Mouse Genome Editing Using the CRISPR/Cas System

Donald W. Harms1, Rolen M. Quadros1, Davide Seruggia1, Masato Ohtsuka1, Gou Takahashi2, Lluis Montoliu3, Channabasavaiah B. Gurumurthy3

1 These authors contributed equally to this work, 2 Department of Bioproduction, Tokyo University of Agriculture, Hokkaido, 3 These authors are co‐corresponding authors
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 15.7
DOI:  10.1002/0471142905.hg1507s83
Online Posting Date:  October, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The availability of techniques to create desired genetic mutations has enabled the laboratory mouse as an extensively used model organism in biomedical research including human genetics. A new addition to this existing technical repertoire is the CRISPR/Cas system. Specifically, this system allows editing of the mouse genome much more quickly than the previously used techniques, and, more importantly, multiple mutations can be created in a single experiment. Here we provide protocols for preparation of CRISPR/Cas reagents and microinjection into one‐cell mouse embryos to create knockout or knock‐in mouse models. Curr. Protoc. Hum. Genet. 83:15.7.1‐15.7.27. © 2014 by John Wiley & Sons, Inc.

Keywords: CRISPR/Cas9; sgRNA; gene editing; mutant mouse; pronuclear and cytoplasmic injection

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Designing CRISPR Targets
  • Basic Protocol 2: Synthesis and Purification of RNA and DNA Components
  • Basic Protocol 3: Isolation of One‐Cell‐Stage Mouse Embryos, Microinjection of CRISPR/Cas Components, and Transfer of Injected Embryos into Pseudopregnant Mice
  • Basic Protocol 4: Genotyping of Offspring
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Designing CRISPR Targets

  Materials
  • sgRNA expression plasmid vectors: e.g., pUC57‐sgRNA expression vector (Addgene, plasmid no. 51132; Shen et al., ) or MLM3636 (Addgene, plasmid no. 43860)
  • Suitable restriction endonucleasess (REs): e.g., BbsI for pX260 or pX330 and BsaI for digesting pUC57‐sgRNA vectors plus REs that cut once downstream of the Cas9 or sgRNA sequences to linearize the plasmids (e.g., pBGK plasmid that expresses Cas9 can be linearized with XbaI and pUC57‐sgRNA vector can be linearized with DraI); it is necessary to ensure that the chosen restriction site does not cut the Cas9 or sgRNA sequences.
  • 0.8% TAE or TBE agarose gel (also see unit 2.7)
  • Gel‐extraction kit (Promega; also available from Qiagen or similar vendors) including elution buffer (EB)
  • 100 μM suitable oligonucleotides containing the target sequence
  • Quick Ligase and 2× Quick Ligation Buffer (NEB)
  • T4 polynucleotide kinase (PNK; NEB)
  • 10× T4 ligase buffer (NEB)
  • Suitable competent bacteria (i.e., DH10B, DH5α)
  • Dithiothreitol (DTT)
  • Esp3I restriction endonuclease (Thermo Scientific)
  • TOP 10 electrocompetent cells (Life Technologies)
  • LB agar plates containing 50 μg/ml ampicillin
  • Expand Long Template PCR System (Roche)
  • Plasmid DNAs containing Cas9 sequence, e.g., pBGK‐Cas9polyA or hCas9 (Addgene, plasmid no. 41815; Mali et al., ), pX260 (Addgene, plasmid no. 42229) or pX330 (Addgene, plasmid no. 42230; Cong et al., ), or any such mammalian codon‐optimized Cas9 plasmid that can be used for in vitro transcription
  • Oligonucleotides:
  •  T7‐hCas9‐Fw‐5′‐TAATACGACTCACTATAGGGAGAATGGACAAGAAGTACTCCATTG‐3′
  • hCas9‐Rv 5′‐ CGGTAGGGATCGAACCCTTTCA‐3′
  • T7‐sgRNA‐Fw 5′‐TTAATACGACTCACTATAGGN 20‐3′ (where N 20 is the selected CRISPR target, cloned in the sgRNA vector)
  • sgRNA‐Rv 5′‐ AAAAGCACCGACTCGGTGCC‐3′
  • Expand High Fidelity PCR system (Roche) or similar proof‐reading Taq polymerase
  • 70% and 100% ethanol
  • RNase‐free H 2O and embryo‐tested H 2O (available from most molecular biology suppliers)
  • 3 M sodium acetate, pH 5.2 ( appendix 2D)
  • mMESSAGE mMACHINE T7 ULTRA kit (Ambion, cat. no. AM1345)
  • MegaClear kit (Ambion, cat. no. AM1908)
  • RNase‐free microinjection buffer: 1 mM Tris·Cl, pH 7.5/0.1 mM EDTA prepared with RNase‐free H 2O
  • Thermal cycler
  • 50°, 65°, and 95°C water baths or heat block(s)
  • Nanodrop spectrophotometer for determination of DNA and RNA concentration
  • NucAway Spin Columns (Life Technologies; optional)
  • Ultrafree‐MC VV Centrifugal Filter (Millipore, cat. no. UFC30VV25)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7), transformation of E. coli (Seidman et al., ), and spectrophotometric determination of nucleic acids including use of Nanodrop ( appendix 3D), and loading microinjection mix on injection needles ( protocol 3)

Basic Protocol 2: Synthesis and Purification of RNA and DNA Components

  Materials
  • Mice:
  • Donor females: in our laboratory, we procure 3‐week‐old B6SJL/J F1 females from The Jackson Laboratory or 4‐week‐old FVB female from Charles River Laboratories
  • Stud males: purchased from the respective vendors at 5 to 6 weeks of age
  • Pseudopregnant recipients: Crl: CD1(ICR) female mice purchased at 5 to 6 weeks of age from Charles River Laboratories, for pseudo‐pregnant foster mother (pseudopregnant mice are obtained by mating 5 to 12 week old CD1 females to vasectomized CD‐1 males on the day before microinjection; on the morning of the injection day, plug‐positive females are used for oviduct transfers; typically 10 to 20 CD‐1 females are bred in each session to obtain an average of 4 to 8 plugged females, and about 15 to 25 injected embryos are transferred per female)
  • Vasectomized males: 5 to 6 week‐old CD‐1 mice purchased from, Charles River Laboratories; vasectomies performed as described in Behringer et al. ( )
  • Hormones: pregnant mares serum gonadotropin (PMSG) and human chorionic gonadotropin (HCG) were obtained from the National Hormone and Peptide Program (Harbor–UCLA Medical Center, Torrance, Calif.)
  • M2 medium for embryo handling and microinjection (Millipore, cat. no. MR‐015‐D)
  • Hyaluronidase for dissociation of cumulus oophorus complex (Millipore, cat. no. MR‐051‐F)
  • KSOM + AA for embryo incubation (Millipore, cat. no. MR‐106‐D)
  • Microinjection mix ( protocol 2)
  • Light mineral oil (Millipore, cat. no. ES‐005‐C)
  • Individually Ventilated Cages (IVCs; Allentown, Lab Products, or Tecniplast)
  • Falcon tissue culture dish, 35 × 10 mm (Corning, cat. no. 353001)
  • Falcon tissue culture dish, 60 × 15 mm (Corning, cat. no. 353002)
  • Falcon IVF dish (Corning, cat. no. 353653)
  • Slide warmer
  • Dissecting instruments including fine forceps
  • Flexipet oocyte/embryo pipets (Cook Medical, cat. no. K‐FPIP‐1130‐10BS‐5)
  • Model P‐97 pipet puller (Sutter Instrument Co.) outfitted with 2.5 mm × 2.5 mm box filament (FB255B)
  • Glass: (World Precision Instrument Inc., cat. no. TW100F‐4) with filament 1.0 mm, 4 in.
  • MicroFil, 28‐G/97 mm long (World Precision Instrument Inc., cat. no. MF28G)
  • 1‐cc tuberculin syringes
  • Nikon Eclipse TE 2000‐E with DIC, equipped with Narishige IM 300 microinjector and NT‐88‐V3 micromanipulators
  • Condenser lens: LWD 0.52
  • Objectives:
  • PLAN 4×/0.10 WD30
  • PLAN APO 10×/0.45 WD4.0
  • PLAN FLUOR ELWD 20×/0.45 DIC L/NI
  • PLAN FLUOR ELWD 40×/0.60 DIC M/NI
  • Chamber slide (Lab‐Tek, cat. no. 177372)
  • Heated glass insert for chamber slide (Live Cell Instrument, cat. no. HG‐T‐Z002) with temperature controller (Live Cell Instrument, cat. no. CU‐301)
  • Holding pipets (Humagen, cat. no. MPH‐SM‐20)
  • Additional reagents and equipment for transfer of embryos into pseudopregnant mice (Behringer et al., )

Basic Protocol 3: Isolation of One‐Cell‐Stage Mouse Embryos, Microinjection of CRISPR/Cas Components, and Transfer of Injected Embryos into Pseudopregnant Mice

  Materials
  • T7 Endonuclease I (NEB)
  • NEBuffer 2 (NEB)
  • 2% agarose gel (also see unit 2.7)
  • Thermal cycler
  • Additional reagents and equipment for the polymerase chain reaction (PCR; Kramer and Coen, ) and agarose gel electrophoresis (unit 2.7)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

  Auerbach, A.B., Norinsky, R., Ho, W., Losos, K., Guo, Q., Chatterjee, S., and Joyner, A.L. 2003. Strain‐dependent differences in the efficiency of transgenic mouse production. Transgenic Res. 12:59‐69.
  Barrangou, R., Fremaux, C., Deveau, H., Richards, M., Boyaval, P., Moineau, S., Romero, D.A., and Horvath, P. 2007. CRISPR provides acquired resistance against viruses in prokaryotes. Science 315:1709‐1712.
  Behringer, R., Gertsenstein, M., Nagy, K. V., and Nagy, A., eds., 2014. Manipulating the Mouse Embryo: A Laboratory Manual. 4th Edition. Cold Spring Harbor Laboratory Press.
  Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., et al. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339:819‐823.
  Engler, C., and Marillonnet, S. 2014. Golden Gate cloning. Methods Mol. Biol. 1116:119‐131.
  Engler, C., Kandzia, R., and Marillonnet, S. 2008. A one pot, one step, precision cloning method with high throughput capability. PLoS One 3:e3647.
  Fielder, T.J., Barrios, L., and Montoliu, L. 2010. A survey to establish performance standards for the production of transgenic mice. Transgenic Res. 19:675‐681.
  Fu, Y., Foden, J.A., Khayter, C., Maeder, M.L., Reyon, D., Joung, J.K., and Sander, J.D. 2013. High‐frequency off‐target mutagenesis induced by CRISPR‐Cas nucleases in human cells. Nat. Biotechnol. 31:822‐826.
  Fujii, W., Kawasaki, K., Sugiura, K., and Naito, K. 2013. Efficient generation of large‐scale genome‐modified mice using gRNA and CAS9 endonuclease. Nucleic Acids Res. 41:e187‐e187.
  Fujii, W., Onuma, A., Sugiura, K., and Naito, K. 2014. Efficient generation of genome‐modified mice via offset‐nicking by CRISPR/Cas system. Biochem. Biophys. Res. Commun. 445:791‐794.
  Geurts, A.M., Cost, G.J., Freyvert, Y., Zeitler, B., Miller, J.C., Choi, V.M., Jenkins, S.S., Wood, A., Cui, X., Meng, X., Vincent, A., Lam, S., Michalkiewicz, M., Schilling, R., Foeckler, J., Kalloway, S., Weiler, H., Ménoret, S., Anegon, I., Davis, G.D., Zhang, L., Rebar, E.J., Gregory, P.D., Urnov, F.D., Jacob, H.J., and Buelow, R. 2009. Knockout rats via embryo microinjection of zinc‐finger nucleases. Science 325:433‐433.
  Hall, B., Limaye, A., and Kulkarni, A. B. 2009. Overview: Generation of gene knockout mice. Curr. Protoc. Cell Biol. 44:19.12.1‐19.12.17.
  Haruyama, N., Cho, A., and Kulkarni, A.B. 2009. Overview: Engineering transgenic constructs and mice. Curr. Protoc. Cell Biol. 42:19.10:19.10.1‐19.10.9.
  Heigwer, F., Kerr, G., and Boutros, M. 2014. E‐CRISP: Fast CRISPR target site identification. Nat. Methods 11:122‐123.
  Hermann, M., Cermak, T., Voytas, D.F., and Pelczar, P. 2014. Mouse genome engineering using designer nucleases. J. Vis. Exp. Available at: http://www.jove.com/video/50930/mouse‐genome‐engineering‐using‐designer‐nucleases [Accessed April 14, 2014].
  Horii, T., Arai, Y., Yamazaki, M., Morita, S., Kimura, M., Itoh, M., Abe, Y., and Hatada, I. 2014. Validation of microinjection methods for generating knockout mice by CRISPR/Cas‐mediated genome engineering. Sci. Rep. 4:4513
  Horvath, P. and Barrangou, R. 2010. CRISPR/Cas, the immune system of bacteria and archaea. Science 327:167‐170.
  Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V., Li, Y., Fine, E.J., Wu, X., Shalem, O., Cradick T.J., Marraffini, L.A., Bao, G., and Zhang, F. 2013. DNA targeting specificity of RNA‐guided Cas9 nucleases. Nat. Biotechnol. 31:827‐832.
  International Society for Transgenic Technologies. 2011. Advanced Protocols for Animal Transgenesis: An ISTT Manual. (S. Pease and T.L. Saunders, eds.). Springer, New York.
  Jinek, M., East, A., Cheng, A., Lin, S., Ma, E., and Doudna, J. 2013. RNA‐programmed genome editing in human cells. eLife 2:e00471.
  Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1:15.1.1‐15.1.14.
  LePage, D.F. and Conlon, R.A. 2006. Animal models for disease: Knockout, knock‐in, and conditional mutant mice. Methods Mol. Med. 129:41‐67.
  Mali, P., Aach, J., Stranges, P.B., Esvelt, K.M., Moosburner, M., Kosuri, S., Yang, L., and Church, G.M. 2013a. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat. Biotechnol. 31:833‐838.
  Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., and Church, G.M. 2013b. RNA‐guided human genome engineering via Cas9. Science 339:823‐826.
  Mashiko, D., Fujihara, Y., Satouh, Y., Miyata, H., Isotani, A., and Ikawa, M. 2013. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Sci. Rep. 3:3355.
  Montague, T.G., Cruz, J.M., Gagnon, J.A., Church, G.M., and Valen, E. 2014. CHOPCHOP: A CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Res. 42:W401‐W407.
  Panda, S.K., Wefers, B., Ortiz, O., Floss, T., Schmid, B., Haass, C., Wurst, W., and Kühn, R. 2013. Highly efficient targeted mutagenesis in mice using TALENs. Genetics 195:703‐713.
  Pattanayak, V., Lin, S., Guilinger, J.P., Ma, E., Doudna, J.A., and Liu, D.R. 2013. High‐throughput profiling of off‐target DNA cleavage reveals RNA‐programmed Cas9 nuclease specificity. Nat. Biotechnol. 31:839‐843.
  Pease, S. and Saunders, T.L. (eds.), 2011. Advanced Protocols for Animal Transgenesis. Springer, Berlin.
  Ran, F.A., Hsu, P.D., Lin, C.‐Y., Gootenberg, J.S., Konermann, S., Trevino, A.E., Scott, D.A., Inoue, A., Matoba, S., Zhang, Y., and Zhang, F. 2013. Double nicking by RNA‐guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154:1380‐1389.
  Rémy, S., Tesson, L., Ménoret, S., Usal, C., Scharenberg, A.M., and Anegon, I. 2010. Zinc‐finger nucleases: A powerful tool for genetic engineering of animals. Transgenic Res. 19:363‐371.
  Seidman, C. E., Struhl, K., Sheen, J. and Jessen, T. 1997. Introduction of plasmid DNA into cells. Curr. Protoc. Mol. Biol. 37:1.8.1‐1.8.10.
  Seruggia, D. and Montoliu, L. 2014. The new CRISPR‐Cas system: RNA‐guided genome engineering to efficiently produce any desired genetic alteration in animals. Transgenic Res. 23:707‐716.
  Shen, B., Zhang, J., Wu, H., Wang, J., Ma, K., Li, Z., Zhang, X., Zhang, P., and Huang, X. 2013. Generation of gene‐modified mice via Cas9/RNA‐mediated gene targeting. Cell Res. 23:720‐723.
  Shen, B., Zhang, W., Zhang, J., Zhou, J., Wang, J., Chen, L., Wang, L., Hodgkins, A., Iyer, V., Huang, X., and Skarnes, W.C. 2014. Efficient genome modification by CRISPR‐Cas9 nickase with minimal off‐target effects. Nat. Methods 11:399‐402.
  Sung, Y.H., Baek, I.‐J., Kim, D.H., Jeon, J., Lee, J., Lee, K., Jeong, D., Kim, J.‐S., and Lee, H.‐W. 2013. Knockout mice created by TALEN‐mediated gene targeting. Nat. Biotechnol. 31:23‐24.
  Terns, R.M. and Terns, M.P. 2014. CRISPR‐based technologies: Prokaryotic defense weapons repurposed. Trends Genet. 30:111‐118.
  Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F., and Jaenisch, R. 2013. One‐step generation of mice carrying mutations in multiple genes by CRISPR/Cas‐mediated genome engineering. Cell 153:910‐918.
  Wefers, B., Panda, S.K., Ortiz, O., Brandl, C., Hensler, S., Hansen, J., Wurst, W., and Kühn, R. 2013. Generation of targeted mouse mutants by embryo microinjection of TALEN mRNA. Nat. Protoc. 8:2355‐2379.
  Yang, H., Wang, H., Shivalila, C.S., Cheng, A.W., Shi, L., and Jaenisch, R. 2013. One‐step generation of mice carrying reporter and conditional alleles by CRISPR/Cas‐mediated genome engineering. Cell 154:1370‐1379.
  Zhou, J., Shen, B., Zhang, W., Wang, J., Yang, J., Chen, L., Zhang, N., Zhu, K., Xu, J., Hu, B., et al. 2014. One‐step generation of different immunodeficient mice with multiple gene modifications by CRISPR/Cas9 mediated genome engineering. Int. J. Biochem. Cell Biol. 46:49‐55.
Internet Resources
  http://crispr.mit.edu/
  This site searches SpCas9 target sites within the sequence of interest and allows users to enter a 23 to 250 base DNA sequence. The site is hosted and maintained by Dr. Feng Zhang's group at Massachusetts Institute of Technology. The algorithm used by this program is based on the specificity analysis performed in Hsu et al. (). Details related to this Web site and how to use the tool are given in and outlined in Figure .
  http://www8.nationalacademies.org/onpinews/newsitem.aspx?RecordID=12910
  National Research Council: Guide for the Care and Use of Laboratory Animals: Eighth Edition. Washington, DC: The National Academies Press, 2011.
  http://ec.europa.eu/environment/chemicals/lab_animals/legislation_en.htm
  European Commission: Legislation for the protection of animals used for scientific purposes.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library