG
Primers
PCR primers 5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
5′ CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
Primer1.0 5′‐AATGATACGGCGACCACCGAGATC‐3′
Primer2.0 5′‐CAAGCAGAAGACGGCATACGAGAT‐3′
TaqMan probe 5′‐CCCTACACGACGCTCTTCCGATCT‐3′

Basic Protocol 2: PCR Amplification and Measurement

  Materials
  • 35.2 μl end‐repaired, A‐tailed, adapter‐ligated DNA sample (see protocol 1)
  • Index N (N refers to barcoded adapter randomly selected from Table 8.17.1)
  • 10× Pfx amplification buffer (Invitrogen, cat. no. 11708‐013)
  • 2.5 mM dNTP mix (Invitrogen, cat. no. R72501)
  • 50 mM MgSO 4 (Invitrogen, cat. no. 11708‐013)
  • PCR primers (see Table 8.17.1)
  • Platinum Pfx DNA polymerase (Invitrogen, cat. no. 11708‐013)
  • Agencourt AMPure beads (cat. no. A29152)
  • EB buffer (Qiagen)
  • Agilent DNA 1000 kit (Agilent, cat. no. 5067‐1504) containing:
    • DNA dye concentrate (blue‐capped vial)
    • Gel matrix (red‐capped vial)
    • DNA marker (green‐capped vial)
    • DNA ladder (yellow‐capped vial)
    • Spin filters
    • DNA chips
    • Syringe
  • Milli‐Q water
  • 10 mM Tris·Cl, pH 8.5
  • 0.1% and 100× Tween 20 (Sigma‐Aldrich)
  • 10× HS Taq buffer (Takara Biotechnology)
  • DMSO (Sigma‐Aldrich)
  • Betaine (Sigma‐Aldrich)
  • ROX (Invitrogen)
  • HS Taq (Takara Biotechnology)
  • Probe (10 μM)
  • 1.5‐ml microcentrifuge tubes
  • Thermal cycler (Thermo Fisher Scientific)
  • Microcentrifuge (Eppendorf)
  • Bioanalyzer 2100 (Agilent)
  • Vortex‐5 (Haimen Kylin‐Bell Lab Instruments)
  • Low‐bind tubes
  • Magnetic separator (Dexter Magnetic Technologies)

Basic Protocol 3: Bioinformatic Pipeline

  Materials
  • Linux‐based command system
  • Whole‐genome sequencing data (FASTQ format):
    • Increment_Ratio_of_Coverage.tar.gz
    • R (required module IDPmisc and SwissAir)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  1000 Genomes Project Consortium. (2015). A global reference for human genetic variation. Nature, 526(7571), 68–74. doi: 10.1038/nature15393.
  Baxevanis, A. D. (2012). Searching online Mendelian inheritance in man (OMIM) for information on genetic loci involved in human disease. Current Protocols in Human Genetics, 73, 9.13:9.13.1–9.13.10. doi: 10.1002/0471142905.hg0913s73.
  Cao, Y., Li, Z., Rosenfeld, J. A., Pursley, A. N., Patel, A., Huang, J., … Choy, K. W. (2016). Contribution of genomic copy‐number variations in prenatal oral clefts: A multicenter cohort study. Geneticae Medicae, 18(10), 1052–1055. doi: 10.1038/gim.2015.216.
  Choy, K. W., Setlur, S. R., Lee, C., & Lau, T. K. (2010). The impact of human copy number variation on a new era of genetic testing. BJOG, 117(4), 391–398. doi: 10.1111/j.1471‐0528.2009.02470.x.
  Corpas, M., Bragin, E., Clayton, S., Bevan, P., & Firth, H. V. (2012). Interpretation of genomic copy number variants using DECIPHER. Current Protocols in Human Genetics, 72, 8.14:8.14.1–8.14.17. doi: 10.1002/0471142905.hg0814s72.
  Dong, Z., Zhang, J., Hu, P., Chen, H., Xu, J., Tian, Q., … Xu, Z. (2016). Low‐pass whole‐genome sequencing in clinical cytogenetics: A validated approach. Geneticae Medicae, 18(9), 940–948. doi: 10.1038/gim.2015.199.
  Dong, Z., Jiang, L., Yang, C., Hu, H., Wang, X., Chen, H., … Liang, Z. (2014). A robust approach for blind detection of balanced chromosomal rearrangements with whole‐genome low‐coverage sequencing. Human Mutation, 35(5), 625–636. doi: 10.1002/humu.22541.
  Harrison, S. M., Riggs, E. R., Maglott, D. R., Lee, J. M., Azzariti, D. R., Niehaus, A., … Rehm, H. L. (2016). Using ClinVar as a Resource to Support Variant Interpretation. Current Protocols in Human Genetics, 89, 8.16.1–8.16.23. doi: 10.1002/0471142905.hg0816s89.
  Jonas, R. K., Montojo, C. A., & Bearden, C. E. (2014). The 22q11.2 deletion syndrome as a window into complex neuropsychiatric disorders over the lifespan. Biological Psychiatry, 75(5), 351–360. doi: 10.1016/j.biopsych.2013.07.019.
  Kearney, H. M., Thorland, E. C., Brown, K. K., Quintero‐Rivera, F., & South, S. T., and Working Group of the American College of Medical Genetics Laboratory Quality Assurance, C. (2011). American College of Medical Genetics standards and guidelines for interpretation and reporting of postnatal constitutional copy number variants. Geneticae Medicae, 13(7), 680–685. doi: 10.1097/GIM.0b013e3182217a3a.
  Li, X., Chen, S., Xie, W., Vogel, I., Choy, K. W., Chen, F., … Zhang, X. (2014). PSCC: Sensitive and reliable population‐scale copy number variation detection method based on low coverage sequencing. PLoS One, 9(1), e85096. doi: 10.1371/journal.pone.0085096.
  Liang, D., Peng, Y., Lv, W., Deng, L., Zhang, Y., Li, H., … Wu, L. (2014). Copy number variation sequencing for comprehensive diagnosis of chromosome disease syndromes. The Journal of Molecular Diagnostics, 16(5), 519–526. doi: 10.1016/j.jmoldx.2014.05.002.
  Lui, S., Song, L., Cram, D. S., Xiong, L., Wang, K., Wu, R., … Yang, F. (2015). Traditional karyotyping versus copy number variation sequencing for detection of chromosomal abnormalities associated with spontaneous miscarriage. Ultrasound in Obstetrics & Gynecology, 46, 472–477. doi: 10.1002/uog.14849.
  Miller, D. T., Adam, M. P., Aradhya, S., Biesecker, L. G., Brothman, A. R., Carter, N. P., … Ledbetter, D. H. (2010). Consensus statement: Chromosomal microarray is a first‐tier clinical diagnostic test for individuals with developmental disabilities or congenital anomalies. American Journal of Human Genetics, 86(5), 749–764. doi: 10.1016/j.ajhg.2010.04.006.
  Redin, C., Brand, H., Collins, R. L., Kammin, T., Mitchell, E., Hodge, J. C., … Talkowski, M. E. (2016). The genomic landscape of balanced cytogenetic abnormalities associated with human congenital anomalies. Nature Genetics, 49, 36–45. doi:10.1038/ng.3720.
  Talkowski, M. E., Rosenfeld, J. A., Blumenthal, I., Pillalamarri, V., Chiang, C., Heilbut, A., … Gusella, J. F. (2012). Sequencing chromosomal abnormalities reveals neurodevelopmental loci that confer risk across diagnostic boundaries. Cell, 149(3), 525–537. doi: 10.1016/j.cell.2012.03.028.
  Tang, Y. C. & Amon, A. (2013). Gene copy‐number alterations: A cost‐benefit analysis. Cell, 152(3), 394–405. doi: 10.1016/j.cell.2012.11.043.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library