High‐Throughput Multiplex Sequencing of miRNA

Francois Vigneault1,2,3, Dmitry Ter‐Ovanesyan2,4, Shahar Alon5,6, Seda Eminaga1, Danos C. Christodoulou1, J. G. Seidman1, Eli Eisenberg5,6, George M. Church1,2

1 Department of Genetics, Harvard Medical School, Boston, Massachusetts, 2 Wyss Institute for Biologically Inspired Engineering, Boston, Massachusetts, 3 Ragon Institute of MGH, MIT, and Harvard, Charlestown, Massachusetts, 4 Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, 5 Department of Neurobiology, George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv, Israel, 6 Raymond and Beverly Sackler School of Physics and Astronomy, Tel Aviv University, Tel Aviv, Israel
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 11.12
DOI:  10.1002/0471142905.hg1112s73
Online Posting Date:  April, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Next‐generation sequencing offers many advantages over other methods of microRNA (miRNA) expression profiling, such as sample throughput and the capability to discover novel miRNAs. As the sequencing depth of current sequencing platforms exceeds what is necessary to quantify miRNAs, multiplexing several samples in one sequencing run offers a significant cost advantage. Although previous studies have achieved this goal by adding bar codes to miRNA libraries at the ligation step, this was recently shown to introduce significant bias into the miRNA expression data. This bias can be avoided, however, by bar coding the miRNA libraries at the PCR step instead. Here, we describe a user‐friendly PCR bar‐coding method of preparing multiplexed microRNA libraries for Illumina‐based sequencing. The method also prevents the production of adapter dimers and can be completed in one day. Curr. Protoc. Hum. Genet. 73:11.12.1‐11.12.10 © 2012 by John Wiley & Sons, Inc.

Keywords: miRNA; Illumina; sequencing; library; multiplex; bar code

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

 Basic Protocol
 Materials
  • RNase Zap (Ambion, cat. no. AM9780)
  • Nuclease‐free water (Ambion, cat. no. AM9937)
  • Starting RNA
  • 10× T4 RNA Ligase 2tr buffer (Enzymatics, cat. no. L6070L)
  • 3′rApp‐adapter (see Table 11.12.1)
  • 100% dimethyl sulfoxide (DMSO; Sigma, cat. no. D9170)
  • RNase inhibitor (Enzymatics, cat. no. Y9240L)
  • RT primer (see Table 11.12.1)
  • 5′ RNA adapter (see Table 11.12.1)
  • ATP (Enzymatics, cat. no. N207‐10‐L)
  • T4 RNA ligase 1 (Enzymatics, cat. no. L6050L)
  • Superscript III First‐Strand Synthesis System (Invitrogen, cat. no. 18080051) containing:
    • 5× First‐strand buffer
    • DTT
  • dNTPs (Enzymatics, cat. no. N2050L)
  • Phusion High‐Fidelity DNA Polymerase (NEB, M0530S) containing:
    • 5× HF buffer
  • BCmiRNA_PCR1 (see Table 11.12.1)
  • BCmiRNA_PCR2_BC (see Table 11.12.1)
  • AgencourtAMPure XP kit (Beckman Coulter Genomics, cat. no. A63880)
  • 70% (v/v) ethanol
  • 2% E‐Gel EX Gel (Invitrogen, cat. no. G4020‐02)
  • 25‐bp ladder (Invitrogen, cat. no. 10597‐011)
  • 100‐bp ladder (Invitrogen, cat. no. 15628‐019)
  • MinElute Gel Extraction kit (Qiagen, cat. no. 28604)
  • Agilent High Sensitivity DNA Kit (Agilent, 5067‐4626)
  • 200‐µl PCR tubes
  • Thermal cycler (for all incubations)
  • 1.5‐ml microcentrifuge tubes
  • Vortex mixer
  • Dynamag‐2 Magnet (Invitrogen, cat. no. 123‐21D)
  • Microcentrifuge
  • E‐Gel I‐Base Power System (Invitrogen, cat. no. G6400)
  • E‐Gel Safe Imager Real‐Time Transilluminator (Invitrogen, G6500)
  • Razor blades
  • Nanodrop Spectrophotometer 2000, optional
  • Agilent 2100 Bioanalyzer
     
    Table 11.12.1 List of Oligonucleotidesa

    NameSequence (5′‐3′)

    BCmiRNA_3′rApp‐adapter/5rApp/ACGGG′CTAATATTTATCGGTGG/3SpC3/
    BCmiRNA_5′RNA‐adapterrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrUrC
    BCmiRNA_RT primerGCTCCACCGATAAATATTAGCCCGT
    BCmiRNA_PCR1AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
    BCmiRNA_PCR2‐BC1CAAGCAGAAGACGGCATACGAGATCGATGTGCTCCACCGATAAATATTAGCCCGT
    BCmiRNA_PCR2‐BC2CAAGCAGAAGACGGCATACGAGATTTAGGCGCTCCACCGATAAATATTAGCCCGT
    BCmiRNA_PCR2‐BC3CAAGCAGAAGACGGCATACGAGATTGACCAGCTCCACCGATAAATATTAGCCCGT
    BCmiRNA_PCR2‐BC4CAAGCAGAAGACGGCATACGAGATACGGTGGCTCCACCGATAAATATTAGCCCGT
    BCmiRNA_PCR2‐BC5CAAGCAGAAGACGGCATACGAGATGCCAATGCTCCACCGATAAATATTAGCCCGT
    BCmiRNA_PCR2‐BC6CAAGCAGAAGACGGCATACGAGATCAGATCGCTCCACCGATAAATATTAGCCCGT
    BCmiRNA_PCR2‐BC7CAAGCAGAAGACGGCATACGAGATACTTGAGCTCCACCGATAAATATTAGCCCGT
    BCmiRNA_PCR2‐BC8CAAGCAGAAGACGGCATACGAGATGATCAGGCTCCACCGATAAATATTAGCCCGT
    BCmiRNA_PCR2‐BC9CAAGCAGAAGACGGCATACGAGATTAGCTTGCTCCACCGATAAATATTAGCCCGT
    BCmiRNA_PCR2‐BC10CAAGCAGAAGACGGCATACGAGATGGCTACGCTCCACCGATAAATATTAGCCCGT
    BCmiRNA_PCR2‐BC11CAAGCAGAAGACGGCATACGAGATCTTGTAGCTCCACCGATAAATATTAGCCCGT
    BCmiRNA_PCR2‐BC12CAAGCAGAAGACGGCATACGAGATATCACGGCTCCACCGATAAATATTAGCCCGT
    BC_Custom_IndexingACGGGCTAATATTTATCGGTGGAGC (optional)

     aNotes: All oligonucleotides can be ordered through Integrated DNA Technologies (IDT; http://www.idtdna.com), with HPLC purification. The bar‐codes are designed to be read in a single pass read, but a custom indexing primer can also be used if desired. The adenylated adapter can be ordered from IDT, or if on a budget, made as previously described (Vigneault et al., 2008).
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •  FigureFigure 11.12.1 Schematic illustration of the miRNA library preparation steps. 3′ adapter is first ligated to the total RNA (steps 1 to 5) followed by RT primer annealing (steps 6 and 7) and 5′ adapter ligation (steps 8 to 10 ). The sample is then revere transcribed (steps 11 and 12) and PCR‐enriched using bar‐coded primers (steps 13 to 27) and is then ready for gel extraction of the miRNA library fraction and QC (steps 28 to 35). The library is now ready for high‐throughput sequencing using either a single pass or custom indexing sequencing.
  •  FigureFigure 11.12.2 Final miRNA library analyzed on 2% agarose gel. Following the PCR and clean‐ up steps, half of the final miRNA is loaded on one lane of a 2% E‐gel alongside 100‐bp (lane 1) and 25‐bp ladders (lane 2). The fraction corresponding to miRNA library to be sequenced was extracted on a previous gel by cutting between 125 bp and 175 bp (lane 4), as described in the procedures, and also loaded alongside the non‐extracted library as a visual reference and expected recovery yield.
  •  FigureFigure 11.12.3 Adapter dimer consideration. Agarose gel comparing miRNA library preparation with RT primer annealing after ligation of both 3′ and 5′ adapter as described previously (lane 3) against miRNA library preparation with RT primer annealing after ligation of 3′ adapter only, as described here (lane 4). The adapter dimer expected to migrate at 114 bp is shown against the 100‐bp (lane 1) and 25‐bp ladder (lane 2). The adapter dimer is caused by ligation of 5′ adapter directly to the excess of 3′ adapter without miRNA captured. Our current protocol prevents the formation of this adapter dimer by annealing the RT primer to any available 3′ adapter, effectively making them double‐stranded and, therefore, a poor substrate for subsequent 5′ adapter ligation by T4 RNA Ligase 1.

Videos

Literature Cited

Literature Cited
    Alon, S., Vigneault, F., Eminaga, S., Christodoulou, D.C., Seidman, J.G., Church, G.M., and Eisenberg, E. 2011. Barcoding bias in high‐throughput multiplex sequencing of miRNA. Genome Res. 21:1506‐1511.
    Creighton, C.J., Reid, J.G., and Gunaratne, P.H. 2009. Expression profiling of microRNAs by deep sequencing. Brief. Bioinform. 10:490‐497.
    Hafner, M., Renwick, N., Brown, M., Mihailović, A., Holoch, D., Lin, C., Pena, J.T., Nusbaum, J.D., Morozov, P., Ludwig, J., Ojo, T., Luo, S., Schroth, G., and Tuschl, T. 2011. RNA‐ligase‐dependent biases in miRNA representation in deep‐sequenced small RNA cDNA libraries. RNA 17:1697‐1712.
    Kawano, M., Kawazu, C., Lizio, M., Kawaji, H., Carninci, P., Suzuki, H., and Hayashizaki, Y. 2010. Reduction of non‐insert sequence reads by dimer eliminator LNA oligonucleotide for small RNA deep sequencing. BioTechniques 49:751‐755.
    Kloosterman, W.P. and Plasterk, R.H.A. 2006. The diverse functions of microRNAs in animal development and disease. Dev. Cell 11:441‐450.
    Lau, N.C., Lim, L.P., Weinstein, E.G., and Bartel, D.P. 2001. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:858‐862.
    Tarasov, V., Jung, P., Verdoodt, B., Lodygin, D., Epanchintsev, A., Menssen, A., Meister, G., and Hermeking, H. 2007. Differential regulation of microRNAs by p53 revealed by massively parallel sequencing: miR‐34a is a p53 target that induces apoptosis and G1‐arrest. Cell Cycle 6:1586‐1593.
    Thomas, M.F. and Ansel, K.M. 2010. Construction of small RNA cDNA libraries for deep sequencing. Methods Mol. Biol. 667:93‐111.
    Uziel, T., Karginov, F.V., Xie, S., Parker, J.S., Wang, Y.‐D., Gajjar, A., He, L., Ellison, D., Gilbertson, R.J., Hannon, G., and Roussel, M.F. 2009. The miR‐17∼92 cluster collaborates with the Sonic Hedgehog pathway in medulloblastoma. Proc. Natl. Acad. Sci. U.S.A. 106:2812‐2817.
    Vigneault, F., Sismour, A.M., and Church, G.M. 2008. Efficient microRNA capture and bar‐coding via enzymatic oligonucleotide adenylation. Nat. Methods 5:777‐779.
    Zhu, J.Y., Pfuhl, T., Motsch, N., Barth, S., Nicholls, J., Grässer, F., and Meister, G. 2009. Identification of novel Epstein‐Barr virus microRNA genes from nasopharyngeal carcinomas. J. Virol. 83:3333‐3341.
    Zhu, Q.‐H., Spriggs, A., Matthew, L., Fan, L., Kennedy, G., Gubler, F., and Helliwell, C. 2008. A diverse set of microRNAs and microRNA‐like small RNAs in developing rice grains. Genome Res. 18:1456‐1465.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library