Molecular Diagnosis of Hearing Loss

Kerry K. Brown1, Heidi L. Rehm2

1 Department of Genetics, Harvard Medical School, Boston, Massachusetts, 2 Laboratory for Molecular Medicine, Partners Healthcare Center for Personalized Genetic Medicine, Cambridge, Massachusetts
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 9.16
DOI:  10.1002/0471142905.hg0916s72
Online Posting Date:  January, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit discusses an approach to identifying a genetic etiology in an individual with nonsyndromic hearing loss. The unit begins with a discussion of the decision‐making process that can be used to determine whether specific genes and/or a large gene panel should be used for molecular diagnosis of a patient presenting with nonsyndromic hearing loss. Next, two protocols are presented: (1) a full gene‐sequencing assay to identify mutations in the GJB2 gene (encoding connexin 26), the most common cause of congenital hearing loss, and (2) an assay to detect the presence of the GJB6‐D13S1830 deletion, a 342‐kb deletion that causes hearing loss in homozygosity or in combination with a single GJB2 mutation. Finally, the unit ends with a strategy for determining the clinical significance of the test results, which can be challenging given the extensive genetic heterogeneity associated with hearing loss. Curr. Protoc. Hum. Genet. 72:9.16.1‐9.16.16 © 2012 by John Wiley & Sons, Inc.

Keywords: hearing loss; deafness; connexin 26; GJB2; connexin 30; GJB6

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: GJB2 (Connexin 26) Gene Test
  • Basic Protocol 2: GJB6–D13S1830 (Connexin 30) Deletion Test
  • Guide to Data Interpretation
  • Time Considerations
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: GJB2 (Connexin 26) Gene Test

  Materials
  • FailSafe PCR System with PreMix D (Epicentre Technologies, cat. no. FS99100)
  • 10 µM primers: Cx26‐1F, ‐1R, ‐2AF, ‐2BF, ‐2AR, and ‐2BR (Table 9.16.1)
  • 25 mM MgCl 2
  • 10 mM dNTP mix ( appendix 2D)
  • AmpliTaq Gold Taq DNA polymerase and 10× PCR buffer II (Applied Biosystems)
  • PCR‐grade H 2O
  • 50 ng/µl genomic DNA ( appendix 3B) to be tested
  • Thermal cycler and suitable reaction tubes
  • PCR cleanup kit (supplied by many companies, e.g., Qiagen or Agencourt Bioscience)
  • Software for sequence data analysis
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7) and DNA cycle sequencing (unit 7.7)
    Table 9.6.1   MaterialsGJB2 Primers

    Name Forward primer sequence (5′→3′) Name Reverse primer sequence (5′→3′) Product length (bp)
    PCR primers
    1F GCCGCCCCCTCCGTAACTTTC 1R CGTGTGTTGGTCCAGCCCCCC 362
    2AF GAGAAGTCTCCCTGTTCTGTCCTA 2BR ACAGCTGAGCACGGGTTG 855
    Additional sequencing primers
    2BF GGCCTACCGGAGACATGAG 2AR ATGCTGCTTGTGTAGGTCCA

Basic Protocol 2: GJB6–D13S1830 (Connexin 30) Deletion Test

  Materials
  • FailSafe PCR System with PreMix D (Epicentre Technologies, cat. no. FS99100)
  • 25 µM primers: F, NLR, and BKR (Table 9.16.3)
  • PCR‐grade H 2O
  • 50 µl genomic DNA ( appendix 3B) to be tested
  • Thermal cycler and suitable reaction tubes
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7)
    Table 9.6.3   MaterialsGJB6‐D13S1830 Primers

    Name Forward primer sequence (5′→3′) Name Reverse primer sequences (5′→3′) Product length
    F TTT AGG GCA TGA TTG GGG TGA TTT NLR TCA TCG GGG GTG TCA ACA AAC A 681 bp
    BKR CAC CAT GCG TAG CCT TAA CCA TTT T 460 bp

GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   1000 Genomes Project: http://www.1000genomes.org/. Accessed: 2011.
   ACMG, Genetics evaluation of congenital hearing loss expert panel. 2002. Genetics evaluation guidelines for the etiologic diagnosis of congenital hearing loss. Genet Med. 4:162‐171.
   Azaiez, H., Yang, T., Prasad, S., Sorensen, J.L., Nishimura, C.J., Kimberling, W.J., and Smith, R.J. 2007. Genotype‐phenotype correlations for SLC26A4‐related deafness. Hum. Genet. 122:451‐457.
   Ballana, E., Ventayol, M., Rabionet, R., Gasparini, P., and Estivill, X. 2011. Connexins and deafness homepage: http://www.crg.es/deafness. Accessed: 2011.
   Bespalova, I.N., Van Camp, G., Bom, S.J., Brown, D.J., Cryns, K., DeWan, A.T., Erson, A.E., Flothmann, K., Kunst, H.P., Kurnool, P., Sivakumaran, T.A., Cremers, C.W., Leal, S.M., Burmeister, M., and Lesperance, M.M. 2001. Mutations in the Wolfram syndrome 1 gene (WFS1) are a common cause of low frequency sensorineural hearing loss. Hum. Mol. Genet. 10:2501‐2508.
   Cryns, K., Orzan, E., Murgia, A., Huygen, P.L., Moreno, F., del Castillo, I., Chamberlin, G.P., Azaiez, H., Prasad, S., Cucci, R.A., Leonardi, E., Snoeckx, R.L., Govaerts, P.J., Van de Heyning, P.H., Van de Heyning, C.M., Smith, R.J., and Van Camp, G. 2004. A genotype‐phenotype correlation for GJB2 (connexin 26) deafness. J. Med. Genet. 41:147‐154.
   dbSNP. National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/projects/SNP/). Accessed 2011.
   de Kok, Y.J, van der Maarel, S.M., Bitner‐Glindzicz, M., Huber, I., Monaco, A.P., Malcolm, S., Pembrey, M.E., Ropers, H.H., and Cremers, F.P. 1995. Association between X‐linked mixed deafness and mutations in the POU domain gene POU3F4. Science 267:685‐688.
   de Kok, Y.J., Vossenaar, E.R, Cremers, C.W., Dahl, N., Laporte, J., Hu, L.J., Lacombe, D., Fischel‐Ghodsian, N., Friedman, R.A., Parnes, L.S., Thorpe, P., Bitner‐Glindzicz, M., Pander, H.J., Heilbronner, H., Graveline, J., den Dunnen, J.T., Brunner, H.G., Ropers, H.H., and Cremers, F.P. 1996. Identification of a hot spot for microdeletions in patients with X‐linked deafness type 3 (DFN3) 900 kb proximal to the DFN3 gene POU3F4. Hum. Mol. Genet. 5:1229‐1235.
   del Castillo, I., Villamar, M., Moreno‐Pelayo, M.A., del Castillo, F.J., Alvarez, A., Telleria, D., Menendez, I., and Moreno, F. 2002. A deletion involving the connexin 30 gene in nonsyndromic hearing impairment. N. Engl. J. Med. 346:243‐249.
   del Castillo, I., Moreno‐Pelayo, M.A., Del Castillo, F.J., Brownstein, Z., Marlin, S., Adina, Q., Cockburn, D.J., Pandya, A., Siemering, K.R., Chamberlin, G.P., Ballana, E., Wuyts, W., Maciel‐Guerra, A.T., Alvarez, A., Villamar, M., Shohat, M., Abeliovich, D., Dahl, H.H., Estivill, X., Gasparini, P., Hutchin, T., Nance, W.E., Sartorato, E.L., Smith, R.J., Van Camp, G., Avraham, K.B., Petit, C., and Moreno, F. 2003. Prevalence and evolutionary origins of the del(GJB6‐D13S1830) mutation in the DFNB1 locus in hearing‐impaired subjects: A multicenter study. Am. J. Hum. Genet. 73:1452‐1458.
   del Castillo, F.J., Rodríguez‐Ballesteros, M., Alvarez, A., Hutchin, T., Leonardi, E., de Oliveira, C.A., Azaiez, H., Brownstein, Z., Avenarius, M.R., Marlin, S., Pandya, A., Shahin, H., Siemering, K.R., Weil, D., Wuyts, W., Aguirre, L.A., Martín, Y., Moreno‐Pelayo, M.A., Villamar, M., Avraham, K.B., Dahl, H.H., Kanaan, M., Nance, W.E., Petit, C., Smith, R.J., Van Camp, G., Sartorato, E.L., Murgia, A., Moreno, F., and del Castillo, I. 2005. A novel deletion involving the connexin‐30 gene, del(GJB6‐d13s1854), found in trans with mutations in the GJB2 gene (connexin‐26) in subjects with DFNB1 non‐syndromic hearing impairment. J. Med. Genet. 42:588‐594.
   Delmaghani, S., del Castillo, F.J., Michel, V., Leibovici, M., Aghaie, A., Ron, U., van Laer, L., Ben‐Tal, N., van Camp, G., Weil, D., Langa, F., Lathrop, M., Avan, P., and Petit, C. 2006. Mutations in the gene encoding pejvakin, a newly identified protein of the afferent auditory pathway, cause DFNB59 auditory neuropathy. Nat. Genet. 38:770‐778.
   Denoyelle, F., Lina‐Granade, G., Plauchu, H., Bruzzone, R., Chaib, H., Levi‐Acobas, F., Weil, D., and Petit, C. 1998. Connexin 26 gene linked to a dominant deafness. Nature 393:319‐320.
   Denoyelle, F., Marlin, S., Weil, D., Moatti, L., Chauvin, P., Garabedian, E.N., and Petit, C. 1999. Clinical features of the prevalent form of childhood deafness, DFNB1, due to a connexin‐26 gene defect: Implications for genetic counseling. Lancet 353:1298‐1303.
   Feldmann, D., le Marechal, C., Jonard, L., Thierry, P., Czajka, C., Couderc, R., Ferec, C., Denoyelle, F., Marlin, S., and Fellmann, F. 2009. A new large deletion in the DFNB1 locus causes nonsyndromic hearing loss. Eur. J. Med. Genet. 52:195‐200.
   Fischel‐Ghodsian, N. 2003. Mitochondrial deafness. Ear Hear. 24:303‐313.
   Green, G.E., Scott, D.A., McDonald, J.M., Woodworth, G.G., Sheffield, V.C., and Smith, R.J. 1999. Carrier rates in the midwestern United States for GJB2 mutations causing inherited deafness. JAMA 281:2211‐2216.
   HGMD. Human Genetic Mutation Database (http://www.hgmd.org). Accessed 2011.
   Hone, S.W. and Smith, R.J. 2002. Medical evaluation of pediatric hearing loss. Laboratory, radiographic, and genetic testing. Otolaryngol. Clin. North Am. 35:751‐764.
   Kenna, M.A., Rehm, H.L., Robson, C.D., Frangulov, A., McCallum, J., Yaeger, D., and Krantz, I.D. 2007. Additional clinical manifestations in children with sensorineural hearing loss and biallelic GJB2 mutations: who should be offered GJB2 testing? Am. J. Med. Genet. A 143A:1560‐1566.
   Kenneson, A., Van Naarden Braun, K., and Boyle, C. 2002. GJB2 (connexin 26) variants and nonsyndromic sensorineural hearing loss: A HuGE review. Genet. Med. 4:258‐274.
   Kimberling, W.J., Hildebrand, H.S., Shearer, A.E., Jensen, M.L., Halder, J.A., Trzupek, K., Cohn, E.S., Weleber, R.G., Stone, E.M., and Smith, R.J. 2010. Frequency of Usher syndrome in two pediatric populations: Implications for genetic screening of deaf and hard of hearing children. Genet. Med. 12:512‐516.
   Lerer, I., Sagi, M., Ben‐Neriah, Z., Wang, T., Levi, H., and Abeliovich, D. 2001. A deletion mutation in GJB6 cooperating with a GJB2 mutation in trans in non‐syndromic deafness: A novel founder mutation in Ashkenazi Jews. Hum. Mutat. 18:460.
   Lim, L.H., Bradshaw, J.K., Guo, Y., Pilipenko, V., Madden, C., Ingala, D., Keddache, M., Choo, D.I., Wenstrup, R., and Greinwald, J.H.Jr. 2003. Genotypic and phenotypic correlations of DFNB1‐related hearing impairment in the Midwestern United States. Arch. Otolaryngol. Head Neck Surg. 129:836‐840.
   LOVD. Leiden Open Variation Database (http://www.lovd.nl/2.0/). Accessed: 2011.
   MORL. Molecular Otolaryngology and Research Laboratory (http://www.healthcare.uiowa.edu/labs/pendredandbor/slcMutations.htm). Accessed: 2011.
   Morle, L., Bozon, M., Alloisio, N., Latour, P., Vandenberghe, A., Plauchu, H., Collet, L., Edery, P., Godet, J., and Lina‐Granade, G. 2000. A novel C202F mutation in the connexin26 gene (GJB2) associated with autosomal dominant isolated hearing loss. J. Med. Genet. 37:368‐370.
   NCHAM. National Center for Hearing Assessment and Management (http://www.infanthearing.org). Accessed: 2011.
   Norris, V.W., Arnos, K.S., Hanks, W.D., Xia, X., Nance, W.E., and Pandya, A. 2006. Does universal newborn hearing screening identify all children with GJB2 (Connexin 26) deafness? Penetrance of GJB2 deafness. Ear Hear. 27:732‐741.
   Orzan, E., Polli, R., Martella, M., Vinanzi, C., Leonardi, M., and Murgia, A. 1999. Molecular genetics applied to clinical practice: The Cx26 hearing impairment. Br. J. Audiol. 33:291‐295.
   Pallares‐Ruiz, N., Blanchet, P., Mondain, M., Claustres, M., and Roux, A.F. 2002. A large deletion including most of GJB6 in recessive non syndromic deafness: a digenic effect? Eur. J. Hum. Genet. 10:72‐76.
   Primignani, P., Castorina, P., Sironi, F., Curcio, C., Ambrosetti, U., and Coviello, D.A. 2003. A novel dominant missense mutation–D179N–in the GJB2 gene (Connexin 26) associated with non‐syndromic hearing loss. Clin. Genet. 63:516‐521.
   Putcha, G.V., Bejjani, B.A., Bleoo, S., Booker, J.K., Carey, J.C., Carson, N., Das, S., Dempsey, M.A., Gastier‐Foster, J.M., Greinwald, J.H. Jr., Hoffmann, M.L., Jeng, L.J., Kenna, M.A., Khababa, I., Lilley, M., Mao, R., Muralidharan, K., Otani, I.M., Rehm, H.L., Schaefer, F., Seltzer, W.K., Spector, E.B., Springer, M.A., Weck, K.E., Wenstrup, R.J., Withrow, S., Wu, B.L., Zariwala, M.A., and Schrijver, I. 2007. A multicenter study of the frequency and distribution of GJB2 and GJB6 mutations in a large North American cohort. Genet. Med. 9:413‐426.
   Rehm, H.L. Partners Healthcare Laboratory for Molecular Medicine (http://pcpgm.partners.org/lmm/tests/hearing‐loss/OtoChip). Accessed: 2011.
   Rehm, H.L., Hernandez, A.L., Lerner‐Ellis, J.P., White, E., Kenna, M.A., and Funke, B.H. 2011. The OtoChip, OtoGenome and OtoQuery Tests. Abstract #53. American College of Medical Genetics Conference, Vancouver, Canada.
   Richards, C.S., Bale, S., Bellissimo, D.B., Das, S., Grody, W.W., Hegde, M.R., Lyon, E., Ward, B.E., and the Molecular Subcommittee of the ACMG Laboratory Quality Assurance Committee. 2008. ACMG recommendations for standards for interpretation and reporting of sequence variations: Revisions 2007. Genet. Med. 10:294‐300.
   Rodriguez‐Ballesteros, M., del Castillo, F.J., Martin, Y., Moreno‐Pelayo, M.A., Morera, C., Prieto, F., Marco, J., Morant, A., Gallo‐Teran, J., Morales‐Angulo, C., Navas, C., Trinidad, G., Tapia, M.C., Moreno, F., and del Castillo, I. 2003. Auditory neuropathy in patients carrying mutations in the otoferlin gene (OTOF). Hum. Mutat. 22:451‐456.
   Rodríguez‐Ballesteros, M., Reynoso, R., Olarte, M., Villamar, M., Morera, C., Santarelli, R., Arslan, E., Medá, C., Curet, C., Völter, C., Sainz‐Quevedo, M., Castorina, P., Ambrosetti, U., Berrettini, S., Frei, K., Tedín, S., Smith, J., Cruz Tapia, M., Cavallé, L., Gelvez, N., Primignani, P., Gómez‐Rosas, E., Martín, M., Moreno‐Pelayo, M.A., Tamayo, M., Moreno‐Barral, J., Moreno, F., and del Castillo, I. 2008. A multicenter study on the prevalence and spectrum of mutations in the otoferlin gene (OTOF) in subjects with nonsyndromic hearing impairment and auditory neuropathy. Hum. Mutat. 29:823‐831.
   Roizen, N.J. 2003. Nongenetic causes of hearing loss. Ment. Retard. Dev. Disabil. Res. Rev. 9:120‐127.
   Shahin, H., Walsh, T., Sobe, T., Lynch, E., King, M.C., Avraham, K.B., and Kanaan, M. 2002. Genetics of congenital deafness in the Palestinian population: multiple connexin 26 alleles with shared origins in the Middle East. Hum. Genet. 110:284‐289.
   Shearer, A.E., DeLuca, A.P., Hildebrand, M.S., Taylor, K.R., Gurrola, J. 2nd, Scherer, S., Scheetz, T.E., and Smith, R.J. 2010. Comprehensive genetic testing for hereditary hearing loss using massively parallel sequencing. Proc. Natl. Acad. Sci. U.S.A. 107:21104‐21109.
   Snoeckx, R.L., Huygen, P.L., Feldmann, D., Marlin, S., Denoyelle, F., Waligora, J., Mueller‐Malesinska, M., Pollak, A., Ploski, R., Murgia, A., Orzan, E., Castorina, P., Ambrosetti, U., Nowakowska‐Szyrwinska, E., Bal, J., Wiszniewski, W., Janecke, A.R., Nekahm‐Heis, D., Seeman, P., Bendova, O., Kenna, M.A., Frangulov, A., Rehm, H.L., Tekin, M., Incesulu, A., Dahl, H.H., du Sart, D., Jenkins, L., Lucas, D., Bitner‐Glindzicz, M., Avraham, K.B., Brownstein, Z., del Castillo, I., Moreno, F., Blin, N., Pfister, M., Sziklai, I., Toth, T., Kelley, P.M., Cohn, E.S., Van Maldergem, L., Hilbert, P., Roux, A.F., Mondain, M., Hoefsloot, L.H., Cremers, C.W., Löppönen, T., Löppönen, H., Parving, A., Gronskov, K., Schrijver, I., Roberson, J., Gualandi, F., Martini, A., Lina‐Granade, G., Pallares‐Ruiz, N., Correia, C., Fialho, G., Cryns, K., Hilgert, N., Van de Heyning, P., Nishimura, C.J., Smith, R.J., and Van Camp, G. 2005. GJB2 mutations and degree of hearing loss: A multicenter study. Am. J. Hum. Genet. 77:945‐957.
   Tekin, M., Arnos, K.S., Xia, X.J., Oelrich, M.K., Liu, X.Z., Nance, W.E., and Pandya, A. 2001. W44C mutation in the connexin 26 gene associated with dominant non‐syndromic deafness. Clin. Genet. 59:269‐273.
   Toriello, H.V., Reardon, W., and Gorlin, R.J. 2004. Hereditary Hearing Loss and Its Syndromes. Oxford University Press, Oxford.
   UMD. Universal Mutation Database (http://www.umd.be/). Accessed: 2011.
   Van Camp, G. and Smith, R.J.H. 2011. Hereditary Hearing Loss Homepage (http://hereditaryhearingloss.org). Accessed: 2011.
   Varga, R., Kelley, P.M., Keats, B.J., Starr, A., Leal, S.M., Cohn, E., and Kimberling, W.J. 2003. Non‐syndromic recessive auditory neuropathy is the result of mutations in the otoferlin (OTOF) gene. J. Med. Genet. 40:45‐50.
   Wilch, E., Azaiez, H., Fisher, R.A., Elfenbein, J., Murgia, A., Birkenhager, R., Bolz, H., da Sil va‐Costa, S.M., del Castillo, I., Haaf, T., Hoefsloot, L., Kremer, H., Kubisch, C., le Marechal, C., Pandya, A., Sartorato, E.L., Schneider, E., van Camp, G., Wuyts, W., Smith, R.J., and Friderici, K.H. 2010. A novel DFNB1 deletion allele supports the existence of a distant cis‐regulatory region that controls GJB2 and GJB6 expression. Clin. Genet. 78:267‐274.
   Yang, T., Vidarsson, H., Rodrigo‐Blomqvist, S., Rosengren, S.S., Enerback, S., and Smith, R.J. 2007. Transcriptional control of SLC26A4 is involved in Pendred syndrome and nonsyndromic enlargement of vestibular aqueduct (DFNB4). Am. J. Hum. Genet. 80:1055‐1063.
   Young, T.L., Ives, E., Lynch, E., Person, R., Snook, S., MacLaren, L., Cater, T., Griffin, A., Fernandez, B., Lee, M.K., King, M.C., and Cator, T. 2001. Non‐syndromic progressive hearing loss DFNA38 is caused by heterozygous missense mutation in the Wolfram syndrome gene WFS1. Hum. Mol. Genet. 10:2509‐2514.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library