Huntington Disease: Molecular Diagnostics Approach

Murat Bastepe1, Winnie Xin2

1 Endocrine Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts, 2 Center for Human Genetic Research, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 9.26
DOI:  10.1002/0471142905.hg0926s87
Online Posting Date:  October, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Huntington disease (HD) is caused by expansion of a CAG trinucleotide repeat in the first exon of the Huntingtin (HTT) gene. Molecular testing of Huntington disease for diagnostic confirmation and disease prediction requires detection of the CAG repeat expansion. There are three main types of HD genetic testing: (1) diagnostic testing to confirm or rule out disease, (2) presymptomatic testing to determine whether an at‐risk individual inherited the expanded allele, and (3) prenatal testing to determine whether the fetus has inherited the expanded allele. This unit includes protocols that describe the complementary use of polymerase chain reactions (PCR) and Southern blot hybridization to accurately measure the CAG trinucleotide repeat size and interpret the test results. In addition, an indirect linkage analysis that does not reveal the unwanted parental HD status in a prenatal testing will also be discussed. © 2015 by John Wiley & Sons, Inc.

Keywords: Huntington disease; triplet repeat expansion; HTT; Huntington disease testing protocol

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Fluorescent PCR Amplification of the HTT CAG Repeat by Using Partial Triplet Repeat Primer and Capillary GEL Electrophoresis
  • Basic Protocol 2: Fluorescent PCR Amplification of Both CAG and CCG Repeats by Using Traditional Primer Pair and Capillary GEL Electrophoresis
  • Basic Protocol 3: Confirmation of Large Expanded Alleles by Using Southern Blotting
  • Support Protocol 1: Preparing and Radiolabeling the Probe
  • Basic Protocol 4: Non‐Disclosure Prenatal Linkage Analysis
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Fluorescent PCR Amplification of the HTT CAG Repeat by Using Partial Triplet Repeat Primer and Capillary GEL Electrophoresis

  Materials
  • No‐template control (NTC), the template volume is replaced with HPLC H 2O
  • Positive controls with known CAG repeat lengths of 38/17, 85/17
  • 10× PCR buffer II (Applied Biosystems)
  • 25 mM MgCl2 (Applied Biosystems)
  • 1 mM deoxynucleotides (dNTPs; 0.25 mM each of dATP, dCTP, dGTP and dTTP)
  • Forward primer (short F): (5 μM) 5′ 6FAM‐ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC (Applied Biosystems)
  • Reverse primer (short R): (5 μM) 5′ ABDtail‐GGCGGTGGCGGCTGTTGCTGCTGCTGCTGC (Applied Biosystems)
  • Dimethyl sulfoxide (DMSO; Sigma)
  • 5 U/μl AmpliTaq Gold DNA polymerase (Applied Biosystems)
  • HPLC H 2O
  • Purified DNA sample in 10 mM Tris·Cl, pH 9.0/0.5 mM EDTA
  • Hi‐Di formamide
  • GeneScan500 LIZ fluorescent size standard (Applied Biosystems)
  • 1.5‐ml sterile microcentrifuge tubes
  • Sterile PCR tubes/plate
  • Thermal cycler
  • Applied Biosystems 3100/3130 or 3730 Genetic Analyzer or other appropriate capillary gel electrophoresis system
  • GeneMapper v5 software (Applied Biosystems)

Basic Protocol 2: Fluorescent PCR Amplification of Both CAG and CCG Repeats by Using Traditional Primer Pair and Capillary GEL Electrophoresis

  Materials
  • No‐template control (NTC), the template volume is replaced with HPLC H 2O
  • Positive controls with known CAG repeat lengths of 38/17, 85/17
  • 10× PCR buffer (Qiagen)
  • 1 mM Deoxynucleotides (dNTPs; 0.25 mM each of dATP, dCTP, dGTP, and dTTP)
  • Forward primer (long F): (5 μM) 5′ 6FAM‐CCTTCGAGTCCCTCAAGTCCTTC (Applied Biosystems)
  • Reverse primer (long R): (5 μM) 5′ ABDtail‐CGGCTGAGGCAGCAGCGGCTGT (Applied Biosystems)
  • Dimethyl sulfoxide (DMSO; Sigma)
  • 5 U/μl Qiagen Taq DNA polymerase (Qiagen)
  • HPLC H 2O
  • Purified DNA sample in 10 mM Tris·Cl, pH 9.0/0.5 mM EDTA
  • Hi‐Di formamide
  • GeneScan500 LIZ fluorescent size standard (Applied Biosystems)
  • 1.5‐ml sterile microcentrifuge tube
  • Sterile PCR tubes/plate
  • Thermal cycler
  • Applied Biosystems 3100/3130 or 3730 Genetic Analyzer or other appropriate capillary gel electrophoresis system
  • GeneMapper v5 software (Applied Biosystems)

Basic Protocol 3: Confirmation of Large Expanded Alleles by Using Southern Blotting

  Materials
  • DNA samples to be analyzed (free from contaminating proteins or RNA, as well as any organic solutions such as phenol)
  • Control DNA samples with normal and expanded alleles
  • PvuII‐HF (100 U/μl) and ApaI (20 U/μl) (New England Biolabs)
  • 10X CutSmart Buffer (New England Biolabs)
  • Agarose (Invitrogen)
  • Nusieve agarose (Lonza)
  • 1× TAE buffer, pH 8.5 (see recipe)
  • Ethidium bromide solution (10 mg/ml) (Sigma)
  • 10× Orange G gel loading dye (see recipe)
  • 1‐kb DNA ladder (New England Biolabs)
  • Denaturing buffer: 1.5 M NaCl/0.5 M NaOH (store at room temperature)
  • Neutralizing buffer: 1.5 M NaCl/0.5 M Tris·Cl, pH 7.0 (store at room temperature)
  • 20× and 2× SSC (see recipes)
  • QuikHyb solution (Agilent)
  • Radiolabeled probe (see protocol 4Support Protocol)
  • Sonicated salmon sperm DNA (Sigma)
  • First wash solution [2× SSC buffer and 0.1% (w/v) SDS]
  • Second wash solution [0.1× SSC buffer and 0.1% (w/v) SDS]
  • Agarose gel electrophoresis apparatus with tray size 20 cm × 24 cm
  • UV transparent plastic wrap (Saran wrap)
  • Ruler
  • UV light
  • Orbital shaker
  • One large glass plate to support the wicks
  • Glass container large enough to hold 2 liters of buffer
  • Whatman 3 MM filter paper sheets
  • Glass pipets
  • Nitrocellulose membrane (Bio‐Rad)
  • Paper towel stacks
  • One small glass plate to place on top of the assembly and under the weight
  • Permanent marker
  • Forceps
  • UV crosslinker (Fisher Scientific, cat. no. FB‐UVXL‐1000)
  • Glass roller bottles
  • Hybridization oven (FisherBiotech)
  • 1.5 ml microcentrifuge tubes
  • X‐ray film exposure cassette
  • X‐ray film (Labscientific)
  • X‐ray film processor (Kodak X‐OMAT 2000)

Support Protocol 1: Preparing and Radiolabeling the Probe

  Additional Materials (also see protocol 3)
  • 5 × AccuPrime GC‐Rich Buffer A (Invitrogen)
  • Forward primer: 5′‐TTGCTGTGTGAGGCAGAACCT‐3′
  • Reverse primer: 5′‐GAAGGACTTGAGGGACTCGAA‐3′
  • AccuPrime GC‐Rich DNA polymerase (2 U/μl) (Invitrogen)
  • Genomic DNA from healthy control
  • Agarose (Invitrogen)
  • 1× TAE (see recipe)
  • 100‐bp DNA ladder (New England Biolabs)
  • Ethidium bromide, 10 mg/ml (Sigma)
  • DNA gel purification kit (QiaQuick Gel Purification Kit, Qiagen)
  • Radiolabeling kit (Megaprime kit from GE Healthcare Life Sciences)
  • [α‐32P]‐dCTP (3000 Ci/mmol) (Perkin‐Elmer)
  • Ice
  • Liquid Scintillation Cocktail (Perkin‐Elmer)
  • 1.5‐ml microcentrifuge tubes
  • Thermal cycler
  • Agarose gel electrophoresis apparatus
  • UV light
  • Spectrophotometer, optional
  • Microcentrifuge (Eppendorf)
  • Pre‐packed Sephadex G‐50 Columns (ProbeQuant G‐50 Micro Columns from GE Healthcare Life Sciences)
  • 20 ml plastic vials
  • Liquid Scintillation Counter for beta‐emission (Beckman LS 6000IC)
  • Protective shields appropriate for 32P

Basic Protocol 4: Non‐Disclosure Prenatal Linkage Analysis

  Materials
  • No‐template control (NTC), the template volume is replaced with HPLC H 2O
  • 10× PCR buffer (Qiagen)
  • 1 mM deoxynucleotides (dNTPs; 0.25 mM each of dATP, dCTP, dGTP, and dTTP)
  • Forward primer: (5 μM) 5′ 6FAM‐respective forward primer for the microsatellite marker (Applied Biosystems)
  • Reverse primer: (5 μM) 5′ ABDtail‐respective reverse primer for the microsatellite marker (Applied Biosystems)
  • 5 U/μl Qiagen Taq DNA polymerase (Qiagen)
  • HPLC H 2O
  • Purified DNA sample in 10 mM Tris·Cl, pH 7.5 /1 mM EDTA
  • Hi‐Di formamide
  • GeneScan500 LIZ fluorescent size standard (Applied Biosystems)
  • 1.5‐ml sterile microcentrifuge tube
  • Sterile PCR tubes/plate
  • Thermal cycler
  • Applied Biosystems 3100/3130 or 3730 Genetic Analyzer or other appropriate capillary gel electrophoresis system
  • GeneMapper v5 software (Applied Biosystems)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Andrew, S.E., Goldberg, Y.P., Theilmann, J., Zeisler, J., and Hayden, M.R. 1994. A CCG repeat polymorphism adjacent to the CAG repeat in the Huntington disease gene: Implications for diagnostic accuracy and predictive testing. Hum. Mol. Genet. 3:65‐67. doi: 10.1093/hmg/3.1.65.
  Bean, L. and Bayrak‐Toydemir, P. 2014. American College of Medical Genetics and Genomics Standards and Guidelines for Clinical Genetics Laboratories, 2014 edition: technical standards and guidelines for Huntington disease. Genet. Med. 16:e2.
  Braude, P.R., De Wert, G.M., Evers‐Kiebooms, G., Pettigrew, R.A., and Geraedts, J.P. 1998. Non‐disclosure preimplantation genetic diagnosis for Huntington's disease: Practical and ethical dilemmas. Prenat. Diagn. 18:1422‐1426. doi: 10.1002/(SICI)1097‐0223(199812)18:13%3c1422::AID‐PD499%3e3.0.CO;2‐R.
  Goldberg, Y.P., Andrew, S.E., Clarke, L.A., and Hayden, M.R. 1993. A PCR method for accurate assessment of trinucleotide repeat expansion in Huntington disease. Hum. Mol. Genet. 2:635‐636. doi: 10.1093/hmg/2.6.635.
  Guida, M., Fenwick, R.G., Papp, A.C., Snyder, P.J., Sedra, M., and Prior, T.W. 1996. Southern transfer protocol for confirmation of Huntington disease. Clin. Chem. 42:1711‐1712.
  Holzmann, C., Saecker, A.M., Epplen, J.T., and Riess, O. 1997. Avoiding errors in the diagnosis of (CAG)n expansion in the huntingtin gene. J. Med. Genet. 34:264.
  The Huntington Disease Collaborative Research Group, 1993. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell 72:971‐983. doi: 10.1016/0092‐8674(93)90585‐E.
  Jama, M., Millson, A., Miller, C.E., and Lyon, E. 2013. Triplet repeat primed PCR simplifies testing for Huntington disease. J. Mol. Diagn. 15:255‐262. doi: 10.1016/j.jmoldx.2012.09.005.
  Kartsaki, E., Spanaki, C., Tzagournissakis, M., Petsakou, A., Moschonas, N., Macdonald, M., and Plaitakis, A. 2006. Late‐onset and typical Huntington disease families from Crete have distinct genetic origins. Int. J. Mol. Med. 17:335‐346.
  Labbadia, J. and Morimoto, R.I. 2013. Huntington's disease: Underlying molecular mechanisms and emerging concepts. Trends Biochem. Sci. 38:378‐385. doi: 10.1016/j.tibs.2013.05.003.
  Li, J.L., Hayden, M.R., Warby, S.C., Durr, A., Morrison, P.J., Nance, M., Ross, C.A., Margolis, R.L., Rosenblatt, A., Squitieri, F., Frati, L., Gomez‐Tortosa, E., Garcia, C.A., Suchowersky, O., Klimek, M.L., Trent, R.J., McCusker, E., Novelletto, A., Frontali, M., Paulsen, J.S., Jones, R., Ashizawa, T., Lazzarini, A., Wheeler, V.C., Prakash, R., Xu, G., Djousse, L., Mysore, J.S., Gillis, T., Hakky, M., Cupples, L.A., Saint‐Hilaire, M.H., Cha, J.H., Hersch, S.M., Penney, J.B., Harrison, M.B., Perlman, S.L., Zanko, A., Abramson, R.K., Lechich, A.J., Duckett, A., Marder, K., Conneally, P.M., Gusella, J.F., MacDonald, M.E., and Myers, R.H. 2006. Genome‐wide significance for a modifier of age at neurological onset in Huntington's disease at 6q23‐24: The HD MAPS study. BMC Med. Genet. 7:71.
  Margolis, R.L. and Ross, C.A. 2003. Diagnosis of Huntington disease. Clin. Chem. 49:1726‐1732. doi: 10.1373/49.10.1726.
  McNeil, S.M., Novelletto, A., Srinidhi, J., Barnes, G., Kornbluth, I., Altherr, M.R., Wasmuth, J.J., Gusella, J.F., MacDonald, M.E., and Myers, R.H. 1997. Reduced penetrance of the Huntington's disease mutation. Hum. Mol. Genet. 6:775‐779. doi: 10.1093/hmg/6.5.775.
  Moutou, C., Gardes, N., and Viville, S. 2004. New tools for preimplantation genetic diagnosis of Huntington's disease and their clinical applications. Eur. J. Hum. Genet. 12:1007‐1014. doi: 10.1038/sj.ejhg.5201291.
  Myers, R.H. 2004. Huntington's disease genetics. NeuroRx 1:255‐262. doi: 10.1602/neurorx.1.2.255.
  Nance, M.A. and Myers, R.H. 2001. Juvenile onset Huntington's disease–clinical and research perspectives. Ment. Retard. Dev. Disabil. Res. Rev. 7:153‐157. doi: 10.1002/mrdd.1022.
  Pecheux, C., Mouret, J.F., Durr, A., Agid, Y., Feingold, J., Brice, A., Dode, C., and Kaplan, J.C. 1995. Sequence analysis of the CCG polymorphic region adjacent to the CAG triplet repeat of the HD gene in normal and HD chromosomes. J. Med. Genet. 32:399‐400. doi: 10.1136/jmg.32.5.399.
  Potter, N.T., Spector, E.B., and Prior, T.W. 2004. Technical standards and guidelines for Huntington disease testing. Genet. Med. 6:61‐65. doi: 10.1097/01.GIM.0000106165.74751.15.
  Pramanik, S., Basu, P., Gangopadhaya, P.K., Sinha, K.K., Jha, D.K., Sinha, S., Das, S.K., Maity, B.K., Mukherjee, S.C., Roychoudhuri, S., Majumder, P.P., and Bhattacharyya, N.P. 2000. Analysis of CAG and CCG repeats in Huntingtin gene among HD patients and normal populations of India. Eur. J. Hum. Genet. 8:678‐682. doi: 10.1038/sj.ejhg.5200515.
  Rubinsztein, D.C., Leggo, J., Coles, R., Almqvist, E., Biancalana, V., Cassiman, J.J., Chotai, K., Connarty, M., Crauford, D., Curtis, A., Curtis, D., Davidson, M.J., Differ, A.M., Dode, C., Dodge, A., Frontali, M., Ranen, N.G., Stine, O.C., Sherr, M., Abbott, M.H., Franz, M.L., Graham, C.A., Harper, P.S., Hedreen, J.C., Jackson, A., Kaplan, J.‐C., Losekoot, M., MacMillan, J.C., Morrison, P., Trottier, Y., Novelletto, A., Simpson, S.A., Theilmann, J., Whittaker, J.L., Folstein, S.E., Ross, C.A., and Hayden, M.R. 1996. Phenotypic characterization of individuals with 30‐40 CAG repeats in the Huntington disease (HD) gene reveals HD cases with 36 repeats and apparently normal elderly individuals with 36‐39 repeats. Am. J. Hum. Genet. 59:16‐22.
  Semaka, A., Creighton, S., Warby, S., and Hayden, M.R. 2006. Predictive testing for Huntington disease: Interpretation and significance of intermediate alleles. Clin. Genet. 70:283‐294. doi: 10.1111/j.1399‐0004.2006.00668.x.
  Sermon, K., De Rijcke, M., Lissens, W., De Vos, A., Platteau, P., Bonduelle, M., Devroey, P., Van Steirteghem, A., and Liebaers, I. 2002. Preimplantation genetic diagnosis for Huntington's disease with exclusion testing. Eur. J. Hum. Genet.10:591‐598. doi: 10.1038/sj.ejhg.5200865.
  Squitieri, F., Maglione, V., Orobello, S., and Fornai, F. 2011. Genotype‐, aging‐dependent abnormal caspase activity in Huntington disease blood cells. J. Neural. Transm.118:1599‐1607. doi: 10.1007/s00702‐011‐0646‐1.
  Squitieri, F., Cannella, M., Gaudio, L., Martino, T., Maglione, V., Giallonardo, P., Simonelli, M., Simonelli, G., Mangeruga, D., Ciarmiello, A., and Pierelli, F. 2003. Italian Huntington disease patients–data and tissue bank. Neurol. Sci.24:215‐216. doi: 10.1007/s10072‐003‐0137‐8.
  Warby, S.C., Graham, R.K., and Hayden, M.R. 1993. Huntington Disease. In GeneReviews(R) (R.A. Pagon, M.P. Adam, H.H. Ardinger, S.E. Wallace, A. Amemiya, L.J.H. Bean, T.D. Bird, C.R. Dolan, C.T. Fong, R.J.H. Smith, and K. Stephens, eds.). Seattle (WA).
  Wexler, N.S., Lorimer, J., Porter, J., Gomez, F., Moskowitz, C., Shackell, E., Marder, K., Penchaszadeh, G., Roberts, S.A., Gayan, J., Brocklebank, D., Cherny, S.S., Cardon, L.R., Gray, J., Dlouhy, S.R., Wiktorski, S., Hodes, M.E., Conneally, P.M., Penney, J.B., Gusella, J., Cha, J.H., Irizarry, M., Rosas, D., Hersch, S., Hollingsworth, Z., MacDonald, M., Young, A.B., Andresen, J.M., Housman, D.E., De Young, M.M., Bonilla, E., Stillings, T., Negrette, A., Snodgrass, S.R., Martinez‐Jaurrieta, M.D., Ramos‐Arroyo, M.A., Bickham, J., Ramos, J.S., Marshall, F., Shoulson, I., Rey, G.J., Feigin, A., Arnheim, N., Acevedo‐Cruz, A., Acosta, L., Alvir, J., Fischbeck, K., Thompson, L.M., Young, A., Dure, L., O'Brien, C.J., Paulsen, J., Brickman, A., Krch, D., Peery, S., Hogarth, P., Higgins, D.S., Jr., Landwehrmeyer, B., and Project, U.S.‐V.C.R. 2004. Venezuelan kindreds reveal that genetic and environmental factors modulate Huntington's disease age of onset. Proc. Natl. Acad. Sci. U. S. A. 101:3498‐3503. doi: 10.1073/pnas.0308679101.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library