Diagnosis of Inherited Disorders of Galactose Metabolism

Carla Cuthbert1, Helene Klapper1, Louis Elsas1

1 Leonard Miller School of Medicine, University of Miami, Miami, Florida
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 17.5
DOI:  10.1002/0471142905.hg1705s56
Online Posting Date:  January, 2008
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Galactose metabolism occurs through an evolutionarily conserved pathway in which galactose and uridine diphosphoglucose are converted to glucose‐1‐phosphate and uridine diphosphogalactose through the action of three sequential enzymes: galactokinase (GALK, EC 2.7.1.6), galactose‐1‐phosphate uridyltransferase (GALT, EC 2.7.7.12), and uridine phosphogalactose 4′‐epimerase (GALE, EC 5.1.3.2). Inborn errors of galactose metabolism occur with impaired activity for each of the enzymes. Classical galactosemia is the most common and the most severe of these diseases and is caused by deficiency of the GALT enzyme, affecting from ∼1 in 10,000 to 1 in 30,000 live births. Deficiency of GALE is the rarest of the three diseases. Assays for galactitol and galactose‐1‐phosphate and methods for assaying enzyme activities of GALT, GALK, and GALE are provided here. Interpretation of diagnostic results for screen‐positive newborns or symptomatic patients, as well as therapeutic interventions based on biochemical phenotype and molecular genotype, are also included as decision trees. Curr. Protoc. Hum. Genet. 56:17.5.1‐17.5.29. © 2008 by John Wiley & Sons, Inc.

Keywords: galactosemia; galactose; metabolism; galactose‐1‐phosphate; galactitol; neonatal screening

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Galactose Analyte Assay
  • Basic Protocol 2: Galactitol and Galactonate Analyte Assay
  • Basic Protocol 3: Galactose‐1‐Phosphate Analyte Assay
  • Basic Protocol 4: Galactokinase Enzyme Assay
  • Basic Protocol 5: Galactose‐1‐Phosphate Uridyltransferase Enzyme Assay
  • Basic Protocol 6: UDPgalactose‐4′‐Epimerase Enzyme Assay
  • Basic Protocol 7: GALT Mutation Panel Analysis
  • Basic Protocol 8: GALT Delta‐5KB Deletion Analysis
  • Support Protocol 1: Preparation of Washed Red Blood Cells
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Galactose Analyte Assay

  Materials
  • 50 mg/dl galactose standard (see recipe)
  • Plasma, serum, or urine
  • NAD substrate A (see recipe)
  • 1.5‐ml microcentrifuge tubes
  • 96‐well plates
  • Synergy HT multi‐detection microplate reader (BioTek) or equivalent

Basic Protocol 2: Galactitol and Galactonate Analyte Assay

  Materials
  • 1 mM D‐galactitol (Sigma cat. no. D0256)
  • 1 mM galactonic acid (Sigma cat. no. S960098)
  • HPLC‐grade water
  • 1.5 U/µl urease solution (Sigma cat. no. U1500)
  • Urine samples
  • D‐[13C]Galactitol (Medical Isotopes)
  • D‐[13C]Galactonate (Medical Isotopes)
  • Ethanol
  • N,O‐Bis(trimethylsilyl)trifluoroacetamide with trimethylchlorosilane (BSTFA with 1% TMCS; Pierce Chemical)
  • Pyridine
  • 1.5‐ml microcentrifuge tubes
  • 37° and 90°C incubators
  • Zymark evaporator/concentrator connected to stream of nitrogen gas (or equivalent)
  • Autosampler vials with 100‐ or 200‐µl inserts for GC/MS analysis
  • Gas chromatography/mass spectrometer (e.g., 6890/5975 GC/MSD with electron ionization source; Agilent)

Basic Protocol 3: Galactose‐1‐Phosphate Analyte Assay

  Materials
  • 0.2 M sodium phosphate buffer, pH 7.0 (see recipe)
  • Washed red blood cells (see protocol 9)
  • NAD substrate B: dissolve 8 mg NAD (Sigma cat. no. N7004) in 9 ml water just before use and keep on ice
  • β‐Galactose dehydrogenase (Sigma cat. no. G6337)
  • β‐Galactose dehydrogenase dilution buffer (see recipe)
  • Alkaline phosphatase (Sigma cat. no. P7923)
  • Alkaline phosphatase dilution buffer (see recipe)
  • 6% (w/v) perchloric acid (dilute from 70% solution with water)
  • 0.1 mg/ml Gal‐1‐P standard (see recipe)
  • 1 M Tris·Cl, pH 8.6 (see recipe)
  • 1.5‐ml microcentrifuge tubes
  • 37°C heating block or water bath
  • 96‐well plates (UV transparent)
  • Synergy HT multi‐detection microplate reader (BioTek) or equivalent

Basic Protocol 4: Galactokinase Enzyme Assay

  Materials
  • Washed red blood cells (see protocol 9)
  • 12.8 mM dithiotheitol (DTT)
  • Hemoglobin reagent (see recipe)
  • 0.8 M Tris·Cl, pH 7.8 (see recipe)
  • Galactokinase substrate mix (see recipe)
  • Galactokinase cofactor mix (see recipe)
  • 0.05 M LiCl solution
  • 0.9% saline (e.g., NaCl solution from VWR cat. no. VW3257)
  • Spectrophotometer
  • 37°C and boiling water baths
  • 1.5‐ml microcentrifuge tubes
  • DEAE‐TLC plates (Whatman cat. no. 4410 225)
  • Hairdryer, optional
  • Phosphorimager screen
  • Densitometer (BioRad Molecular Imager FX)

Basic Protocol 5: Galactose‐1‐Phosphate Uridyltransferase Enzyme Assay

  Materials
  • Washed red blood cells (see protocol 9)
  • Lysing buffer (see recipe)
  • Hemoglobin reagent (see recipe)
  • Glycine buffer (see recipe)
  • 14C‐labeled Gal‐1‐P substrate
  • UDPG substrate (see recipe)
  • 0.05 M LiCl solution
  • Spectrophotometer
  • 37° and 100°C heating blocks
  • DEAE‐TLC plates
  • Hairdryer, optional
  • Phosphorimager screen
  • Densitometer (e.g., BioRad Molecular Imager FX)

Basic Protocol 6: UDPgalactose‐4′‐Epimerase Enzyme Assay

  Materials
  • Washed red blood cells (see protocol 9)
  • Lysing buffer (see recipe)
  • Hemoglobin reagent (see recipe)
  • Glycine buffer (see recipe)
  • Epimerase substrate mix: 0.1 µCi [14C]UDPgalactose and 4 mM unlabeled UDPgalactose (store frozen in aliquots)
  • NAD substrate C: dissolve 8 mg NAD (Sigma cat. no. N7004) in 0.7 ml water just before use and keep on ice
  • Epimerase TLC buffer (see recipe)
  • Spectrophotometer
  • 1.5‐ml microcentrifuge tubes
  • 37° and 100°C heating blocks
  • Polyethyleneimine‐cellulose TLC plates
  • Phosphorimager screen
  • Densitometer (e.g., BioRad Molecular Imager FX)

Basic Protocol 7: GALT Mutation Panel Analysis

  Materials
  • 3 to 5 ng/µl genomic DNA from patient (isolated from whole blood using the QIAamp DNA Blood Mini Kit; QIAGEN cat. no. 51104)
  • iTaq polymerase with 10× PCR buffer (BioRad)
  • 50 mM MgCl 2
  • PCR primers labeled GALT‐1 through GALT‐6:
    • 50 µM GALT‐1 primer (5′‐GCCTGCACATACTGCATGTGA‐3′)
    • 50 µM GALT‐2 primer (5′‐GGGGACACAGGGCTTGGCTCTCTCCCA‐3′)
    • 50 µM GALT‐3 primer (5′‐AGGAGGGAGTTGACTTGGTGT‐3′)
    • 50 µM GALT‐4 primer (5′‐GGTCAGCATCTGGACCCCAGG‐3′)
    • 50 µM GALT‐5 primer (5′‐GGACCGACATGAGTGGCAGCGTTACATCC‐3′)
    • 50 µM GALT‐6 primer (5′‐GGGTGGGCCTTCCCTACTCC‐3′)
  • 2 mM dNTP mix: 2 mM dATP, 2 mM dCTP, 2 mM dGTP, 1.9 mM dTTP
  • DIG‐dUTP (Roche cat. no. 11093088910), diluted to 0.1 mM working solution with water
  • Roche PCR ELISA Dig detection kit (Roche cat. no. 11965409910) including:
    • Denaturing solution (vial 1A)
    • Hybridization buffer (bottle 2)
    • Anti‐DIG‐pod conjugate (small brown bottle)
    • Conjugate dilution buffer (bottle 4)
    • Washing solution (made from tablets in bottle 5)
    • ABTS solution (bottle 6)
    • Streptavidin‐coated multiwell plates
  • 18 GALT ASO primers (biotinylated and nonbiotinylated; see recipe)
  • Electrophoresis apparatus for agarose minigels
  • 0.5‐ml thin‐walled PCR tubes
  • PCR thermal cycler
  • Parafilm
  • 70°C shaking water bath
  • Plate reader
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7)

Basic Protocol 8: GALT Delta‐5KB Deletion Analysis

  Materials
  • Whole blood from patient or control (200 µl)
  • QIAamp DNA blood mini kit (Qiagen cat. no. 51104) containing:
    • QIAamp spin columns
    • 2‐ml collection tubes
    • Buffers AL, AW1, AW2, and AE
    • Protease
    • Protease solvent
    • Proteinase K
  • DNA Taq polymerase kit (Qiagen cat. no. 203203) containing:
    • HotStar Taq DNA polymerase
    • 10× PCR buffer
    • 5× Q‐solution
    • 25 mM MgCl 2
  • 2 mM working dNTP solutions (2 mM dATP, 2 mM dCTP, 2 mM dGTP, 2 mM dTTP)
  • 20 µM Delta‐5kb primers in TE buffer:
    • Delta‐5kb primer A (5′‐AGTACCAGGGGAGGAATTAATTTGAATTT‐3′; gene location, –1164F)
    • Delta‐5kb primer B (5′ GTGTGATTTCCCCACCCACAGG‐3′; +4795R)
    • Delta‐5kb primer C (5′‐CTTGTGTCTTGGTTGTGGCTGGAGG‐3′; +4116F)
  • Loading buffer
  • 2% agarose gel
  • PCR thermal cycler
  • Electrophoresis apparatus for agarose minigels
  • Additional reagents and equimpment for agarose gel electrophoresis (unit 2.7)

Support Protocol 1: Preparation of Washed Red Blood Cells

  Materials
  • Whole blood collected in a green‐top heparin tube (pre‐feed sampling for Gal‐1‐P assay)
  • 0.9% (w/v) sodium chloride
  • 15‐ml centrifuge tubes
  • 1.5‐ml microcentrifuge tubes
  • Transfer pipets
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Barbouth, D., Slepak, T., Klapper H., Lai, K., and Elsas, L.J. 2006. Prevention of a molecular misdiagnosis in galactosemia. Genet. Med. 8:178‐182.
   Coffee, B., Hjelm, L.N., DeLorenzo, A., Courtney, E., Yu, C., and Muralidharan, K. 2006. Characterization of an unusual deletion of the galactose‐1‐phosphate uridyl transferase (GALT) gene. Genet. Med.. 8:635‐640.
   Elsas, L.J. 2005. Galactosemia. GeneTests (www.genetests.org).
   Elsas, L.J. 2007. Galactosemia. In Cecil Textbook of Medicine, 23rd Edition. (W.B. Saunders, ed.). Elsevier, New York.
   Elsas, L.J. and Lai, K. 1998. The molecular biology of galactosemia. Genet. Med. 1:40‐48.
   Holton, J.B., Walter, J.H., and Tyfield, L.A. 2001. Galactosemia. In The Metabolic and Molecular Bases of Inherited Diseases, 8th Edition. (C.R. Scriver, A.L. Beaudet, W.S. Sly, and D. Valle, eds.) McGraw Hill, New York.
   Lai, K., Willis, A.C., and Elsas, L.J. 1999. The biochemical role of glutamine 188 in human galactose‐1‐phosphate uridyltransferase. J. Biol. Chem. 274:6559‐6566.
   Langley, S.D., Lai, K., Dembure, P.P., Hjelm, L.N., and Elsas, L.J. 1997. Molecular basis for Duarte and LA variant galactosemia. Am. J. Hum. Genet. 60:366‐372.
   Ng, W.G., Bergren, W.R., and Donnell, G.N. 1967. An improved procedure for the assay of hemolysate galactose‐1‐phosphate uridyl transferase activity by the use of 14C‐labeled galactose‐1‐phosphate. Clin. Chim. Acta 15:489‐492.
   Pass, K.A., Lane, P.A., Fernhoff, P.M., Hinton, C.F., Panny, S.R., Parks, J.S., Pelias, M.K., Rhead, W.J., Ross, S.I., Wethers, D.L., and Elsas, L.J. 2000. U.S. newborn screening system guidelines II: Follow‐up of children, diagnosis, management, and evaluation statement of the council of regional networks for genetic services (CORN). J. Pediatrics 137:S1‐S46.
   Shin, Y.S. 1991. Galactose metabolites and disorders of galactose metabolism. In Techniques in Diagnostic Human Biochemical Genetics: A Laboratory Manual, pp. 267‐283. John Wiley and Sons, Inc. Hoboken, N.J.
   Thoden, B.T., Henderson, J.M., Fridovich‐Keil, J.L., and Holden, H.M. 2002. Structural analysis of the Y299C mutant of Escherichia coli UDP‐galactose 4‐epimerase. J. Biol. Chem. 277:27528‐27534.
   Tyfield, L., Reichardt, J., Fridovich‐Keil, J., Croke, D., Elsas, L.J., Strobl, W., Kozak, L., Coskun, T., Novelli, G., Okano, Y., Zekanowski, C., Shin, Y., and Boleda, M.D. 1999. Classical galactosemia and mutations at the galactose‐1‐phosphate uridyltransferase (GALT) gene. Human Mutation 13:417‐130.
   Yager, C., Wehrli, S., and Segal, S. 2006. Urinary galactitol and galactonate quantified by isotope‐dilution gas chromatography‐mass spectrometry. Clin. Chim. Acta 366:216‐224.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library