Molecular Analysis of Oxidative Phosphorylation Diseases for Detection of Mitochondrial DNA Mutations

John M. Shoffner1

1 Scottish‐Rite Children's Medical Center, Atlanta, Georgia
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 9.9
DOI:  10.1002/0471142905.hg0909s13
Online Posting Date:  May, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Oxidative phosphorylation (OXPHOS) diseases are caused by inherited or spontaneously occurring mutations in the mitochondrial DNA (mtDNA) or the nuclear DNA. Mutations in the mtDNA can be classified into two groups, rearrangements and point mutations. This unit describes a method for detecting rearrangements of the mtDNA, which involves Southern blot hybridization. Another protocol detects mtDNA point mutations using restriction analysis of polymerase chain reaction (PCR) products. The Southern blot method requires an mtDNAā€specific probe.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Screening for Mitochondrial DNA Rearrangements by Southern Blot Hybridization
  • Support Protocol 1: Mitochondrial DNA Probe Preparation Using Long‐Range PCR
  • Basic Protocol 2: Screening for Mitochondrial DNA Point Mutations by Restriction Analysis of PCR Products
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Screening for Mitochondrial DNA Rearrangements by Southern Blot Hybridization

  Materials
  • 2.0 to 5.0 µg genomic DNA (unit 10.5) from skeletal muscle
  • 10× restriction buffer (supplied with restriction enzyme)
  • BamHI and EcoRV restriction endonucleases (8 to 12 U/µl; Life Technologies)
  • 5.0 M sodium chloride (NaCl)
  • 100% and 70% ethanol
  • 6× gel loading buffer with Ficoll ( appendix 2D)
  • DNA molecular weight markers: e.g., kilobase ladder and λ HindIII digest (Life Technologies; size ranges 75 to 12,216 bp and 564 to 23,130 bp, respectively)
  • TBE buffer ( appendix 2D)
  • Ethidium bromide solution ( appendix 2D)
  • Prehybridization/hybridization buffer (see recipe)
  • SSC ( appendix 2D; prepare fresh)
  • SSC/0.1% (w/v) SDS ( appendix 2D; prepare fresh), 65°C
  • Salmon sperm DNA (e.g., Stratagene)
  • >1 ×108 cpm/µg [α‐32P]dCTP mtDNA probe (see protocol 2)
  • 1× SSC/ 0.1% (w/v) SDS ( appendix 2D; prepare fresh), 65°C
  • 0.5× SSC/ 0.1% (w/v) SDS ( appendix 2D; prepare fresh), 65°C
  • Centrifuge (∼20,000 × g)
  • Speedvac vacuum desiccator (Savant)
  • 14 × 11 × 0.6–cm and 25 × 20 × 0.6–cm gel electrophoresis apparatuses (e.g., Life Technologies)
  • MP4 camera (Polaroid) and type 55 film or Eagle Eye II still video imaging system (Stratagene)
  • Fluorescent ruler
  • Zeta‐probe blotting membrane (Bio‐Rad)
  • Positive‐pressure DNA transfer apparatus (Stratagene)
  • UV Stratalinker (Stratagene)
  • Blotting paper (Schleicher & Schuell)
  • 60° to 80°C hybridization oven with rotisserie (Hybaid) and appropriate hybridization bottles
  • PhosphorImager (Molecular Dynamics) or Kodak X‐Omat AR film (for conventional autoradiography)
  • Additional reagents and materials for agarose gel electrophoresis and Southern blotting (unit 2.7)

Support Protocol 1: Mitochondrial DNA Probe Preparation Using Long‐Range PCR

  • 10 mM 4dNTP mixture ( appendix 2D)
  • Primer 1: 5′‐TGAGGCCAAATATCATTCTGAGGGGC‐3′
  • Primer 2: 5′‐TTTCATCATGCGGAGATGTTGGATGG‐3′
  • Ampliwax PCR Gem 50 (Perkin‐Elmer)
  • 50 to 250 ng total genomic DNA ( appendix 3B, unit 10.5, & unit 14.4) from leukocytes or skeletal muscle of normal individual (∼1 µl)
  • Expand Long Template PCR System (Boehringer Mannheim) containing 1.75 U/µl Taq DNA polymerase/Pwo DNA polymerase enzyme mixture and PCR buffers
  • DNA molecular weight markers: e.g., λ HindIII digest (Life Technologies; size range 564 to 23,130 bp)
  • 1× TBE buffer ( appendix 2D) containing 0.5 µg/ml ethidium bromide
  • Qiaex II gel extraction kit (Qiagen)
  • High Prime DNA labeling kit (Boehringer Mannheim)
  • 32P]dCTP (3000 mCi/mmol; Amersham)
  • 0.5‐ml microcentrifuge tubes
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7) and random oligonucleotide–primed synthesis ( appendix 3E)
NOTE: Special reagents used in this PCR reaction are the Expand Long Template PCR System (Boehringer Mannheim), Ampliwax PCR Gem 50 (Perkin‐Elmer), and 10× PCR amplification buffer (buffer 3, Boehringer Mannheim). Buffer 3 contains 500 mM Tris·Cl, pH 9.2; 140 mM (NH 4) 2SO 4; 22.5 mM MgCl 2; 20% (v/v) Nonidet P‐40; 0.5% (v/v) Tween 20; and 50% (v/v) glycerol.

Basic Protocol 2: Screening for Mitochondrial DNA Point Mutations by Restriction Analysis of PCR Products

  Materials
  • 10× PCR amplification buffer: 100 mM Tris˙Cl (pH 8.3)/50 mM KCl/25 mM MgCl 2
  • 1.25 mM 4dNTP mixture ( appendix 2D)
  • 10 pmol/µl forward and reverse oligonucleotide primers (see Table 9.9.2)
  • 5 U/µl Taq DNA polymerase
  • 25 to 50 ng genomic DNA from leukocytes ( appendix 3B & unit 14.4) or skeletal muscle (unit 10.5), or 5 to 10 ng mitochondrial DNA from platelets
  • Mineral oil (nuclease free)
  • 10× restriction buffer (supplied with restriction enzymes)
  • BSA
  • Spermidine
  • Restriction endonucleases for mutation detection (see Table 9.9.2)
  • 6× gel loading buffer with Ficoll ( appendix 2D)
  • 1× TBE buffer ( appendix 2D)
  • Ethidium bromide solution ( appendix 2D)
  • DNA molecular weight markers: e.g., DNA marker V (Boehringer Mannheim; size range 11 to 587 bp)
  • 0.5‐ml microcentrifuge tubes
  • UV Stratalinker (Stratagene)
  • Thermal cycler (Perkin‐Elmer)
  • Additional reagents and materials for agarose gel electrophoresis (unit 2.7) and nondenaturing PAGE (unit 7.4)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Alcolado, J.C., Majid, A., Brockington, M., Sweeney, M.G., Morgan, R., Rees, A., Harding, A.E., and Barnett, A.H. 1994. Mitochondrial gene defects in patients with NIDDM. Diabetologia 37:372‐376.
   Bourgeron, T., Rustin, P., Chretien, D., Birch‐Machin, M., Bourgeois, M., Viegas‐Péquignot, E., Munnich, A., and Rotig, A. 1995. Mutation of a nuclear succinate dehydrogenase gene results in mitochondrial respiratory chain deficiency. Nature Genet 11:144‐149.
   Cheng, S., Higuchi, R., and Stoneking, M. 1994. Complete mitochondrial genome amplification. Nature Genet. 7:350‐351.
   DeVries, D.D., Went, L.N., Bruyn, G.W., Scholte, H.R., Hofstra, R.M.W., Bolhuis, P.A., and van Oost, B.A. 1996. Genetic and biochemical impairment of mitochondrial complex I activity in a family with Lebec hereditary optic neuropathy and hereditary spastic dystonia. Am. J. Hum. Genet. 58:703‐711.
   Fabrizi, G.M., Tiranti, V., Mariotti, C., Guazzi, G.C., Malandrini, A., DiDonato, S., and Zeviani, M. 1995. Sequence analysis of mitochondrial DNA in a new inherited encephalomyopathy. J. Neurol. 242:490‐496.
   Fu, K., Hartlen, R., Johns, T., Genge, A., Karpati, G., and Shoubridge, E.A. 1996. A novel heteroplasmic tRNAleu(CUN) mtDNA point mutation in a sporadic patient with mitochondrial encephalomyopathy segregates rapidly in skeletal muscle and suggests and approach to therapy. Hum. Mol. Genet. 5:1835‐1840.
   Goto, Y., Nonaka, I., and Horai, S. 1990. A mutation in the tRNA(Leu)(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature 348:651‐653.
   Hammans, S.R., Sweeney, M.G., Brockington, M., Morgan, H.J.A., and Harding, A.E. 1991. Mitochondrial encephalopathies: Molecular genetic diagnosis from blood samples. Lancet 337:1311‐1313.
   Holt, I.J., Harding, A.E., Cooper, J.M., Schapira, A.H., Toscano, A., Clark, J.B., and Morgan‐Hughes, J.A. 1989a. Mitochondrial myopathies: Clinical and biochemical features of 30 patients with major deletions of muscle mitochondrial DNA. Ann. Neurol. 26:699‐708.
   Holt, I.J., Miller, D.H., and Harding, A.E. 1989b. Genetic heterogeneity and mitochondrial DNA heteroplasmy in Leber's hereditary optic neuropathy. J. Med. Genet. 26:739‐743.
   Howell, N., Bindoff, L., McCullough, D.A., Kubacka, I., Poulton, J., MacKey, D., Taylor, L., and Turnbull, D.M. 1991. Leber hereditary optic neuropathy: Identification of the same mitochondrial ND1 mutation in six pedigrees. Am. J. Hum. Genet. 49:939‐950.
   Huoponen, K., Vilkki, J., Aula, P., Nikoskelainen, E.K., and Savontaus, M.‐L. 1991. A new mtDNA mutation associated with Leber hereditary optic neuropathy. Am. J. Hum. Genet. 48:1147‐1153.
   Johns, D.R., Neufeld, M.J., and Park, R.D. 1992. An ND‐6 mitochondrial DNA mutation associated with Leber hereditary optic neuropathy. Biochem. Biophys. Res. Commun. 187:1551‐1557.
   Johns, D.R., Hehrer, K.L., Miller, N.R., and Smith, K.H. 1993. Leber's hereditary optic neuropathy. Clinical manifestations of the 14484 mutation. Arch. Ophthalmol. 111:495‐498.
   Keightly, J.A., Hoffbuh, K.C., Burton, M.D., Salas, V.M., Johnston, W.S.W., Penn, A.M.W., Buist, N.R.M., and Kennaway, N.G. 1996. A microdeletion in cytochrome c oxidase (COX) subunit III associated with COX deficiency and recurrent myoglobulinuria. Nature Genet. 12:410‐415.
   Moraes, C.T., DiMauro, S., Zeviani, M., Lombes, A., Shanske, S., Miranda, A.F., Nakase, H., Bonilla, E., Werneck, L.C., Servidel, S., Nonaka, I., Koga, Y., Spiro, A.J., Brownell, A.K.W., Schmidt, B., Schotland, D.L., Zupanc, M., DeVivo, D.C., Schon, E.A., and Rowland, L.P. 1989. Mitochondrial DNA deletions in progressive external ophthalmoplegia and Kearns‐Sayre syndrome. New Engl. J. Med. 320:1293‐1299.
   Moraes, C.T., Ricci, E., Bonilla, E., DiMauro, S., and Schon, E.A. 1992. The mitochondrial tRNA(Leu(UUR)) mutation in mitochondrial encephalomyopathy, lactic acidosis, and strokelike episodes (MELAS): Genetic, biochemical, and morphological correlations in skeletal muscle. Am. J. Hum. Genet. 50:934‐949.
   Otabe, S., Sakura, H., Shimokawa, K., Mori, Y., Kadowaki, H., Yasuda, K., Nonaka, K., Hagura, R., Akanuma, Y., Yazaki, Y., and Kadowaki, T. 1994. The high prevalence of the diabetic patients with a mutation in the mitochondrial gene in Japan. J. Clin. Endocrinol. Metab. 79:768‐771.
   Poulton, J., Deadman, M.E., Bronte‐Stewart, J., Foulds, W.S., and Gardiner, R.M. 1991. Analysis of mitochondrial DNA in Leber's hereditary optic neuropathy. J. Med. Genet. 28:765‐770.
   Sakuta, R., Goto, Y.‐I., Horai, S., and Nonaka, I. 1993. Mitochondrial DNA mutations at nucleotide positions 3243 and 3271 in mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke‐like episodes: A comparative study. J. Neurol. Sci. 115:158‐160.
   Santorelli, F.M., Shanske, S., Macaya, A., DeVivo, D.C., and DiMauro, S. 1993. The mutation at nt 8993 of mitochondrial DNA is a common cause of Leigh's syndrome. Ann. Neurol. 34:827‐834.
   Santorelli, F.M., Suk‐Chun, M., Vasquez‐Acevedo, M., Gonzalez‐Astiazarin, A., Ridaura‐Sanz, C., Gonzalez‐Halphen, D., and DiMauro, S. 1995. A novel mitochondrial DNA point mutation associated with mitochondrial encephaolcardiomyopathy. Biochem. Biophys. Res. Commun. 216:835‐840.
   Santorelli, F.M., Schlessel, J.S., Slonim, A.E., and DiMauro, S. 1996. Novel mutation in the mitochondrial DNA tRNA glycine gene associated with sudden unexpected death. Ped. Neurol. 15:145‐149.
   Schoolwerth, A.C. and Drewnowska, K. 1993. Renal metabolism. In Diseases of the Kidney (R.W. Schrier and C.W. Gottschalk, eds.) pp. 233‐260. Little, Brown, Boston.
   Shoffner, J.M., Lott, M.T., Lezza, A.M., Seibel, P., Ballinger, S.W., and Wallace, D.C. 1990. Myoclonic epilepsy and ragged‐red fiber disease (MERRF) is associated with a mitochondrial DNA tRNA(Lys) mutation. Cell 61:931‐937.
   Shoffner, J.M., Fernhoff, P.M., Krawiecki, N.S., Caplan, D.B., Holt, P.J., Koontz, D.A., Takei, Y., Newman, N.J., Ortiz, R.G., Polak, M., Ballinger, S.W., Lott, M.T., and Wallace, D.C. 1992. Subacute necrotizing encephalopathy: Oxidative phosphorylation defects and the ATPase 6 point mutation. Neurology 42:2168‐2174.
   Shoffner, J.M. and Wallace, D.C. 1995. Oxidative phosphorylation diseases. In The Metabolic and Molecular Bases of Inherited Disease (C.R. Scriver, A.L. Beaudet, W.S. Sly, and D. Valle, eds.) pp. 1535‐1610. McGraw‐Hill, New York.
   Silvestri, G., Servidel, S., Ranas, M., Ricci, E., Spinazzola, A., Paris, E., and Tonall, P. 1996. A novel mitochondrial DNA point mutation in the tRNAIle gene is associated with progressive external ophthalmoplegia. Biochem. Biophys. Res. Commun. 220:622‐627.
   Suomalainen, A., Kaukonen, J., Amati, P., Timonen, R., Haltia, M., Weissenbach, J., Zeviani, M., Somer, H., and Peltonen, L. 1995. An autosomal dominant locus predisposing to deletions of mitochondrial DNA. Nature Genet. 9:146‐151.
   Tatuch, Y., Christodoulou, J., Feigenbaum, A., Clark, J.T.R., Wherret, J., Smith, C., Rudd, N., Petrova‐Benedict, R., and Robinson, B.H. 1992. Heteroplasmic mitochondrial DNA mutation (T to G) at 8993 can cause Leigh disease when the percentage of abnormal mtDNA is high. Am. J. Hum. Genet. 50:852‐858.
   Tatuch, Y., Pagon, R.A., Vlcek, B., Roberts, R., Korson, M., and Robinson, B.H. 1994. The 8993 mtDNA mutation: Heteroplasmy and clinical presentation in three families. Eur. J. Hum. Genet. 2:35‐43.
   Taylor, R.W., Chinney, P.F., Haldane, F., Morris, A.A.M., Bindoff, L.A., Wilson, J., and Turnbull, D.M. 1996. MELAS associated with a mutation in the valine transfer RNA gene of mitochondrial DNA. Ann. Neuorl. 40:459‐462.
   Tiranti, V., Chariot, P., Carella, F., Toscano, A., Soliveci, P., Girlanda, P., Carrara, F., Fratta, G.M., Reid, F.M., Mariotti, C., and Zeviani, M. 1995. Maternally inherited hearing loss, ataxia, and myoclonus associated with a novel point mutation in mitochondrials tRNASer(UCN) gene. Hum. Mol. Genet. 4:1421‐1427
   Wallace, D.C., Singh, G., Lott, M.T., Hodge, J.A., Schurr, T.G., Lezza, A.M., Elsas, L.J. 2d., and Nikoskelainen, E.K. 1988. Mitochondrial DNA mutation associated with Leber's hereditary optic neuropathy. Science 242:1427‐1430.
   Wallace, D.C., Lott, M.T., Brown, M.D., Huoponen, K., and Torroni, A. 1995. Report of the committee on human mitochondrial DNA. In Human Gene Mapping 1994, a Compendium (A.J. Cuticchia, ed.) pp. 910‐954. Johns Hopkins University Press, Baltimore.
   Yershov, G., Barsky, V., Belgovskiy, A., Kirillov, E., Kreindlin, E., Ivanov, I., Parinov, S., Guschin, D., Drobishev, A., Dubiley, S., and Mirzabekov, A. 1996. DNA analysis and diagnostics on oligonucleotide microchips. Proc. Natl. Acad. Sci. U.S.A. 93:4913‐4918.
   Zeviani, M., Amati, P., Bresolin, N., Antozzi, C., Piccolo, G., Toscano, A., and DiDonato, S. 1991. Rapid detection of the A to G (8344) mutation of mtDNA in Italian families with myoclonus epilepsy and ragged‐red fibers (MERRF). Am. J. Hum. Genet. 48:203‐211.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library