Molecular Analysis of Gene Rearrangements and Mutations in Acute Leukemias and Myeloid Neoplasms

Lynette M. Sholl1, Janina Longtine2, Frank C. Kuo1

1 Brigham and Women's Hospital, Boston, Massachusetts, 2 Yale University, New Haven, Connecticut
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 10.4
DOI:  10.1002/cphg.31
Online Posting Date:  January, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

A subset of acute leukemias and other myeloid neoplasms contains specific genetic alterations, many of which are associated with unique clinical and pathologic features. These alterations include chromosomal rearrangements leading to oncogenic fusion proteins or alteration of gene expression by juxtaposing oncogenes to enhancer elements, as well as mutations leading to aberrant activation of a variety of proteins critical to hematopoietic progenitor cell proliferation and differentiation. Molecular analysis is central to diagnosis and clinical management of leukemias, permitting genetic confirmation of a clinical and histologic impression, providing prognostic and predictive information, and facilitating detection of minimal residual disease. This unit will outline approaches to the molecular diagnosis of the most frequent and clinically relevant genetic alterations in acute leukemias and myeloid neoplasms. © 2017 by John Wiley & Sons, Inc.

Keywords: leukemia; myeloid neoplasms; mutations; prognosis; rearrangements

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Detection of Chromosomal Translocations by Reverse PCR: t(9;22)(q34;q11.2) With BCR‐ABL1 Fusion
  • Alternate Protocol 1: Quantitative Reverse Transcriptase PCR (qRT‐PCR): t(9;22)(q34;q11.2) With BCR‐ABL1 Fusion
  • Alternate Protocol 2: Detection of Chromosomal Translocations by RT‐PCR of t(15;17)(q22;q21) With PML‐RARA Fusion
  • Basic Protocol 2: Detection of Gene Mutations by PCR: ABL1‐Resistance Mutations
  • Alternate Protocol 3: Detection of Point Mutations by PCR: KIT Mutation
  • Alternate Protocol 4: Detection of Mutations by PCR: FLT3‐ITD and D835 Mutation
  • Alternate Protocol 5: Detection of Insertions/Deletions by PCR: NPM1 Mutation
  • Alternate Protocol 6: Targeted Mutation Analysis: JAK2 V617F Mutation Detection BY ARMS
  • Support Protocol 1: RNA Isolation Using Trizol Reagent
  • Support Protocol 2: Creating Standards for Quantitative PCR: BCR‐ABL1
  • Basic Protocol 3: Detection of Mutations by Next‐Generation‐Sequencing Based Panel
  • Reagents and Solutions
  • Commentary
  • Acknowledgments
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Detection of Chromosomal Translocations by Reverse PCR: t(9;22)(q34;q11.2) With BCR‐ABL1 Fusion

  Materials
  • Bone marrow or blood samples
  • 5× reverse transcriptase buffer (Invitrogen or see recipe)
  • Diethylpyrocarbonate (DEPC)‐treated water ( appendix 2D)
  • 2.5 mM deoxynucleotide triphosphate (dNTP) mix (2.5 mM each dATP, dCTP, dGTP, and dTTP; see recipe)
  • 0.1 M dithiothreitol (DTT)
  • Ribonuclease inhibitor (recombinant RNasin; Promega)
  • 10 μM primer solutions (see Fig.  for primer sequences; see Tables 10.4.2 and 10.4.3 for first‐ and second‐round PCR primers used)
  • 200 U/μl reverse transcriptase (SuperScript, RNase H; Thermo Fisher Scientific, Invitrogen brand)
  • 10× PCR amplification buffer (Thermo Fisher Scientific, Applied Biosystems brand or see recipe)
  • 25 mM MgCl 2 (Thermo Fisher Scientific, Applied Biosystems brand)
  • 10% (v/v) formamide
  • 5 U/μl Taq DNA polymerase (Thermo Fisher Scientific, Applied Biosystems brand)
  • 2.5% agarose gel containing 0.5 μg/ml ethidium bromide (prepared with TBE buffer; unit 2.7; Jarcho, )
  • PCR tubes
  • 95°C water baths
  • Thermal cycler
  • Additional reagents and equipment for isolating RNA by the TRIzol method ( protocol 9) and agarose gel electrophoresis (unit 2.7; Jarcho, )
Table 0.4.2   MaterialsFirst‐Round PCR Master Mix for t(9;22) and t(15;17) AssaysSecond‐Round PCR Master Mix for t(9;22) and t(15;17) Assays

t(9;22) assay a t(15;17) assay b
Reaction component Control (μl) Fusion (μl) Control (μl) Intron 3 (μl) Intron/exon 6 (μl)
10 μM primer 1 2 2 1.5 1.5 1.5
10 μM primer 2 2 2
10 μM primer 3 2 2
10 μM primer 4 2 2
10 μM primer 5 2
10× PCR buffer 5 5 5 5 5
25 mM MgCl 2 3 3 3 3 3
Water 18.25 18.25 20.25 15.25 20.25
10% formamide 5
5 U/μl Taq polymerase 0.25 0.25 0.25 0.25 0.25
t(9;22) assay a t(15;17) assay b
Reaction component Control (μl) Fusion (μl) Control (μl) Intron 3 (μl) Intron/exon 6 (μl)
10 μM primer 2 2
10 μM primer 5 2
10 μM primer 6 2 2 2 2
10 μM primer 7 2 2
10 μM primer 8 2 2
10 μM primer 9 2
10× PCR buffer 5 5 5 5 5
2.5 mM MgCl 2 3 3 3 3 3
2.5 mM dNTP mix 4 4 4 4 4
Water 23.75 21.75 23.75 18.75 23.75
10% formamide 5
5 U/μl Taq polymerase 0.25 0.25 0.25 0.25 0.25

 aSee Figure for t(9;22) assay primer sequences.
 bSee Figure for t(15;17) assay primer sequences.
Table 0.4.3   MaterialsFirst‐Round PCR Master Mix for t(9;22) and t(15;17) AssaysSecond‐Round PCR Master Mix for t(9;22) and t(15;17) Assays

t(9;22) assay a t(15;17) assay b
Reaction component Control (μl) Fusion (μl) Control (μl) Intron 3 (μl) Intron/exon 6 (μl)
10 μM primer 1 2 2 1.5 1.5 1.5
10 μM primer 2 2 2
10 μM primer 3 2 2
10 μM primer 4 2 2
10 μM primer 5 2
10× PCR buffer 5 5 5 5 5
25 mM MgCl 2 3 3 3 3 3
Water 18.25 18.25 20.25 15.25 20.25
10% formamide 5
5 U/μl Taq polymerase 0.25 0.25 0.25 0.25 0.25
t(9;22) assay a t(15;17) assay b
Reaction component Control (μl) Fusion (μl) Control (μl) Intron 3 (μl) Intron/exon 6 (μl)
10 μM primer 2 2
10 μM primer 5 2
10 μM primer 6 2 2 2 2
10 μM primer 7 2 2
10 μM primer 8 2 2
10 μM primer 9 2
10× PCR buffer 5 5 5 5 5
2.5 mM MgCl 2 3 3 3 3 3
2.5 mM dNTP mix 4 4 4 4 4
Water 23.75 21.75 23.75 18.75 23.75
10% formamide 5
5 U/μl Taq polymerase 0.25 0.25 0.25 0.25 0.25

 aSee Figure for t(9;22) assay primer sequences.
 bSee Figure for t(15;17) assay primer sequences.
NOTE: Experiments involving PCR and RNA require extremely careful technique to prevent contamination and RNA degradation; see appendix 2D.CAUTION: Diethylpyrocarbonate (DEPC) is a suspected carcinogen and should be handled carefully.

Alternate Protocol 1: Quantitative Reverse Transcriptase PCR (qRT‐PCR): t(9;22)(q34;q11.2) With BCR‐ABL1 Fusion

  Additional Materials (also see protocol 1)
  • 10 μM primers (see primer sequences in Table 10.4.4)
  • TaqMan RNA‐to‐CT 1‐Step kit (Thermo Fisher Scientific, Applied Biosystems brand, cat. no. 4392938) including:
    • 2× Master Mix with dUTP
    • 40× ArrayScript UP Reverse Transcriptase and RNase Inhibitor Mix
    • 5 μM TaqMan Minor Groove Binding (MGB) Probe (Thermo Fisher Scientific, Applied Biosystems brand, cat. no. 4316034; see probe sequences in Table 10.4.4)
  • Optical 96‐well reaction plates
  • Optical caps or optical adhesive plate covers
  • ABI Sequence Detection System (7000 or 7900)
  • Centrifuge with 96‐well plate adaptor
Table 0.4.4   Additional Materials (also see protocol 1)Primer and Probe Sequences for qRT‐PCR for the BCR‐ABL1 Fusion Transcript

Name Sequence
BCR‐ABL1 qRT‐PCR primer sequences
BCR exon B3 Forward primer 5′ CAGCCACTGGATTTAAGCAGAGT 3′
BCR exon B2 Forward primer 5′ CGCTGACCATCAATAAGGAAGAA 3′
ABL1 exon 2 Reverse primer 5′ CTGGGACTCCGAGTTTCAGTC 3′
GUS Forward primer 5′ ATTTTGCCCGATTTCATGACTGA 3′
GUS Reverse primer 5′ GCTCACTTCTAGGGGAAAAAT AAG 3′
BCR‐ABL1 qRT‐PCR probe sequences
ABL1 exon 2 (common) 5′ CCTTCAGCGGCCAGTAG 3′
GUS 5′ CAGTCACCGACGAGAGT 3′

Alternate Protocol 2: Detection of Chromosomal Translocations by RT‐PCR of t(15;17)(q22;q21) With PML‐RARA Fusion

  Additional Materials (also see protocol 1)
  • 10 μM t(15;17) primers (Fig.  )
  • 18 μl sample and control reverse transcriptase (RT) products ( protocol 1, steps 1 through 4)

Basic Protocol 2: Detection of Gene Mutations by PCR: ABL1‐Resistance Mutations

  Materials
  • RNA sample and controls
  • 10× PCR amplification buffer (Thermo Fisher Scientific, Applied Biosystems brand or see recipe)
  • 25 mM MgCl 2 (Thermo Fisher Scientific, Applied Biosystems brand)
  • 2.5 mM deoxynucleotide triphosphate (dNTP) mix (2.5 mM each dATP, dCTP, dGTP, and dTTP; see recipe)
  • First‐ and second‐round BCR‐ABL1 PCR primers (see Table 10.4.6)
  • Taq DNA polymerase
  • 2.5% agarose gel prepared in TBE buffer (see unit 2.7; Jarcho, )
  • 10 mM BigDye v3.1 (ABI)
  • 10 μM primers (Table 10.4.6)
  • Diethylpyrocarbonate (DEPC)‐treated water ( appendix 2D)
  • 3 M sodium acetate ( appendix 2D)
  • 100% ethanol
  • 70% ethanol
  • 100% isopropanol
  • HI DI formamide (ABI)
  • 0.2‐ml PCR tubes, individual or strips of 8, or 96‐well plate
  • Thermal cycler
  • 3130 × l POP7 Genetic Analyzer (ABI) and capillary electrophoresis (CE) tubes
  • Centrifuge with 96‐well plate adaptor
  • Additional reagents and equipment for reverse transcription ( protocol 1, steps 1 to 4) and agarose gel electrophoresis (unit 2.7; Jarcho, )
Table 0.4.6   MaterialsNested PCR and Sequencing Primers for BCR‐ABL Mutation Analysis

BCR‐ABL1 PCR (1st reaction)
BCR Exon B2 Forward 5′ACAGCATTCCGCTGACCAT 3′
ABL1 kinase domain (KD) Reverse 5′ TCCACTTCGTCTGAGATACTGGATT 3′
Nested ABL1 PCR 1
ABL1‐KD‐M13 Forward 5′ TGTAAAACGACGGCCAGTCGCAACAAGCCCACTGTCT 3′
ABL1‐KD‐M13 Reverse 5′ CAGGAAACAGCTATGACCGCTGTGTAGGTGTCCCCTGT 3′
Nested ABL1 PCR 2
ABL1‐KD‐M13‐2 Forward 5′ TGTAAAACGACGGCCAGTGCTGATTTTGGCCTGAGCAG 3′
ABL1‐KD‐M13‐2 Reverse 5′ CAGGAAACAGCTATGACCTCCACTTCGTCTGAGATACTGGATT 3′
Sequencing primers
M13 Forward 5′ TGTAAAACGACGGCCAGT 3′
M13 Reverse 5′ CAGGAAACAGCTATGAC C3′

Alternate Protocol 3: Detection of Point Mutations by PCR: KIT Mutation

  Additional Materials (also see protocol 4)
  • DNA sample
  • 10 μM KIT primers (see Table 10.4.8)
Table 0.4.8   Additional Materials (also see protocol 4)KIT PCR Primers

KIT intron 16 Forward 5′ GGTTTTCTTTTCTCCTCCAACC 3′
KIT intron 17 Reverse 5′ TGCAGGACTGTCAAGCAGAG 3′
KIT exon 17 mutant Forward 5′ GATTTTGGTCTAGCCAGCGT 3′

Alternate Protocol 4: Detection of Mutations by PCR: FLT3‐ITD and D835 Mutation

  Additional Materials (also see protocol 4)
  • 10 μM FLT3 primers (see Table 10.4.9)
  • Sample DNA
  • NEBuffer 3 (New England Biolabs)
  • 10× BSA (New England Biolabs)
  • EcoRV restriction enzyme (New England Biolabs)
Table 0.4.9   Additional Materials (also see protocol 4)FLT3 PCR Primers

FLT3‐ITD‐FAM Forward 5′ 6‐FAM‐GCAATTTAGGTATGAAAGCCAGC 3′ (light sensitive)
FLT3‐ITD‐HEX Reverse 5′‐HEX‐CTTTCAGCATTTTGACGGCAACC 3′ (light sensitive)
FLT‐D835‐TET Forward 5′‐TET‐GTAAAACGACGGCCAGCCGCCAGGAACGTGCTTG 3′(light sensitive)
FLT‐D835 Reverse 5′CAGGAAACAGCTATGACGATATCAGCCTCACATTGCCCC 3′

Alternate Protocol 5: Detection of Insertions/Deletions by PCR: NPM1 Mutation

  Additional Materials (also see protocol 4)
  • NPM1 primers (see Table 10.4.11)
  • Sample DNA
Table 0.4.1   Additional Materials (also see protocol 4)NPM1 PCR primers

NPM1‐M13 Forward 5′ CAGGAAACAGCTATGACCAGGGCAGGGACATTCTCATA 3′
NPM1‐M13 Reverse 5′ TGTAAAACGACGGCCAGTCTATGAAGTGTTGTGGTTCC 3′

Alternate Protocol 6: Targeted Mutation Analysis: JAK2 V617F Mutation Detection BY ARMS

  Additional Materials (also see protocol 4)
  • JAK2 PCR primers (see Table 10.4.12)
Table 0.4.2   Additional Materials (also see protocol 4)JAK2 PCR Primers

JAK2 outer Forward 5′ CAGGCTTACACAGGGGTTTC 3′
JAK2 outer‐FAM Reverse 5′‐FAM‐ATTGCTTTCCTTTTTCACAAGAT 3′ (light‐sensitive)
JAK2 WT Forward 5′ GCATTTGGTTTTAAATTATGGAGTATATG 3′
JAK2 mutant‐FAM Reverse 5′‐FAM‐GTTTTACTTACTCTCGTCTCCACAAAA 3′ (light‐sensitive)

Support Protocol 1: RNA Isolation Using Trizol Reagent

  Materials
  • Patient samples: whole blood, bone marrow, cerebrospinal fluid (CSF), or proficiency testing samples
  • Puregene RBC Lysis solution (Qiagen, cat. no. 158904)
  • PBS ( appendix 2D)
  • TRIzol Reagent (Thermo Fisher Scientific, cat. no. 15596026; store at 2° to 8°C)
  • Chloroform
  • 100% isopropanol
  • 70% and 80% ethanol (in DEPC‐treated water)
  • Nuclease‐free (e.g., DEPC‐treated) H 2O
  • RNase‐Free DNase set (Qiagen, cat. no. 79254) including:
    • Buffer RDD
    • DNase I stock solution
    • Nuclease‐free H 2O
  • RNeasy MinElute Clean up kit (Qiagen) including:
    • Buffer RLT
    • Buffer RPE
    • RNeasy MinElute Spin columns
  • 15‐ and 50‐ml conical centrifuge tubes
  • Beckman Allegra 6R tabletop centrifuge
  • NanoDrop 1000 spectrophotometer ( appendix 3D)
  • Additional reagents and equipment for determination of RNA concentration using the NanoDrop spectrophotometer ( appendix 3D)

Support Protocol 2: Creating Standards for Quantitative PCR: BCR‐ABL1

  Materials
  • 10 mg/ml yeast tRNA (Thermo Fisher Scientific, Ambion brand, cat. no. AM7119)
  • Diethylpyrocarbonate (DEPC)‐treated water ( appendix 2D)
  • 400 ng/μl negative RNA (InVivoScribe, cat. no. 4‐089‐3070)
  • 400 ng/μl B3A2 RNA (InVivoScribe, cat. no. 4‐089‐0910)
  • 400 ng/μl B2A2 RNA (InVivoScribe, cat. no. 4‐089‐0190)
  • Additional reagents and equipment for spectrophotometric determination of RNA concentration ( appendix 3D)

Basic Protocol 3: Detection of Mutations by Next‐Generation‐Sequencing Based Panel

  Materials
  • DNA sample and controls
  • Illumina Truseq Custom Amplicon kit (Illumina, cat. no. FC‐130‐1001)
  • Custom Amplicon oligo tube (CAT, separately designed according to the genes to be included in the panel)
  • Oligo Hybridization for Sequencing 2 (OHS2)
  • VWR Ultrapure water (VWR, cat. no. RLMB‐009‐4000)
  • Stringent Wash 1 (SW1)
  • Universal Buffer 1 (UB1)
  • Extension‐Ligation Mix 4 (ELM4)
  • Illumina Truseq Custom Amplicon Index kit (Illumina, cat. no. FC‐130‐1003)
  • PCR master mix 2 (PMM2)
  • i5 primers (A5XX)
  • i7 primers (A7XX)
  • TruSeq DNA Polymerase 1 (TDP1)
  • 50 mM sodium hydroxide (freshly made; diluted from 10 N sodium hydroxide)
  • Elution buffer with Tris (EBT)
  • AMPure XP beads (Thermo Fisher Scientific, cat. no. NC9933872)
  • 80% ethanol (freshly prepared, 7 ml for 16 samples)
  • Hybridization buffer (HT1)
  • Illumina MiSeq kits V2 (300 cycles; Illumina, cat. no. MA‐102‐2002)
  • Nanodrop 100 Spectrophotometer
  • 1.5‐ml Eppendorf tubes
  • 95oC heat block
  • Eppendorf microcentrifuge
  • Illumina Truseq Index Plate Fixture kit (Illumina, cat. no. FC‐130‐1005)
  • Illumina Truseq Custom Amplicon Filter plate (Illumina, cat. no. FC‐130‐1006)
  • Illumina Truseq Index Plate Fixture and Collar kit (Illumina, cat. no. FC‐130‐1007)
  • Filter Plate with lid
  • Adapter collar (reusable)
  • Adhesive aluminum foil seal (Thermo Fisher Scientific, cat. no. NC9212509)
  • Table top centrifuge with plate adaptors
  • Incubator (37oC)
  • Bio‐Rad Microseal A (Bio‐Rad, cat. no. MSA‐5001)
  • 8‐well strip PCR tubes
  • Thermal cycler
  • Qubit fluorometer (Thermo Fisher Scientific)
  • 96‐well MIDI plates
  • Eppendorf tubes
  • 15‐ml Falcon tube
  • Eppendorf microcentrifuge
  • Dynamag magnet stand, 16 place or 96 well (Thermo Fisher Scientific, cat. no. 12321D or 12331D)
  • Additional reagents and equipment for reverse transcription ( protocol 1, steps 1 to 4) and agarose gel electrophoresis (unit 2.7; Jarcho, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

  Akin, C. 2006. Molecular diagnosis of mast cell disorders: A paper from the 2005 William Beaumont Hospital Symposium on Molecular Pathology. J. Mol. Diagn. 8:412‐419. doi: 10.2353/jmoldx.2006.060022.
  Arber, D.A., Orazi, A., Hasserjian, R., Thiele, J., Borowitz, M.J., Le Beau, M.M., Bloomfield, C.D., Cazzola, M., and Vardiman, J.W. 2016. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood 127:2391‐2405. doi: 10.1182/blood‐2016‐03‐643544.
  Bassan, R., Spinelli, O., Oldani, E., Intermesoli, T., Tosi, M., Peruta, B., Rossi, G., Borlenghi, E., Pogliani, E.M., Terruzzi, E., Fabris, P., Cassibba, V., Lambertenghi‐Deliliers, G., Cortelezzi, A., Bosi, A., Gianfaldoni, G., Ciceri, F., Bernardi, M., Gallamini, A., Mattei, D., Di Bona, E., Romani, C., Scattolin, A.M., Barbui, T., and Rambaldi, A. 2009. Improved risk classification for risk‐specific therapy based on the molecular study of minimal residual disease (MRD) in adult acute lymphoblastic leukemia (ALL). Blood 113:4153‐4162. doi: 10.1182/blood‐2008‐11‐185132.
  Behdad, A., Weigelin, H.C., Elenitoba‐Johnson, K.S., and Betz, B.L. 2015. A clinical grade sequencing‐based assay for CEBPA mutation testing: Report of a large series of myeloid neoplasms. J. Mol. Diagn. 17:76‐84. doi: 10.1016/j.jmoldx.2014.09.007.
  Brisco, M.J., Latham, S., Sutton, R., Hughes, E., Wilczek, V., van Zanten, K., Budgen, B., Bahar, A.Y., Malec, M., Sykes, P.J., Kuss, B.J., Waters, K., Venn, N.C., Giles, J.E., Haber, M., Norris, M.D., Marshall, G.M., and Morley, A.A. 2009. Determining the repertoire of IGH gene rearrangements to develop molecular markers for minimal residual disease in B‐lineage acute lymphoblastic leukemia. J. Mol. Diagn. 11:194‐200. doi: 10.2353/jmoldx.2009.080047.
  Cavé, H., van der Werff ten Bosch, J., Suciu, S., Guidal, C., Waterkeyn, C., Otten, J., Bakkus, M., Thielemans, K., Grandchamp, B., and Vilmer, E., for the European Organization for Research and Treatment of Cancer—Childhood Leukemia Cooperative Group. 1998. Clinical significance of minimal residual disease in childhood acute lymphoblastic leukemia. N. Engl. J. Med. 339:591‐598. doi: 10.1056/NEJM199808273390904.
  Chaturvedi, A., Araujo Cruz, M.M., Jyotsana, N., Sharma, A., Yun, H., Görlich, K., Wichmann, M., Schwarzer, A., Preller, M., Thol, F., Meyer, J., Haemmerle, R., Struys, E.A., Jansen, E.E., Modlich, U., Li, Z., Sly, L.M., Geffers, R., Lindner, R., Manstein, D.J., Lehmann, U., Krauter, J., Ganser, A., and Heuser, M. 2013. Mutant IDH1 promotes leukemogenesis in vivo and can be specifically targeted in human AML. Blood 122:2877‐2887. doi: 10.1182/blood‐2013‐03‐491571.
  Chronic Myeloid Leukemia Trialists’ Collaborative Group. 1997. Interferon alfa versus chemotherapy for chronic myeloid leukemia: A meta‐analysis of seven randomized trials. J. Natl. Cancer Inst. 89:1616‐1620. doi: 10.1093/jnci/89.21.1616.
  Coustan‐Smith, E., Ribeiro, R.C., Stow, P., Zhou, Y., Pui, C.H., Rivera, G.K., Pedrosa, F., and Campana, D. 2006. A simplified flow cytometric assay identifies children with acute lymphoblastic leukemia who have a superior clinical outcome. Blood 108:97‐102. doi: 10.1182/blood‐2006‐01‐0066.
  Druker, B.J., Sawyers, C.L., Kantarjian, H., Resta, D.J., Reese, S.F., Ford, J.M., Capdeville, R., and Talpaz, M. 2001a. Activity of a specific inhibitor of the BCR‐ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia and acute lymphoblastic leukemia with the Philadelphia chromosome. N. Engl. J. Med. 344:1038‐1042. doi: 10.1056/NEJM200104053441402.
  Druker, B.J., Talpaz, M., Resta, D.J., Peng, B., Buchdunger, E., Ford, J.M., Lydon, N.B., Kantarjian, H., Capdeville, R., Ohno‐Jones, S., and Sawyers, C.L. 2001b. Efficacy and safety of a specific inhibitor of the BCR‐ABL tyrosine kinase in chronic myeloid leukemia. N. Engl. J. Med. 344:1031‐1037. doi: 10.1056/NEJM200104053441401.
  Falini, B., Martelli, M.P., Bolli, N., Bonasso, R., Ghia, E., Pallotta, M.T., Diverio, D., Nicoletti, I., Pacini, R., Tabarrini, A., Galletti, B.V., Mannucci, R., Roti, G., Rosati, R., Specchia, G., Liso, A., Tiacci, E., Alcalay, M., Luzi, L., Volorio, S., Bernard, L., Guarini, A., Amadori, S., Mandelli, F., Pane, F., Lo‐Coco, F., Saglio, G., Pelicci, P.G., Martelli, M.F., and Mecucci, C. 2006. Immunohistochemistry predicts nucleophosmin (NPM) mutations in acute myeloid leukemia. Blood 108:1999‐2005. doi: 10.1182/blood‐2006‐03‐007013.
  Falini, B., Bolli, N., Liso, A., Martelli, M.P., Mannucci, R., Pileri, S., and Nicoletti, I. 2009. Altered nucleophosmin transport in acute myeloid leukaemia with mutated NPM1: Molecular basis and clinical implications. Leukemia 23:1731‐1743. doi: 10.1038/leu.2009.124.
  Fasan, A., Haferlach, C., Alpermann, T., Jeromin, S., Grossmann, V., Eder, C., Weissmann, S., Dicker, F., Kohlmann, A., Schindela, S., Kern, W., Haferlach, T., and Schnittger, S. 2014. The role of different genetic subtypes of CEBPA mutated AML. Leukemia 28:794‐803. doi: 10.1038/leu.2013.273.
  Goodwin, S., McPherson, J.D., and McCombie, W.R. 2016. Coming of age: Ten years of next‐generation sequencing technologies. Nat. Rev. Genet. 17:333‐351. doi: 10.1038/nrg.2016.49.
  Hindson, C.M., Chevillet, J.R., Briggs, H.A., Gallichotte, E.N., Ruf, I.K., Hindson, B.J., Vessella, R.L., and Tewari, M. 2013. Absolute quantification by droplet digital PCR versus analog real‐time PCR. Nat. Methods. 10:1003‐1005. doi: 10.1038/nmeth.2633.
  Hirt, C., Schuler, F., Kiefer, T., Schwenke, C., Haas, A., Niederwieser, D., Neser, S., Assmann, M., Srock, S., Rohrberg, R., Dachselt, K., Leithäuser, M., Rabkin, C.S., Herold, M., and Dölken, G. 2008. Rapid and sustained clearance of circulating lymphoma cells after chemotherapy plus rituximab: Clinical significance of quantitative t(14;18) PCR monitoring in advanced stage follicular lymphoma patients. Br. J. Haematol. 141:631‐640. doi: 10.1111/j.1365‐2141.2008.07101.x.
  Hochhaus, A., O'Brien, S.G., Guilhot, F., Druker, B.J., Branford, S., Foroni, L., Goldman, J.M., Müller, M.C., Radich, J.P., Rudoltz, M., Mone, M., Gathmann, I., Hughes, T.P., Larson, R.A., and IRIS Investigators. 2009. Six‐year follow‐up of patients receiving imatinib for the first‐line treatment of chronic myeloid leukemia. Leukemia 23:1054‐1061. doi: 10.1038/leu.2009.38.
  Hughes, T., Deininger, M., Hochhaus, A., Branford, S., Radich, J., Kaeda, J., Baccarani, M., Cortes, J., Cross, N.C., Druker, B.J., Gabert, J., Grimwade, D., Hehlmann, R., Kamel‐Reid, S., Lipton, J.H., Longtine, J., Martinelli, G., Saglio, G., Soverini, S., Stock, W., and Goldman, J.M. 2006. Monitoring CML patients responding to treatment with tyrosine kinase inhibitors: review and recommendations for harmonizing current methodology for detecting BCR‐ABL transcripts and kinase domain mutations and for expressing results. Blood 108:28‐37. doi: 10.1182/blood‐2006‐01‐0092.
  Jain, P., Kantarjian, H., Patel, K.P., Gonzalez, G.N., Luthra, R., Kanagal Shamanna, R., Sasaki, K., Jabbour, E., Romo, C.G., Kadia, T.M., Pemmaraju, N., Daver, N., Borthakur, G., Estrov, Z., Ravandi, F., O'Brien, S., and Cortes, J. 2016. Impact of BCR‐ABL transcript type on outcome in patients with chronic‐phase CML treated with tyrosine kinase inhibitors. Blood 127:1269‐1275 doi: 10.1182/blood‐2015‐10‐674242.
  Jarcho, J. 2001. Restriction fragment length polymorphism analysis. Curr. Protoc. Hum. Genet. 1:2.7.1‐2.7.15. doi: 10.1002/0471142905.hg0207s01.
  Jeha, S., Pei, D., Raimondi, S.C., Onciu, M., Campana, D., Cheng, C., Sandlund, J.T., Ribeiro, R.C., Rubnitz, J.E., Howard, S.C., Downing, J.R., Evans, W.E., Relling, M.V., and Pui, C.H. 2009. Increased risk for CNS relapse in pre‐B cell leukemia with the t(1;19)/TCF3‐PBX1. Leukemia 23:1406‐1409. doi: 10.1038/leu.2009.42.
  Jones, A.V., Kreil, S., Zoi, K., Waghorn, K., Curtis, C., Zhang, L., Score, J., Seear, R., Chase, A.J., Grand, F.H., White, H., Zoi, C., Loukopoulos, D., Terpos, E., Vervessou, E.C., Schultheis, B., Emig, M., Ernst, T., Lengfelder, E., Hehlmann, R., Hochhaus, A., Oscier, D., Silver, R.T., Reiter, A., and Cross, N.C. 2005. Widespread occurrence of the JAK2 V617F mutation in chronic myeloproliferative disorders. Blood 106:2162‐2168. doi: 10.1182/blood‐2005‐03‐1320.
  Klampfl, T., Gisslinger, H., Harutyunyan, A.S., Nivarthi, H., Rumi, E., Milosevic, J.D., Them, N.C., Berg, T., Gisslinger, B., Pietra, D., Chen, D., Vladimer, G.I., Bagienski, K., Milanesi, C., Casetti, I.C., Sant'Antonio, E., Ferretti, V., Elena, C., Schischlik, F., Cleary, C., Six, M., Schalling, M., Schönegger, A., Bock, C., Malcovati, L., Pascutto, C., Superti‐Furga, G., Cazzola, M., and Kralovics, R. 2013. Somatic mutations of calreticulin in myeloproliferative neoplasms. N. Engl. J. Med. 369:2379‐2390. doi: 10.1056/NEJMoa1311347.
  Leroy, H., Roumier, C., Huyghe, P., Biggio, V., Fenaux, P., and Preudhomme, C. 2005. CEBPA point mutations in hematological malignancies. Leukemia 19:329‐334. doi: 10.1038/sj.leu.2403614.
  Levis, M. and Small, D. 2003. FLT3: ITDoes matter in leukemia. Leukemia 17:1738‐1752. doi: 10.1038/sj.leu.2403099.
  Maurer, J., Kinzel, H., Nentwig, T., and Thiel, E. 1990. Molecular diagnosis of the Philadelphia chromosome in chronic myelogenous and acute lymphoblastic leukemias by PCR. Dis. Markers 8:211‐218.
  Mauro, M.J. and Deininger, M.W. 2006. Chronic myeloid leukemia in 2006: A perspective. Haematologica 91:152.
  Melnick, A. and Licht, J.D. 1999. Deconstructing a disease: RARalpha, its fusion partners, and their roles in the pathogenesis of acute promyelocytic leukemia. Blood 93:3167‐3215.
  Moorman, A.V., Richards, S.M., Robinson, H.M., Strefford, J.C., Gibson, B.E., Kinsey, S.E., Eden, T.O., Vora, A.J., Mitchell, C.D., and Harrison, C.J., on behalf of the UK Medical Research Council (MRC)/National Cancer Research Institute (NCRI) Childhood Leukaemia Working Party (CLWP). 2007. Prognosis of children with acute lymphoblastic leukemia (ALL) and intrachromosomal amplification of chromosome 21 (iAMP21). Blood 109:2327‐2330. doi: 10.1182/blood‐2006‐08‐040436.
  Murphy, K.M., Levis, M., Hafez, M.J., Geiger, T., Cooper, L.C., Smith, B.D., Small, D., and Berg, K.D. 2003. Detection of FLT3 internal tandem duplication and D835 mutations by a multiplex polymerase chain reaction and capillary electrophoresis assay. J. Mol. Diagn. 5:96‐102. doi: 10.1016/S1525‐1578(10)60458‐8.
  Nangalia, J., Massie, C.E., Baxter, E.J., Nice, F.L., Gundem, G., Wedge, D.C., Avezov, E., Li, J., Kollmann, K., Kent, D.G., Aziz, A., Godfrey, A.L., Hinton, J., Martincorena, I., Van Loo, P., Jones, A.V., Guglielmelli, P., Tarpey, P., Harding, H.P., Fitzpatrick, J.D., Goudie, C.T., Ortmann, C.A., Loughran, S.J., Raine, K., Jones, D.R., Butler, A.P., Teague, J.W., O”Meara, S., McLaren, S., Bianchi, M., Silber, Y., Dimitropoulou, D., Bloxham, D., Mudie, L., Maddison, M., Robinson, B., Keohane, C., Maclean, C., Hill, K., Orchard, K., Tauro, S., Du, M.Q., Greaves, M., Bowen, D., Huntly, B.J., Harrison, C.N., Cross, N.C., Ron, D., Vannucchi, A.M., Papaemmanuil, E., Campbell, P.J., and Green, A.R. 2013. Somatic CALR mutations in myeloproliferative neoplasms with nonmutated JAK2. N. Engl. J. Med. 369:2391‐2405. doi: 10.1056/NEJMoa1312542.
  Ortmann, C.A., Kent, D.G., Nangalia, J., Silber, Y., Wedge, D.C., Grinfeld, J., Baxter, E.J., Massie, C.E., Papaemmanuil, E., Menon, S., Godfrey, A.L., Dimitropoulou, D., Guglielmelli, P., Bellosillo, B., Besses, C., Döhner, K., Harrison, C.N., Vassiliou, G.S., Vannucchi, A., Campbell, P.J., and Green, A.R. 2015. Effect of mutation order on myeloproliferative neoplasms. N. Engl. J. Med. 372:601‐612. doi: 10.1056/NEJMoa1412098.
  Pabst, T., Mueller, B.U., Zhang, P., Radomska, H.S., Narravula, S., Schnittger, S., Behre, G., Hiddemann, W., and Tenen, D.G. 2001. Dominant‐negative mutations of CEBPA, encoding CCAAT/enhancer binding protein‐α (C/EBPα), in acute myeloid leukemia. Nat. Genet. 27:263‐270. doi: 10.1038/85820.
  Pandolfi, P.P., Alcalay, M., Fagioli, M., Zangrilli, D., Mencarelli, A., Diverio, D., Biondi, A., Lo Coco, F., Rambaldi, A., and Grignani, F. 1992. Genomic variability and alternative splicing generate multiple PML/RAR alpha transcripts that encode aberrant PML proteins and PML/RAR alpha isoforms in acute promyelocytic leukaemia. EMBO J. 11:1397‐1407.
  Papaemmanuil, E., Gerstung, M., Bullinger, L., Gaidzik, V.I., Paschka, P., Roberts, N.D., Potter, N.E., Heuser, M., Thol, F., Bolli, N., Gundem, G., Van Loo, P., Martincorena, I., Ganly, P., Mudie, L., McLaren, S., O'Meara, S., Raine, K., Jones, D.R., Teague, J.W., Butler, A.P., Greaves, M.F., Ganser, A., Döhner, K., Schlenk, R.F., Döhner, H., and Campbell, P.J. 2016. Genomic classification and prognosis in acute myeloid leukemia. N. Engl. J. Med. 374:2209‐2221. doi: 10.1056/NEJMoa1516192.
  Pasqualucci, L., Liso, A., Martelli, M.P., Bolli, N., Pacini, R., Tabarrini, A., Carini, M., Bigerna, B., Pucciarini, A., Mannucci, R., Nicoletti, I., Tiacci, E., Meloni, G., Specchia, G., Cantore, N., Di Raimondo, F., Pileri, S., Mecucci, C., Mandelli, F., Martelli, M.F., and Falini, B. 2006. Mutated nucleophosmin detects clonal multilineage involvement in acute myeloid leukemia: Impact on WHO classification. Blood 108:4146‐4155. doi: 10.1182/blood‐2006‐06‐026716.
  Ponziani, V., Gianfaldoni, G., Mannelli, F., Leoni, F., Ciolli, S., Guglielmelli, P., Antonioli, E., Longo, G., Bosi, A., and Vannucchi, A.M. 2006. The size of duplication does not add to the prognostic significance of FLT3 internal tandem duplication in acute myeloid leukemia patients. Leukemia 20:2074‐2076. doi: 10.1038/sj.leu.2404368.
  Preudhomme, C., Revillion, F., Merlat, A., Hornez, L., Roumier, C., Duflos‐Grardel, N., Jouet, J.P., Cosson, A., Peyrat, J.P., and Fenaux, P. 1999. Detection of BCR‐ABL transcripts in chronic myeloid leukemia (CML) using a ‘real time’ quantitative RT‐PCR assay. Leukemia 13:957‐964. doi: 10.1038/sj.leu.2401426.
  Pulsipher, M.A., Carlson, C., Langholz, B., Wall, D.A., Schultz, K.R., Bunin, N., Kirsch, I., Gastier‐Foster, J.M., Borowitz, M., Desmarais, C., Williamson, D., Kalos, M., and Grupp, S.A. 2015. IgH‐V(D)J NGS‐MRD measurement pre‐ and early post‐allotransplant defines very low‐ and very high‐risk ALL patients. Blood 125:3501‐3508. doi: 10.1182/blood‐2014‐12‐615757.
  Renneville, A., Roumier, C., Biggio, V., Nibourel, O., Boissel, N., Fenaux, P., and Preudhomme, C. 2008. Cooperating gene mutations in acute myeloid leukemia: A review of the literature. Leukemia 22:915‐931. doi: 10.1038/leu.2008.19.
  Roberts, K.G., Li, Y., Payne‐Turner, D., Harvey, R.C., Yang, Y.L., Pei, D., McCastlain, K., Ding, L., Lu, C., Song, G., Ma, J., Becksfort, J., Rusch, M., Chen, S.C., Easton, J., Cheng, J., Boggs, K., Santiago‐Morales, N., Iacobucci, I., Fulton, R.S., Wen, J., Valentine, M., Cheng, C., Paugh, S.W., Devidas, M., Chen, I.M., Reshmi, S., Smith, A., Hedlund, E., Gupta, P., Nagahawatte, P., Wu, G., Chen, X., Yergeau, D., Vadodaria, B., Mulder, H., Winick, N.J., Larsen, E.C., Carroll, W.L., Heerema, N.A., Carroll, A.J., Grayson, G., Tasian, S.K., Moore, A.S., Keller, F., Frei‐Jones, M., Whitlock, J.A., Raetz, E.A., White, D.L., Hughes, T.P., Guidry Auvil, J.M., Smith, M.A., Marcucci, G., Bloomfield, C.D., Mrózek, K., Kohlschmidt, J., Stock, W., Kornblau, S.M., Konopleva, M., Paietta, E., Pui, C.H., Jeha, S., Relling, M.V., Evans, W.E., Gerhard, D.S., Gastier‐Foster, J.M., Mardis, E., Wilson, R.K., Loh, M.L., Downing, J.R., Hunger, S.P., Willman, C.L., Zhang, J., and Mullighan, C.G. 2014. Targetable kinase‐activating lesions in Ph‐like acute lymphoblastic leukemia. N. Engl. J. Med. 371:1005‐1015. doi: 10.1056/NEJMoa1403088.
  Schlenk, R.F., Dohner, K., Krauter, J., Fröhling, S., Corbacioglu, A., Bullinger, L., Habdank, M., Späth, D., Morgan, M., Benner, A., Schlegelberger, B., Heil, G., Ganser, A., and Döhner, H., and German‐Austrian Acute Myeloid Leukemia Study Group. 2008. Mutations and treatment outcome in cytogenetically normal acute myeloid leukemia. N. Engl. J. Med. 358:1909‐1918. doi: 10.1056/NEJMoa074306.
  Schnittger, S., Schoch, C., Kern, W., Mecucci, C., Tschulik, C., Martelli, M.F., Haferlach, T., Hiddemann, W., and Falini, B. 2005. Nucleophosmin gene mutations are predictors of favorable prognosis in acute myelogenous leukemia with a normal karyotype. Blood 106:3733‐3739. doi: 10.1182/blood‐2005‐06‐2248.
  Schnittger, S., Kohl, T.M., Haferlach, T., Kern, W., Hiddemann, W., Spiekermann, K., and Schoch, C. 2006. KIT‐D816 mutations in AML1‐ETO‐positive AML are associated with impaired event‐free and overall survival. Blood 107:1791‐1799. doi: 10.1182/blood‐2005‐04‐1466.
  Schumacher, J.A., Elenitoba‐Johnson, K.S., and Lim, M.S. 2008. Detection of the c‐kit D816V mutation in systemic mastocytosis by allele‐specific PCR. J. Clin. Pathol. 61:109‐114. doi: 10.1136/jcp.2007.047928.
  Shah, N.P., Kasap, C., Weier, C., Balbas, M., Nicoll, J.M., Bleickardt, E., Nicaise, C., and Sawyers, C.L. 2008. Transient potent BCR‐ABL inhibition is sufficient to commit chronic myeloid leukemia cells irreversibly to apoptosis. Cancer Cell 14:485‐493. doi: 10.1016/j.ccr.2008.11.001.
  Soverini, S., Iacobucci, I., Baccarani, M., and Martinelli, G. 2007. Targeted therapy and the T315I mutation in Philadelphia‐positive leukemias. Haematologica 92:437‐439. doi: 10.3324/haematol.11248.
  Steensma, D.P. 2005. Polycythemia vera: Plethora, from prehistory to present. Curr. Hematol. Rep. 4:230‐234.
  Steensma, D.P. 2006. JAK2 V617F in myeloid disorders: Molecular diagnostic techniques and their clinical utility: A paper from the 2005 William Beaumont Hospital Symposium on Molecular Pathology. J. Mol. Diagn. 8:397‐411. doi: 10.2353/jmoldx.2006.060007.
  Swerdlow, S.H., Campo, E., Harris, N.L., Jaffe, E.S., Pileri, S.A., Stein, H., Thiele, J., and Vardiman, J.W. (eds.). 2008. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. World Health Organization Classification of Tumours. International Agency for Research on Cancer, Lyon, France.
  Tagata, Y., Yoshida, H., Nguyen, L.A., Kato, H., Ichikawa, H., Tashiro, F., and Kitabayashi, I. 2008. Phosphorylation of PML is essential for activation of C/EBP and PU.1 to accelerate granulocytic differentiation. Leukemia 22:273‐280. doi: 10.1038/sj.leu.2405024.
  Thiede, C., Koch, S., Creutzig, E., Steudel, C., Illmer, T., Schaich, M., and Ehninger, G. 2006. Prevalence and prognostic impact of NPM1 mutations in 1485 adult patients with acute myeloid leukemia (AML). Blood 107:4011‐4020. doi: 10.1182/blood‐2005‐08‐3167.
  Thota, S., Viny, A.D., Makishima, H., Spitzer, B., Radivoyevitch, T., Przychodzen, B., Sekeres, M.A., Levine, R.L., and Maciejewski, J.P. 2014. Genetic alterations of the cohesin complex genes in myeloid malignancies. Blood 124:1790‐1798. doi: 10.1182/blood‐2014‐04‐567057.
  Ustun, C., Corless, C.L., Savage, N., Fiskus, W., Manaloor, E., Heinrich, M.C., Lewis, G., Ramalingam, P., Kepten, I., Jillella, A., and Bhalla, K. 2009. Chemotherapy and dasatinib induce long‐term hematologic and molecular remission in systemic mastocytosis with acute myeloid leukemia with KITD816V. Leuk. Res. 33:735‐741. doi: 10.1016/j.leukres.2008.09.027.
  van der Velden, V.H., Cazzaniga, G., Schrauder, A., Hancock, J., Bader, P., Panzer‐Grumayer, E.R., Flohr, T., Sutton, R., Cave, H., Madsen, H.O., Cayuela, J.M., Trka, J., Eckert, C., Foroni, L., Zur Stadt, U., Beldjord, K., Raff, T., van der Schoot, C.E., and van Dongen, J.J. on behalf of the European Study Group on MRD detection in ALL (ESG‐MRD‐ALL). 2007a. Analysis of minimal residual disease by Ig/TCR gene rearrangements: Guidelines for interpretation of real‐time quantitative PCR data. Leukemia 21:604‐611. doi: 10.1038/sj.leu.2404586.
  van der Velden, V.H., Panzer‐Grumayer, E.R., Cazzaniga, G., Flohr, T., Sutton, R., Schrauder, A., Basso, G., Schrappe, M., Wijkhuijs, J.M., Konrad, M., Bartram, C.R., Masera, G., Biondi, A., and van Dongen, J.J. 2007b. Optimization of PCR‐based minimal residual disease diagnostics for childhood acute lymphoblastic leukemia in a multi‐center setting. Leukemia 21:706‐713. doi: 10.1038/sj.leu.2404535.
  van Dongen, J.J., Macintyre, E.A., Gabert, J.A., Delabesse, E., Rossi, V., Saglio, G., Gottardi, E., Rambaldi, A., Dotti, G., Griesinger, F., Parreira, A., Gameiro, P., Diáz, M.G., Malec, M., Langerak, A.W., San Miguel, J.F., and Biondi, A. 1999. Standardized RT‐PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED‐1 Concerted Action: Investigation of minimal residual disease in acute leukemia. Leukemia 13:1901‐1928. doi: 10.1038/sj.leu.2401592.
  Yoshida, K., Sanada, M., Shiraishi, Y., Nowak, D., Nagata, Y., Yamamoto, R., Sato, Y., Sato‐Otsubo, A., Kon, A., Nagasaki, M., Chalkidis, G., Suzuki, Y., Shiosaka, M., Kawahata, R., Yamaguchi, T., Otsu, M., Obara, N., Sakata‐Yanagimoto, M., Ishiyama, K., Mori, H., Nolte, F., Hofmann, W.K., Miyawaki, S., Sugano, S., Haferlach, C., Koeffler, H.P., Shih, L.Y., Haferlach, T., Chiba, S., Nakauchi, H., Miyano, S., and Ogawa, S. 2011. Frequent pathway mutations of splicing machinery in myelodysplasia. Nature 478:64‐69. doi: 10.1038/nature10496.
  Zhen, C. and Wang, Y.L. 2013. Molecular monitoring of chronic myeloid leukemia. J. Mol. Diagn. 15:556‐564. doi: 10.1016/j.jmoldx.2013.05.010.
  Zhou, J., Goldwasser, M.A., Li, A., Dahlberg, S.E., Neuberg, D., Wang, H., Dalton, V., McBride, K.D., Sallan, S.E., Silverman, L.B., and Gribben, J.G., Dana‐Farber Cancer Institute ALL Consortium. 2007. Quantitative analysis of minimal residual disease predicts relapse in children with B‐lineage acute lymphoblastic leukemia in DFCI ALL Consortium Protocol 95‐01. Blood 110:1607‐1611. doi: 10.1182/blood‐2006‐09‐045369.
Key References
  Arber, 2016, See above.
  2016 revision of the WHO classification of myeloid neoplasm.
  Mauro and Deininger, 2006. See above.
  A comprehensive review of CML biology and testing.
  Melnick and Licht, 1999. See above.
  A review of the molecular biology of acute promyelocytic leukemia and the role of its associated fusion proteins.
  Papaemmanuil, 2016. See above.
  Genomic classification and prognosis of AML based on study of 1500+ patients.
  Renneville et al., 2008. See above.
  A review of some of the mutations known to impact on prognosis in AML.
  Steensma, 2006. See above.
  A review of the biology of JAK2 mutations with an emphasis on molecular diagnosis.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library