Methylation‐Specific PCR

Bradford Coffee1

1 Emory University School of Medicine, Atlanta, Georgia
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 10.6
DOI:  10.1002/0471142905.hg1006s61
Online Posting Date:  April, 2009
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

DNA methylation is a dynamic covalent modification of DNA that is found in transcriptionally repressed regions of the genome. In concert with other epigenetic modifications, such as the repressive histone H3 modifications of lysine 9 and lysine 27 methylation, DNA methylation acts to repress gene expression through the formation of condensed chromatin structures. Thus, DNA methylation is a marker for gene repression. Methylation‐specific PCR (MSP) is a rapid and inexpensive method that can be used to determine the methylation status of DNA. MSP can be used to assess CpG methylation at imprinted genes and on the inactive X chromosome. In addition, MSP can be used to investigate the aberrant DNA methylation that occurs in diseases such as fragile X syndrome and in many types of cancers. MSP is rapid, inexpensive, and relatively simple to perform and provides a powerful tool to investigate these epigenetic processes. Curr. Protoc. Hum. Genet. 61:10.6.1‐10.6.14. © 2009 by John Wiley & Sons, Inc.

Keywords: DNA methylation; sodium bisulfite; real‐time PCR; imprinting

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Sodium Bisulfite Treatment of Genomic DNA
  • Basic Protocol 2: Methylation‐Sensitive PCR
  • Basic Protocol 3: Quantitative Methylation‐Sensitive PCR (Q‐MSP)
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Sodium Bisulfite Treatment of Genomic DNA

  Materials
  • <1 µg sample and control (from patients affected with Prader‐Willi syndrome—with absence of unmethylated paternally inherited alleles, and Angelman syndrome—with absence of methylated maternally inherited alleles) DNA (for preparation see, e.g., appendix 3B)
  • Distilled water, room temperature and 65°C (autoclaved)
  • 2 M and 3 M NaOH, freshly prepared (see recipe)
  • 10 mM hydroquinone, freshly prepared (see recipe)
  • 3.6 M sodium bisulfite, freshly prepared (see recipe)
  • Mineral oil
  • Wizard genomic DNA purification system (Promega), or equivalent, including:
    • Collection tubes
    • 0.5 M EDTA, pH 8.0
    • Nuclease‐free water
    • Nuclei lysis solution
    • RNase A solution
    • Wizard SV lysis buffer
    • Wizard SV minicolumns
    • Wizard SV wash solution
  • 95% (v/v) ethanol
  • 10 mg/ml glycogen
  • 3 M sodium acetate, pH 5.2
  • 100% and 70% (v/v) ethanol, ice cold
  • 1.5‐ml microcentrifuge tube
  • 54°C heating block
NOTE: All centrifugations, unless otherwise noted, are at maximum speed in a microcentrifuge (>20,000 × g).NOTE: Before setting up the bisulfite reactions, it is important that all chemicals used in the reaction—sodium hydroxide, hydroquinone, and sodium bisulfite—be prepared fresh just before use. The amounts given can be scaled to produce the amount needed.

Basic Protocol 2: Methylation‐Sensitive PCR

  Materials
  • HotStar Taq DNA polymerase kit (Qiagen), including:
    • 10× PCR buffer II, without MgCl 2
    • 25 mM MgCl 2
    • HotStar Taq DNA polymerase
  • 10 mM dNTPs ( appendix 2D)
  • PW/AS primer cocktail:
    • 1 pmol/µl methylated DNA–specific MF1 primers (5′‐TAAATAAGTACGTTTGCGCGGTC‐3′)
    • 1 pmol/µl methylated MR1 DNA–specific primers (5′‐AACCTTACCCGCTCCATCGCG‐3′)
    • 2 pmol/µl unmethylated DNA–specific PF2 primers (5′‐GTAGGTTGGTGTGTATGTTTAGGT‐3′)
    • 2 pmol/µl unmethylated DNA–specific PR2 primers (5′‐ACATCAAACATCTCCAACAACCA‐3′)
    • 1 pmol/µl unmodified DNA–specific SNRPNF primers (5′‐GGAGGGAGCTGGGACCCC‐3′)
    • 1 pmol/µl unmodified DNA–specific SNRPNR primers (5′‐GAAGCCACCGGCACAGCT‐3′)
  • Distilled water, autoclaved
  • Sodium bisulfite–treated sample and control DNA ( protocol 1)
  • 3% (w/v) agarose gel
  • 100‐ to 300‐bp molecular size markers (e.g., Promega 100‐bp ladder)
  • Ethidium bromide
  • Thermal cycler and appropriate PCR tubes
  • UV transilluminator
  • Additional reagents and equipment for performing agarose gel electrophoresis (unit 2.7)

Basic Protocol 3: Quantitative Methylation‐Sensitive PCR (Q‐MSP)

  Materials
  • Control DNA from a normal individual (for preparation see, e.g., appendix 3B)
  • Sodium bisulfite–treated standard DNA ( protocol 1) from a cytogenetically identified duplication of the H19 region of 11p15 (if available)
  • Sodium bisulfite–treated sample and control DNA ( protocol 1)
  • 10× PCR buffer (Invitrogen)
  • 50 mM MgCl 2 (Invitrogen)
  • 1.25 mM dNTPs ( appendix 2D)
  • Amplification primers
    • CTCF6F (5′‐GTATAGTATATGGGTATTTTTGGAGG‐3′)
    • CTCF6R (5′‐CCCAATTAAAACRAACTCRAACTATAAT‐3′)
  • Dual‐labeled fluorescent probes with Black Hole Quencher 1 (BHQ1) added by supplier during synthesis
    • CTCF6M: 5′‐FAM‐AAGTGGTCGCGCGGCGGTAGTGTA‐BHQ1‐3′ (IDT)
    • CTCF6U: 5′‐HEX‐TGGAAGTGGTTGTGTGGTGGTAGTGTAGG‐BHQ1‐3′ (IDT)
  • 5 U/µl Platinum Taq DNA polymerase (Invitrogen)
  • Distilled water (autoclaved)
  • 8‐well strip cap tube
  • iQ5 iCycler thermal cycler with iQ5 software (BioRad)
  • Additional reagents and equipment for preparing sodium bisulfite–treated DNA ( protocol 1) and quantifying DNA by absorption spectroscopy ( appendix 3D)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Antequera, F., Boyes, J., and Bird, A. 1990. High levels of de novo methylation and altered chromatin structure at CpG islands in cell lines. Cell 62:503‐514.
   Coffee, B., Muralidharan, K., Highsmith, W.E. Jr., Lapunzina, P., and Warren, S.T. 2006. Molecular diagnosis of Beckwith‐Wiedemann syndrome using quantitative methylation‐sensitive polymerase chain reaction. Genet. Med. 8:628‐634.
   Eads, C.A., Danenberg, K.D., Kawakami, K., Saltz, L.B., Blake, C., Shibata, D., Danenberg, P.V., and Laird, P.W. 2000 MethyLight: A high‐throughput assay to measure DNA methylation. Nucleic Acids Res. 28:E32.
   Frommer, M., McDonald, L.E., Millar, D.S., Collis, C.M., Watt, F., Grigg, G.W., Molloy, P.L., and Paul, C.L. 1992. A genomic sequencing protocol that yields a positive display of 5‐methylcytosine residues in individual DNA strands. Proc. Natl. Acad. Sci. U.S.A. 89:1827‐1831.
   Gonzalgo, M.L. and Jones, P.A. 1997. Rapid quantitation of methylation differences at specific sites using methylation‐sensitive single nucleotide primer extension (Ms‐SNuPE). Nucleic Acids Res. 25:2529‐2531.
   Graff, J.R., Herman, J.G., Lapidus, R.G., Chopra, H., Xu, R., Jarrard, D.F., Isaacs, W.B., Pitha, P.M., Davidson, N.E., and Baylin, S.B. 1995. E‐cadherin expression is silenced by DNA hypermethylation in human breast and prostate carcinomas. Cancer Res. 55:5195‐5199.
   Herman, J.G., Latif, F., Weng, Y., Lerman, M.I., Zbar, B., Liu, S., Samid, D., Duan, D.S., Gnarra, J.R., Linehan, W.M., and Baylin, S.B. 1994. Silencing of the VHL tumor‐suppressor gene by DNA methylation in renal carcinoma. Proc. Natl. Acad. Sci. U.S.A. 91:9700‐9704.
   Herman, J.G., Graff, J.R., Myohanen, S., Nelkin, B.D., and Baylin, S.B. 1996a. Methylation‐specific PCR: A novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. U.S.A. 93:9821‐9826.
   Herman, J.G., Jen, J., Merlo, A., and Baylin, S.B. 1996b. Hypermethylation‐associated inactivation indicates a tumor suppressor role for p15(INK4B). Cancer Res. 56:722‐727.
   Kubota, T., Das, S., Christian, S.L., Baylin, S.B., Herman, J.G., and Ledbetter, D.H. 1997. Methylation‐specific PCR simplifies imprinting analysis. Nat. Genet. 16:16‐17.
   Li, E., Beard, C., and Jaenisch, R. 1993. Role for DNA methylation in genomic imprinting. Nature 366:362‐365.
   Merlo, A., Herman, J.G., Mao, L., Lee, O.J., Gabrielson, E., Burger, P.C., Baylin, S.B., and Sidransky, D. 1995. 5′ CpG island methylation is associated with transcriptional silencing of the tumour suppressor P16/CDKN2/MTS1 in human cancers. Nat. Med. 1:686‐692.
   Riggs, A.D. and Pfeifer, G.P. 1992. X‐chromosome inactivation and cell memory. Trends Genet. 8:169‐174.
   Xiong, Z. and Laird, P.W. 1997. COBRA: A sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 25:2532‐2534.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library