Identifying Mutations for MYH‐Associated Polyposis

Thomas W. Prior1, Scott J. Bridgeman1

1 Ohio State University, Columbus, Ohio
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 10.13
DOI:  10.1002/0471142905.hg1013s64
Online Posting Date:  January, 2010
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Polyposis associated with mutations in the gene MYH is an autosomal recessive syndrome characterized by the development of colorectal adenomas and cancer. Two common mutations, p.Tyr165Cys (exon 7) and p.Glu382Asp (exon 13), have been shown to account for the majority of the mutations occurring in individuals of Caucasian ancestry. Other mutations have been found throughout the gene and many have been shown to have very low frequencies. Ethnic differences in the mutation spectrum have also been observed. Thus, in order to achieve the highest clinical sensitivity, it is necessary to perform whole‐gene sequencing of the MYH gene. The sequencing protocol described allows one to identify mutations throughout the MYH gene. Curr. Protoc. Hum. Genet. 64:10.13.1‐10.13.14. © 2010 by John Wiley & Sons, Inc.

Keywords: colorectal cancer; multiple colorectal adenomas; genetic mutation; mutation detection; DNA sequencing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Preparation of DNA from Peripheral Blood for MYH Testing
  • Basic Protocol 2: Polymerase Chain Reaction (PCR) Amplification of the MYH Gene and PCR Product Purification
  • Basic Protocol 3: Cycle Sequencing of Purified PCR Products
  • Basic Protocol 4: Sequence Analysis of MYH Gene
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of DNA from Peripheral Blood for MYH Testing

  Materials
  • 2× sucrose‐Triton (see recipe), ice cold
  • Blood sample in ACD or EDTA tube
  • Nuclei lysis buffer (see recipe)
  • 10 mg/ml proteinase K
  • Sodium chloride, saturated
  • 100% (prechilled) and 70% ethanol
  • TE buffer, pH 8.0 ( appendix 2D)
  • 15‐ and 50‐ml conical polypropylene centrifuge tubes
  • Refrigerated centrifuge
  • Cryotubes
  • 0.5‐ and 1.5‐ml microcentrifuge tubes, sterile
  • Disposable inoculating loop (Nunc, cat. no. 254410/253287)
  • Plastic disposable transfer pipets, wide bore
  • Vortex, with multi‐head and timer
  • Additional reagents for quantitation of DNA ( appendix 3D)

Basic Protocol 2: Polymerase Chain Reaction (PCR) Amplification of the MYH Gene and PCR Product Purification

  Materials
  • PCR‐grade H 2O
  • 100 mM MgCl 2
  • 10× PCR ammonium sulfate buffer, pH 8.8 (see recipe) 25 mM dNTPs (25 mM each of G, C, A, and T)
  • AmpliTaq Gold DNA polymerase (Applied Biosystems)
  • 2.5 pmol/µl PCR primers for MYH (Table 10.13.1)
  • 100 ng/µl DNA ( protocol 1)
  • 2.5% (w/v) agarose gel in 1× TAE buffer (unit 2.7)
  • 100‐bp DNA ladder
  • 10 U/µl exonuclease I enzyme (USB)
  • 1 U/µl Rapid Alkaline Phosphatase, bovine (Roche)
  • 200‐µl PCR tubes
  • Thermal cycler (BioRad Tetrad 2 or equivalent)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7)
    Table 0.3.1   Materials   MYH PCR/Sequence Primers a   MYH PCR/Sequence Primers

    Exon Primer Primer Sequence 5′ – 3′ Primer length Fragment size
    1.1 MYH EX1.1F TACCTCTGGGAAGCCGCTC 19 407 bp
    MYH EX1.1R AGACAGCAGAACACGGAGGC 20
    1.2 MYH EX1.2F CAGCCTGGCGCGCGCTAATTGCCT 24 516 bp
    MYH EX1.2R TTGTCCCTTCCTCGCCATCC 20
    2 MYH EX2F GGCCTCAAAATTTGGCCTC 19 222 bp
    MYH EX2R CTTTCATGGCCAATGAGCCT 20
    3/4 MYH EX3/4F CTGTGTCCCAAGACCCTGAT 20 377 bp
    MYH EX3/4R AAAGTGGCCCTGCTCTCAG 19
    5/7 MYH EX5/7F GCAGGTCAGCAGTGTCCTCAT 19 530 bp
    MYH EX5/7R CTACCACCTGATTGGAGTGCAA 20
    8/9 MYH EX8/9F CACAGGAGGTGAATCAACTCTGG 23 504 bp
    MYH EX8/9R AGCAGAGCTCCTTTGCAGACA 21
    10/11 MYH EX10/11F CAGCTCTGGTAGGATGTTGGG 21 476 bp
    MYH EX10/11R ACCTAGAGAGTGGGCTTTGGC 21
    12 MYH EX12F CTTGGCTTGAGTAGGGTTCG 20 286 bp
    MYH EX12R ATTCCCTCCATTCTCTCTTG 20
    13/14 MYH EX13/14F AAGAGAGAATGGAGGGAATCG 21 496 bp
    MYH EX13/14R TTCATGTAGAACATGTAGGAAACAC 25
    15 MYH EX15F GCCTGGCCAAAAAAGCATATT 21 288 bp
    MYH EX15R GAACTATTCCTCCCTCCAGTGAAG 24
    16 MYH EX16F GATTTGCATTTTTAGGACAATTCGA 25 495 bp
    MYH EX16R TCACTTGAGGCCAGAATCACCT 22

     aFrom http://frodo.wi.mit.edu/primer3/, http://www.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG00000132781, and http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=604933.

Basic Protocol 3: Cycle Sequencing of Purified PCR Products

  Materials
  • BigDye Terminator v1.1 cycle sequencing kit and 5× sequencing buffer (Applied Biosystems)
  • Nuclease‐free H 2O
  • Purified PCR products ( protocol 2)
  • 0.8 pmol/µl primers (Table 10.13.1)
  • Hi‐Di formamide (Applied Biosystems; optional)
  • 200‐µl PCR tubes
  • Thermal cycler (BioRad Tetrad 2)
  • Edge BioSystems V3 96‐well Short Plate, and rubber cushions (http://www.edgebio.com/)
  • Centrifuge with 96‐well deep‐well plate carrier
  • 96‐well receiver plate: ABI MicroAmp Optical 96‐Well Reaction Plate (Applied Biosystems, cat. no. N801‐0560)
  • ABI 3130 capillary sequencer (Applied Biosystems; see protocol 4)
  • Additional reagents and equipment for cycle sequencing (unit 7.4) and sequence analysis of MYH gene ( protocol 4)

Basic Protocol 4: Sequence Analysis of MYH Gene

  Materials
  • Purified cycle sequence products ( protocol 3)
  • Hi‐Di Formamide (Applied Biosystems)
  • Automated Sequencer (ABI 3130 from Applied Biosystems or equivalent)
  • Mutation Surveyor Software (SoftGenetics; or any other analysis software)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Al‐Tassan, N., Chimel, N.H., Maynard, J., Fleming, N., Livinngston, A.L., Williams, G.T., Hodges, A.K., Davies, D.R., David, S.S., Sampson, J.R., and Cheadle, J.P. 2002. Inherited variants of MYH associated with somatic G:C>T:A mutations in colorectal tumors. Nat. Genet. 30:227‐232.
   Chow, E., Thirlwell, C., Macrae, F., and Lipton, L. 2004. Colorectal cancer and inherited mutations in base‐excision repair. Lancet Oncol. 5:600‐606.
   Jenkins, M.A., Croitoru, M.E., Monga, N., Clearly, S.P., Cotterchi, M., Hopper, J.L., and Gallinger, S. 2006. Risk of colorectal cancer in monoallelic and biallelic carriers of MYH mutations: A population based Case‐Family Study. Cancer Epidemiol. Biomarkers Prev. 15:312‐314.
   Jo, W.S., Bandipalliam, P., Shannon, K.M., Niendorf, K.B., Chan‐Smutko, G., Hur, C., Syngal, S., and Chung, D.C. 2005. Correlation of polyp number and family history of colon cancer with germline MYH mutations. Clin. Gastroenterol. Hepatol. 3:1022‐1028.
   Jones, S., Emmerson, P., Maynard, J., Best, J.M., Jordan, S., Williams, G.T., Sampson, J.R., and Cheadle, J.P. 2002. Biallelic germline mutations in MYH predispose to multiple colorectal adenoma and somatic G:C–>T:A mutations. Hum. Mol. Genet. 11:2961‐2967.
   Kairupan, C.F., Meldrum, C.J., Crooks, R., Milward, E.A., Spigelman, A.D., Burgess, B., Groombridge, C., Kirk, J., Tucker, K., Ward, R., Williams, R.M., and Scott, R.J. 2005. Mutation analysis of the MYH gene in an Australian series of colorectal polyposis patients with or without germline APC mutations. Int. J. Cancer 10:73‐77.
   Lynch, H.T. and de la Chapelle, A. 2003. Hereditary colorectal cancer. New Engl. J. Med. 348:919‐932.
   Miller, S.A., Dykes, D.D., and Polesky, H.F. 1988. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16:1215.
   Miyaki, M., Iijima, T., Yamaguchi, T., Hishima, T., Tamura, K., Utsumomiya, J., and Mori, T. 2005. Germline mutations of the MYH gene in Japanese patients with multiple colorectal adenomas Mutat. Res. 578:430‐433.
   Riegiert‐Johnson, D.L., Johnson, R.A., Rabe, K.G., Wang, L., Thomas, B., Baudhuin, L.M., Thibodeau, S.N., and Boardman, L.A. 2007. The value of MUTYH testing in patients with early onset microsatellite stable colorectal cancer referred for hereditary nonpolyposis colon cancer syndrome testing. Genet. Test. 11:361‐365.
   Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B., and Erlich, H.A. 1988. Primer‐directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487‐491.
   Sampson, J.R., Dolwani, S., Jones, S., Eccles, D., Ellis, A., Evans, D.G., Frayling, I., Jordan, S., Maher, E.R., Mak, T., Maynard, J., Pigatto, F., Shaw, J., and Cheadle, J.P. 2003. Autosomal recessive colorectal adenomatous polyposis due to inherited mutations of MYH. Lancet 362:39‐41.
   Sanger, F., Nicklen, S., and Coulson, A.R. 1977. DNA sequencing with chain‐terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74:5463‐5467.
   Sieber, O.M., Lipton, L., Crabtree, M., Heinimann, K., Fidalgo, P., Phillips, R.K., Bisgaard, M.L., Orntoft, T.F., Aaltonen, L.A., Hodgson, S.V., Thomas, H.J., and Tomlinson, I.P. 2003. Multiple colorectal adenomas, classic adenomatous polyposis and germ‐line mutations in MYH. New Engl. J. Med. 348:791‐799.
Internet Resources
  http://agvgd.iarc.fr/
  Align GVGD (International Agency for Research on Cancer). Align GVGD is a freely available, Web‐based program that combines the biophysical characteristics of amino acids and protein multiple sequence alignments to predict where missense substitutions in genes of interest fall in a spectrum ranging from enriched deleterious to enriched neutral.
  http://frodo.wi.mit.edu/primer3/
  Primer3 (v.0.4.0). Primer3 is a widely used program for designing PCR primers on the basis of the DNA sequence to be amplified by PCR, which is an essential and ubiquitous tool in genetics and molecular biology. Primer3 can also design hybridization probes and sequencing primers.
  http://genes.mit.edu/burgelab/rescue‐ese/
  RESCUE‐ESE, an online tool for identifying candidate ESEs in vertebrate exons. Specific short oligonucleotide sequences that enhance pre‐mRNA splicing when present in exons, termed exonic splicing enhancers (ESEs), play important roles in constitutive and alternative splicing. A hybrid computational/experimental method, RESCUE‐ESE. was developed for identifying sequences with ESE activity.
  http://rulai.cshl.edu/cgi‐bin/tools/ESE3/esefinder.cgi?process=home
  ESE Finder (v. 3.0), an online tool for identifying candidate ESEs, which are specific short oligonucleotide sequences that enhance pre‐mRNA splicing when present in exons. These play important roles in constitutive and alternative splicing. A hybrid computational/experimental method, ESE Finder was developed for identifying sequences with ESE activity.
  http://www.edgebio.com/techinfo/protocols/63887_89939v2.pdf
  Edge Biotech protocol for using Performa DTR V3 96‐well short plates. These are gel‐filtration plates that consist of 440‐µl columns in a standardized array. This plate provides optimal performance for removal of BigDye v. 3.0 and 3.1 as well as other dye terminators, dNTPs, salts, and other low‐molecular‐weight materials from sequencing reactions.
  http://www.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG00000132781
  (MUTYH‐001; ENST00000372115; ENSP00000361187); Ensembl Gene Based Display; A/G‐specific adenine DNA glycosylase (MutY homolog) (hMYH); chromosome 1: 45,794,914‐45,806,142 reverse strand. The Ensembl project produces genome databases for vertebrates and other eukaryotic species, and makes this information freely available online. Ensembl is a joint project of EMBL‐EBI and the Wellcome Trust Sanger Institute to develop a software system that produces and maintains automatic annotation on selective eukaryotic genomes. ENSG…Gene; ENST…Transcript; ENSP…Protein.
  http://www.hgvs.org/mutnomen/
  Human Genome Variation Society (HGVS)—nomenclature for the description of sequence variations. The Society aims to foster discovery and characterization of genomic variations including population distribution and phenotypic associations. HGVS promotes collection, documentation, and free distribution of genomic variation information and associated clinical variations and endeavors to foster the development of the necessary methodology and informatics.
  http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=604933
  NCBI–OMIM–604933; MutY, E. coli, homolog of; MUTYH. Online Mendelian Inheritance in Man (OMIM) is a comprehensive, authoritative, and timely compendium of human genes and genetic phenotypes. The full‐text, referenced overviews in OMIM contain information on all known mendelian disorders and over 12,000 genes. OMIM focuses on the relationship between phenotype and genotype. It is updated daily, and the entries contain copious links to other genetics resources.
  http://www.softgenetics.com/mutationSurveyor.html
  Mutation Surveyor—a unique tool for DNA variant analysis from sequence traces. Mutation Surveyor uses patented anti‐correlation technology to provide highly accurate discovery of DNA variants from Sanger sequencing traces. Compatible with outputs from Applied Biosystems, Beckman‐Coulter, and MegaBACE systems, Mutation Surveyor rapidly locates all variants and SNP/indels between reference traces and sample/patient traces with excellent accuracy and sensitivity.
  http://www3.appliedbiosystems.com/cms/groups/mcb_support/documents/generaldocuments/cms_061441.pdf
  The AmpliTaq 360 DNA Polymerase protocol provides all the information needed to perform PCR over a wide range of DNA templates, including some of the most challenging GC‐rich sequences.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library