Mitochondrial Genome Interrogation for Forensic Casework and Research Studies

Rhonda K. Roby1, Marc Sprouse2, Nicole Phillips2, Alessandra Alicea‐Centeno2, Shantanu Shewale2, Sabrina Shore3, Natasha Paul3

1 Institute of Applied Genetics, UNT Health Science Center, Fort Worth, Texas, 2 Department of Molecular & Medical Genetics, UNT Health Science Center, Fort Worth, Texas, 3 TriLink BioTechnologies, Inc., San Diego, California
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 14.9
DOI:  10.1002/0471142905.hg1409s81
Online Posting Date:  April, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes methods used in the analysis of mitochondrial DNA (mtDNA) for forensic and research applications. UNIT describes procedures specifically for forensic casework where the DNA from evidentiary material is often degraded or inhibited. In this unit, protocols are described for quantification of mtDNA before amplification; amplification of the entire control region from high‐quality samples as well as procedures for interrogating the whole mitochondrial genome (mtGenome); quantification of mtDNA post‐amplification; and, post‐PCR cleanup and sequencing. The protocols for amplification were developed for high‐throughput databasing applications for forensic DNA testing such as reference samples and population studies. However, these same protocols can be applied to biomedical research such as age‐related disease and health disparities research. Curr. Protoc. Hum. Genet. 81:14.9.1‐14.9.23. © 2014 by John Wiley & Sons, Inc.

Keywords: mtDNA; mtGenome; forensic; quantification; amplification; sequencing; PCR

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Human mtDNA Quantification Using a Real‐Time qPCR Assay
  • Basic Protocol 2: mtDNA Amplification for Reference Samples and High‐Quality DNA
  • Basic Protocol 3: Whole Mitochondrial Genome Amplification
  • Basic Protocol 4: Post‐Amplification Quantification Using the Agilent 2100 Bioanalyzer
  • Basic Protocol 5: Preparation of Amplified mtDNA Samples for Sequencing
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Human mtDNA Quantification Using a Real‐Time qPCR Assay

  Materials
  • 10% (v/v) commercial bleach solution (7 mM sodium hypochlorite solution)
  • 4.88 nM mtDNA synthetic standard (mtDNA SS Fwd and mtDNA SS Rev; Table  14.9.1)
  • TE–4 (10 mM Tris·Cl, pH 8.0/0.1 mM EDTA)
  • UV‐irradiated, molecular‐biology‐grade, nuclease‐free water
  • TaqMan Universal PCR master mix, no AmpErase UNG (Applied Biosystems)
  • TaqMan exogenous internal positive control reagents (Applied Biosystems)
  • 9 µM PCR amplification primers (Qfwd8 and Qrev8; Table  14.9.1)
  • 2.5 µM TaqMan MGB probe (QRL8; Table  14.9.1) (Applied Biosystems)
  • Applied Biosystems 7500 real‐time PCR system and SDS software v1.2.3
  • 1.5‐ml microcentrifuge tubes
  • 96‐well optical reaction plates and base
  • Optical adhesive reaction plate covers
  • Centrifuge with plate rotor

Basic Protocol 2: mtDNA Amplification for Reference Samples and High‐Quality DNA

  Materials
  • 10% (v/v) bleach solution (7 mM sodium hypochlorite solution)
  • CleanAmp GC‐Rich master mix (TriLink BioTechnologies)
  • UV‐irradiated, molecular‐biology‐grade, nuclease‐free water
  • 1.6 µg/µl BSA
  • 9 µM PCR amplification primers (R1 and R2; Table  14.9.5)
  • Extracted and purified DNA for amplification
  • Positive control: 0.24 ng/µl HL60 control DNA (ATCC #HL‐60) or known blood sample
  • 96‐well plates or 0.2‐ml PCR strip tubes and strip caps
  • Centrifuge with plate rotor
  • Thermal cycler
Table 4.9.5   MaterialsOligonucleotide Sequences for mtDNA Amplification in protocol 3 a

Primer Binding site Primer sequence (5′–3′)
R1 (forward) mt15,910–15,931 CACCAGTCTTGTAAACCGGAGA
R2 (reverse) mt545‐564 CTTTGGGGTTTGGTTGGTTC

 aOligonucleotide sequences can be ordered from a number of commercial sources, including TriLink BioTechnologies.

Basic Protocol 3: Whole Mitochondrial Genome Amplification

  Materials
  • 10% (v/v) commercial bleach (7 mM sodium hypochlorite solution)
  • UV irradiated molecular biology grade nuclease‐free water
  • PrimeSTAR GXL DNA polymerase (ClonTech Laboratories) containing:
    • 2.5 mM dNTPs
    • PrimeSTAR GXL 5× buffer
    • PrimeSTAR GXL polymerase
  • 4.8 µM PCR amplification primers (Table  14.9.8)
  • 25 mM MgCl 2
  • Extracted and purified DNA for amplification
  • 96‐well PCR plates or 0.2‐ml PCR strip tubes and strip caps
  • Eppendorf MasterCycler pro S thermal cycler
Table 4.9.8   MaterialsOligonucleotide Sequences for Amplification of Entire Human mtGenome ( protocol 3) a

Amplicon Forward primer binding site Forward primer sequence (5′‐3′) Reverse primer binding site Reverse primer sequence (5′‐3′) Size (bp)
1 mt14,898–4919 TAGCCATGCACTACTCACCAGA mt151‐172 GGATGAGGCAGGAATCAAAGAC 1822
2 mt16,488–16,509 CTGTATCCGACATCTGGTTCCT mt1677–1698 GTTTAGCTCAGAGCGGTCAAGT 1758
3 mt1404–1425 ACTTAAGGGTCGAAGGTGGATT mt3947–3968 TCGATGTTGAAGCCTGAGACTA 2543
4 mt3734–3756 AAGTCACCCTAGCCATCATTCTA mt6739–6761 GATATCATAGCTCAGACCATACC 3005
5 mt6511–6533 CTGCTGGCATCACTATACTACTA mt9220–9242 GATTGGTGGGTCATTATGTGTTG 2709
6 mt8910–8931 CTTACCACAAGGCACACCTACA mt10,648–10,669 GGCACAATATTGGCTAAGAGGG 1738
7 mt10,360–10,381 GTCTGGCCTATGAGTGACTACA mt12,226–12,247 CAGTTCTTGTGAGCTTTCTCGG 1866
8 mt11,977–12,000 CTCCCTCTACATATTTACCACAAC mt13,830–13,852 AAGTCCTAGGAAAGTGACAGCGA 1853
9 mt13,477–13,498 GCAGGAATACCTTTCCTCACAG mt15,349–15,370 GTGCAAGAATAGGAGGTGGAGT 1872

 aOligonucleotide sequences can be ordered from a number of commercial sources, including TriLink BioTechnologies.

Basic Protocol 4: Post‐Amplification Quantification Using the Agilent 2100 Bioanalyzer

  Materials
  • 10% (v/v) bleach solution (7 mM sodium hypochlorite solution)
  • DNA 7500 LabChip Kit (Agilent Technologies, Inc.) containing:
    • DNA chips
    • DNA dye concentrate
    • DNA gel matrix
    • Gel‐dye mix (store at 4°C, light sensitive, expires 4 weeks from preparation date)
    • DNA 7500 markers
    • DNA 7500 ladder
    • Electrode cleaner chip
    • Spin filters
    • Syringes
  • UV‐irradiated, molecular‐biology‐grade, nuclease‐free water
  • Amplified product
  • Agilent 2100 Bioanalyzer (Agilent Technologies) containing:
    • Chip priming station (Agilent Technologies)
    • IKA vortex mixer (IKA Works)
CAUTION: DNA 7500 LabChip Kit components contain DMSO, which should be treated as a potential mutagen and used with appropriate care.

Basic Protocol 5: Preparation of Amplified mtDNA Samples for Sequencing

  Materials
  • 10% (v/v) bleach solution (7 mM sodium hypochlorite)
  • 70% (v/v) ethanol
  • PCR products
  • UV‐irradiated, molecular‐biology‐grade, nuclease‐free water
  • ExoSAP‐IT (USB), store at –20°C
  • BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems)
  • BetterBuffer (Gel Company)
  • BigDye XTerminator purification kit (Applied Biosystems) containing:
    • BigDye XTerminator Solution
    • SAM Solution
  • 3.3 µM cycle sequencing primers (Table  14.9.11)
  • Fume hood
  • Applied Biosystems GeneAmp PCR System 9700
  • Plate vortexer
  • Centrifuge with plate rotor
  • 1.5‐ml microcentrifuge tubes
  • 96‐well plates
  • Aluminum foil or plate strip caps
Table 4.9.1   MaterialsOligonucleotide Sequences of Cycle Sequencing Primers for protocol 5 a

Primer Direction Binding site Sequence (5′‐3′)
A1 Forward mt15,978–15,997 CACCATTAGCACCCAAAGCT
A2 Forward mt16,140–16,159 TACTTGACCACCTGTAGTAC
B1 Reverse mt16,391–16,410 GAGGATGGTGGTCAAGGGAC
B2 Reverse mt16,237–16,257 GGCTTTGGAGTTGCAGTTGAT
C1 Forward mt29‐48 CTCACGGGAGCTCTCCATGC
C2 Forward mt154‐177 TTATTTATCGCACCTACGTTCAAT
D1 Reverse mt408‐429 CTGTTAAAAGTGCATACCGCCA
D2 Reverse mt285‐306 GGGGTTTGGTGGAAATTTTTTG
A4 Forward mt16,190–16,209 CCCCATGCTTACAAGCAAGT
B4 Reverse mt16,164–16,182 TTTGATGTGGATTGGGTTT
R1 Forward mt15,910–15,931 CACCAGTCTTGTAAACCGGAGA
R2 Reverse mt546‐564 CTTTGGGGTTTGGTTGGTTC

 aOligonucleotide sequences can be ordered from a number of commercial sources, including TriLink BioTechnologies.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Anderson S., Bankier, A.T., Barrell, B.G., de Bruijn, M.H., Coulson, A.R., Drouin, J., Eperon, I.C., Nierlich, D.P., Roe, B.A., Sanger, F., Schreier, P.H., Smith, A.J., Staden, R., and Young, I.G. 1981. Sequence and organization of the human mitochondrial genome. Nature 290:457‐465.
  Anderson T.D., Ross, J.P., Roby, R.K., Lee, D.A., and Holland, M.M. 1999. A validation study for the extraction and analysis of DNA from human nail material and its application to forensic casework. J. Forensic Sci. 44:1053‐1056.
  Andrews, R.M., Kubacka, I., Chinnery, P.F., Lightowlers, R.N., Turnbull, D.M., and Howell, N. 1999. Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat. Genet. 23:47.
  Bini, C., Ceccardi, S., Luiselli, D., Ferri, G., Pelotti, S., Colalongo, C., Falconi, M., and Paooalardo, G. 2003. Different informativeness of the three hypervariable mitochondrial DNA regions in the population of Bolgna (Italy). Forensic Sci. Int. 135:48‐52.
  Brown, W.M., George, M., and Wilson, A.C. 1979. Rapid evolution of animal mitochondrial DNA. Proc. Natl. Acad. Sci. U.S.A. 76:1967‐1971.
  Cann, R.L., Stoneking, M., and Wilson, A.C. 1987. Mitochondrial DNA and human evolution. Nature 325:31‐36.
  Copeland, W.C. 2002. Mitochondrial DNA. Methods and protocols. Introduction. Methods Mol. Biol. 197:v‐vi.
  Curtis, P.C., Thomas, J.L., Phillips, N.R., and Roby, R.K. 2010. Optimization of primer‐specific filter metrics for the assessment of mitochondrial DNA sequence data. Mitochondrial DNA 21:191‐197.
  Giles R.E., Blanc H., Cann, H.M., and Wallace, D.C. 1980. Maternal inheritance of human mitochondrial DNA. Proc. Natl. Acad. Sci. U.S.A. 77:6715‐6719.
  Gray, M.W. 1992. The endosymbiont hypothesis revisited. Int. Rev. Cytol. 141:233‐357.
  Hazkani‐Covo, E., Zeller, R.D., and Martin, W. 2010. Molecular poltergeists: Mitochondrial DNA copies (numts) in sequenced nuclear genomes. PLoS Genet. 6:1‐11.
  Ingman, M., Kaessmann, H., Pääbo, S., and Gyllensten, U. 2000. Mitochondrial genome variation and the origin of modern humans. Nature 408:708‐713.
  Kavlick, M.F., Lawrence, H.S., Merritt, R.T., Fisher, C., Isenberg, A., Robertson, J.M., and Budowle, B. 2011. Quantification of human mitochondrial DNA using synthesized DNA standards. J Forensic Sci. 56:1457‐1463.
  Liu, X. and Harada, S. 2013. DNA isolation from mammalian samples. Curr. Protoc. Mol. Biol. 102:2.14.1‐2.14.13.
  Lutz, S., Wittig, H., Weisser, H.J., Heizmann, J., Junge, A., Dimo‐Simonin, N., Parson, W., Edelmann, J., Anslinger, K., Jung, S., and Augustin, C. 2000. Is it possible to differentiate mtDNA by means of HVIII in samples that cannot be distinguished by sequencing the HVI and HVII regions? Forensic Sci. Int. 113:97‐101.
  Phillips, N.R., Simpkins, J.W., and Roby, R.K. 2013. Mitochondrial DNA deletions in Alzheimer's brains: A review. Alzheimers Demet. DOI: 10.1016/j.jalz.2013.04.508.
  Ramos, A., Santos, C., Alvarez, L., Nogues, R., and Aluja, M.P. 2009. Human mitochondrial DNA complete amplification and sequencing: A new validated primer set that prevents nuclear DNA sequences of mitochondrial origin co‐amplification. Electrophoresis 30:1587‐1593.
  Robin, E.D. and Wong, R. 1998. Mitochondrial DNA molecules and virtual number of mitochondria per cell in mammalian cells. J. Cell Physiol. 136:507‐513.
  Roby, R.K., Phillips, N.R., Thomas, J.L., Sprouse, M.L., and Curtis, P.C. 2011. Development of an integrated workflow from laboratory processing to report generation for mtDNA haplotype analysis. Nat. Inst. Justice Report No: NCJ 234292. (http://www.ncjrs.gov/App/publications/abstract.aspx?ID=256237)
  Roby, R.K., Phillips, N.R., Thomas, J.L., and Sprouse, M.L. 2012. Development of an expert system for automated forensic mitochondrial DNA data analysis. Nat. Inst. Justice Report No: NCJ 239675. (https://www.ncjrs.gov/App/Publications/abstract.aspx?ID=261741)
  Sprouse, M.S., Phillips, N.R., Kavlick, M.F., and Roby, R.K. 2014. Internal validation of human mitochondrial DNA quantification using real‐time PCR. J. Forensic Sci. In press.
  Wallace, D.C., Stugard, C., and Murdock, D. 1997. Ancient mtDNA sequences in the human nuclear genome: A potential source of errors in identifying pathogenic mutations. Proc. Natl. Acad. Sci. U.S.A. 94:14900‐14905.
  Yao, Y.G., Kong, Q.P., Salas, A., and Bandelt, H.J. 2008. Pseudomitochondrial genome haunts disease studies. J. Med. Genet. 45:769‐772.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library