Diagnosis of Copper Transport Disorders

Lisbeth B. Møller1, Julia D. Hicks2, Courtney S. Holmes3, David S. Goldstein3, Cornelia Brendel4, Peter Huppke4, Stephen G. Kaler2

1 Kennedy Centre, Glostrup, Denmark, 2 Unit on Human Copper Metabolism, Molecular Medicine Program, Eunice Kennedy Shriver National Institute of Child Health and Human Development, Bethesda, Maryland, 3 Clinical Neurocardiology Section, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, Maryland, 4 Department of Pediatric Neurology, Georg August University, Göttingen, Germany
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 17.9
DOI:  10.1002/0471142905.hg1709s70
Online Posting Date:  July, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Techniques for the diagnosis of copper transport disorders are increasingly important due to recent recognition of previously unappreciated clinical phenotypes and emerging advances in the treatment of these conditions. Here, we collate the diagnostic approaches and techniques currently employed for biochemical and molecular assessment of at‐risk individuals in whom abnormal copper metabolism is suspected. Curr. Protoc. Hum. Genet. 70:17.9.1‐17.9.33 © 2011 by John Wiley & Sons, Inc.

Keywords: catechols; copper; Menkes disease; Multiplex Ligation‐Dependent Probe Amplification; multiplex polymerase chain reaction; polymerase chain reaction; Wilson disease

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Plasma Catechol Patterns to Diagnose Menkes Disease
  • Basic Protocol 2: Copper Uptake and Retention in Fibroblasts to Diagnose Menkes Disease
  • Basic Protocol 3: Multiplex PCR for Detection of Large ATP7A Deletions
  • Basic Protocol 4: PCR and Sequencing for Detection of Small ATP7A Alterations
  • Alternate Protocol 1: Multiplex Ligation‐Dependent Probe Amplification (MLPA) to Detect ATP7A Deletions and Duplications
  • Basic Protocol 5: PCR and Sequencing for ATP7B Mutation Analysis
  • Alternate Protocol 2: MLPA Test for ATP7B
  • Basic Protocol 6: Ceruloplasmin (CP) Gene Mutation Analysis
  • Basic Protocol 7: CCS Gene Mutation Analysis
  • Basic Protocol 8: CTR1 Gene Mutation Analysis
  • Basic Protocol 9: ATOX1 Gene Mutation Analysis
  • Alternate Protocol 3: Chorionic Villus Specimen Copper Level
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Plasma Catechol Patterns to Diagnose Menkes Disease

  Materials
  • Mobile phase (see recipe)
  • HPLC grade (Type I) water (prepared using, e.g., the Milli‐Q system)
  • 20/80 (see recipe)
  • STD MIX (see recipe)
  • Sample, prepared (see recipe)
  • Alumina, acid‐washed, activity grade I (ICN Biomedicals)
  • Tris‐EDTA buffer (see recipe)
  • DHBA internal standard (see recipe for Standards)
  • Waters HPLC pump, Model 510 or 515
  • Waters 717‐plus Autosampler (WISP) with refrigeration unit
  • Axxi‐chrom 5 µm 4.6 × 250 mm C18 reversed phase analytical column (Axxiom; http://www.axxiomchromatography.com/)
  • ESA Coulochem II or III with conditioning and analytical cells (Dionex)
  • Column Temperature Controller (Cera)
  • Refrigerated centrifuge
  • 250‐µl disposable limited‐volume inserts for WISP vials (Waters)
  • Mechanical shaker
  • Autosampler (WISP) vials (Waters)
  • Data acquisition software‐Waters Empower Pro System (PC)

Basic Protocol 2: Copper Uptake and Retention in Fibroblasts to Diagnose Menkes Disease

  Materials
  • Fetal bovine serum (FBS; Invitrogen, cat. no. 10106‐169, or Sigma, cat. no. F7524)
  • F12 supplement (Invitrogen, cat. no. 21765‐29)
  • Pen‐strep (Invitrogen, cat. no. 15140‐122)
  • Glutamax (Invitrogen, cat. no. 35050‐038)
  • Tylosin (Sigma, cat. no. T3397)
  • 500 IE/ml amphotericin B
  • Cells:
    • Fibroblast cultures obtained from the patients in question
    • Controls (at least two fibroblast cultures from known Menkes patients, and at least two fibroblast cultures from normal controls)
  • 64Cu (250 MBq, 250 µg Cu/ml, specific activity: 1.33 TBq/g; Risø National Laboratory for Sustainable Energy, Technical University of Denmark, http://www.risoe.dtu.dk/)
  • 0.02 mM EDTA (Titriplex R 3; Merck, cat. no. 8418) in 0.9% NaCl
  • 0.9% (w/v) NaCl
  • 10% NaOH
  • Lowry protein assay kit (available from various suppliers; also see Schacterle and Pollack, )
  • Hionic‐Fluor scintillation cocktail (PerkinElmer, cat. no. )
  • 56° and 80°C water bath
  • 24‐well tissue culture plates
  • Plate sealers for 24‐well plates
  • Vortex mixer
  • β‐scintillation counter (Beckman LS 5000 C3)
  • Additional reagents and equipment for basic cell culture techniques including trypsinization ( appendix 3G)

Basic Protocol 3: Multiplex PCR for Detection of Large ATP7A Deletions

  Materials
  • ∼300 ng/µl genomic DNA (isolated from whole blood using Wizard Genomic DNA Purification Kit from Promega)
  • Primer Set A:
    • Exon 10 Forward: ATATATGTGAATTTCAGCATTTTTTAA
    • Exon 10 Reverse: ATGTATTTCCAATGATTGGCC
    • Exon 20 Forward: TATTGCTCAGTTATGTTTCACGTACT
    • Exon 20 Reverse: GATTATCATTGACCACATAGGGC
    • Exon 22 Forward: ATGCTGAAGAAGTATCAAACAAAGAAA
    • Exon 22 Reverse: CAAGAATAAAACCTACCAAGAATGAC
  • Primer Set B:
    • Exon 1 Forward: GGGGGTGGGAAAAGAGAAGC
    • Exon 1 Reverse: CATGACCTTCTCACCACACTCGT
    • Exon 16 Forward: TTTCTGGAAAGGTGATGTGGA
    • Exon 16 Reverse: TAGATTTGATCCGGGGAATTC
    • Exon 17 Forward: AATTAACTAGGGGTTTTTATCTTGC
    • Exon 17 Reverse: CAGGGTTATAAAGTTAGCCATCTG
  • Primer Set C:
    • Exon 5 Forward: GATGCAATTGAATGATCAATACTGC
    • Exon 5 Reverse: TGTAAGAGAACAAAAAAGATGGAGCT
    • Exon 12 Forward: GCATATTATCATGGTGCTTTTTAT
    • Exon 12 Reverse: CTCTCTGTTCATAATTTAGTTATTCATAGC
    • Exon 23 Forward: TCTCATTTACTTTTGGTTATTTGAAACT
    • Exon 23 Reverse: AGTGCATGACAAGTTAAACTGGC
  • Primer Set D:
    • Exon 18 Forward: GAACTTGCTTCATGGGGTTT
    • Exon 18 Reverse: AGAGGTCTCTCAAAAATAAATAAATTAAT
    • Exon 21 Forward: AAGGTAGACGTAATCTTCAACATACACAG
    • Exon 21 Reverse: ATGGCTTTAGTGGAAAAAGCAGTACTAGT
  • Primer Set E:
    • Exon 2 Forward: GCATGGCTGAAATTAATGAATTT
    • Exon 2 Reverse: CTTCAATGGCATTTGACTTCAGT
    • Exon 7 Forward: AGTGGTAACTCATGTTTAATGGTGGA
    • Exon 7 Reverse: GATTCACGGGAGTGCTGATTAAA
    • Exon 19 Forward: TATTCCAAGTTCTTTTATTTTGTGCTG
    • Exon 19 Reverse: AAATTTCTTAGCATTTGAAGGCAAG
  • Primer Set F:
    • Exon 3 Forward: TGTGATAGAATTTAATTAAACTGACTTTTG
    • Exon 3 Reverse: AAACTCATGCTTAAGAAGAAAGCAA
    • Exon 4 Forward: GTGGTTATTGATTTAGAAAACAGAATG
    • Exon 4 Reverse: TGCCTATGAATCATTTCTCATTGA
    • Exon 14 Forward: TACTCTGCATTCAGTATCAGAAAAGACTT
    • Exon 14 Reverse: CACTCCAAACCTTTAAAGATCCTGGT
  • Primer Set G:
    • Exon 8/9 Forward: GTTCTTAATGACAATACCATGGCTTAG
    • Exon 8/9 Reverse: GCCTGCCAAATTTTGCTTATT
    • Exon 11 Forward: AGACCTGAACTTTTTCTTCCTTAGC
    • Exon 11 Reverse: TAAAAAAAGAGAAGAGGGAAGAGTG
    • Exon 15 Forward: TTGTACAGCTCTAAATCAATAACCA
    • Exon 15 Reverse: GTGCTATTGATAGTTTGGTGGTAC
  • Primer Set H:
    • Exon 6 Forward: TTTCATACTTGATAATACTAAGAAGTAAT
    • Exon 6 Reverse: CAACTCTTCTCTGAACCTTACCAAG
    • Exon 13 Forward: AACAAATAATGATATGTTTCATGATAGTG
    • Exon 13 Reverse: GTGAAGATTTATACTGAGAAGGCTTTA
  • Buffer D (Invitrogen)
  • 10 mM dNTP mix (Invitrogen)
  • 5 U/µl Platinum High‐Fidelity Taq DNA Polymerase (Invitrogen)
  • NuSieve agarose (Lonza)
  • 1× TBE buffer ( appendix 2D)
  • 10 mg/ml ethidium bromide solution (Invitrogen)
  • 6× gel loading buffer ( appendix 2D)
  • GeneRuler DNA Ladder Mix (Fermentas)
  • PCR tubes
  • PCR thermal cycler (Applied Biosystems GeneAmp PCR system 9700)
  • Gel tray (e.g., 15 × 10–cm; also see unit 2.7)
  • Gel combs (3.5 to 4.5 mm wide; also see unit 2.7)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7)

Basic Protocol 4: PCR and Sequencing for Detection of Small ATP7A Alterations

  Materials
  • 5× Q‐solution (Qiagen)
  • 10× PCR buffer containing 15 mM MgCl 2 (Qiagen, cat. no. 1005479), for exon 1
  • Hot Start Taq DNA polymerase (Qiagen, cat. no. 203205)
  • Primer mix for PCR amplification (forward and reverse, 10 µM each; Table 17.9.1)
  • Genomic DNA extracted from blood or fibroblasts (for the MLPA test, EDTA blood gives the best result)
  • 10× PCR buffer containing 15 mM MgCl 2 (Applied Biosystems, cat. no. 4396)
  • AmpliTaq Gold DNA polymerase (Applied Biosystems, cat. no. N808‐0248)
  • Agarose (Sigma, cat.no.A6013)
  • 1× TBE buffer ( appendix 2A)
  • 10 mg/ml ethidium bromide
  • DNA size standard ladder
  • 0.04% (w/v) resol red loading buffer (Sigma‐Aldrich cat. no. 318841)
  • Millipore DNA Purification Kit
  • Primers pS and pC:
    • acccactgcttactggcttatc (pS) for all forward reactions
    • gaggggcaaacaacagatggc (pC) for all reverse reactions
  • BigDye Terminator v3.1 Cycle Sequencing Kit, 4337035 rev A
  • Injection solution (Millipore, cat. no. LSKS 09624)
  • PCR thermal cycler Applied Biosystems GeneAmp PCR system 9700
  • 1000‐ml conical flask
  • 50‐ml conical polypropylene centrifuge tubes (e.g., BD Falcon)
  • 10 × 11–cm gel tray.
  • Gel combs for 10‐µl wells
  • Multiscreen (Millipore, to be used for purification prior to sequencing)
  • Seqscape/Gene Marker v.1.95 (Applied Biosystems)
  • ABI 3130XL Genetic Analyzer (Applied Biosystems)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7)
    Table 7.9.1   Materials   Primers for PCR Amplification, ATP7A Gene a   Primers for PCR Amplification, ATP7A Gene

    Exon Primers b Sequence c Expected fragment size (bp)
    1 MNKex1L acccactgcttactggcttatcCATCACCCGGAAGTGGG 385
    MNKex1R gaggggcaaacaacagatggcCGAGACTGCCCCAGACTAAC
    2 MNKex2L acccactgcttactggcttatcCAACTTTCCTTTACTTCATCTAAGG 501
    MNKex2R gaggggcaaacaacagatggcTTGCCAAATGTGTCAGTGTG
    3 MNKex3aL acccactgcttactggcttatcTCAAATGCCTGATAGGTACCAC 683
    MNKex3aR gaggggcaaacaacagatggcCTTCAGCACGACTTCACCAG
    MNKex3bL acccactgcttactggcttatcATTGCTGAAGACCAAGGGTG 442
    MNKex3bR gaggggcaaacaacagatggcCTCTAGTCTCATGGATTC
    4 MNKex4aL acccactgcttactggcttatcTTTCTAGTCTATGCCAATAACATTTTC 559
    MNKex4aR gaggggcaaacaacagatggcTCACAATGGCAGACCTATTCTC
    MNKex4bL acccactgcttactggcttatcTCACAGCAAAGGAGTCCATC 404
    MNKex4bR gaggggcaaacaacagatggcTGCCATCAATGTTTATCACAG
    MNKex4cL acccactgcttactggcttatcATAGAGGCTGTATCACCGGG 528
    MNKex4cR GaggggcaaacaacagatggcCTGCTGGCTACCTCCATAGG
    5 MNKex5L acccactgcttactggcttatcGGAATAGATTGTCAGTGCCTGG 472
    MNKex5R gaggggcaaacaacagatggcTGAAAATCTTTATGAGGCCTTACC
    6 MNKex6L acccactgcttactggcttatcTTCTCCAGATTCAAATCCTTTAATAC 468
    MNKex6R GaggggcaaacaacagatggcCCTTCCATTTTCCAGTTTCC
    7 MNKex7L acccactgcttactggcttatcTGGTAACTCATGTTTAATGGTGG 341
    MNKex7R GaggggcaaacaacagatggcAACCAGAAATGATTCACGGG
    8 MNKex8L acccactgcttactggcttatcCCAGAGTGACTTGCCCTCAG 358
    MNKex8R gaggggcaaacaacagatggcGATATACATTGTGACCATTTCATCC
    9 MNKex9L acccactgcttactggcttatcTGGATGAAATGGTCACAATG 496
    MNKex9R gaggggcaaacaacagatggcGCATATGGCATAAAATGATCAGAC
    10 MNKex10L acccactgcttactggcttatcCGATTGTTTTGGCTTAATCTCC 548
    MNKex10R gaggggcaaacaacagatggcTGAAAATACGTCTTTCAGTAAATGG
    11 MNKex11L acccactgcttactggcttatcAAAGCTGTCTTTTGGGTAAATG 383
    MNKex11R gaggggcaaacaacagatggcTGAAGTATGGCAAAATGTGG
    12 MNKex12L acccactgcttactggcttatcTGGTTCTAGCTTCCATTGGC 462
    MNKex12R gaggggcaaacaacagatggcAACTAAAGCCACAAAGTAAATCTGAG
    13 MNKex13L acccactgcttactggcttatcTTTCACCTAGGCATTTGTTCAG 444
    MNKex13R gaggggcaaacaacagatggcAAACGAACTCCATATTAATGCAAC
    14 MNKex14L acccactgcttactggcttatcCACCACACCTGGCCATTAAC 440
    MNKex14R gaggggcaaacaacagatggcTCACTCTCCCACTCCAAACC
    15 MNKex15L acccactgcttactggcttatcTTCTGGAATCTCAGTATGTCCC 628
    MNKex15R gaggggcaaacaacagatggcAACAAAGGCCAATCTGAAGC
    16 MNKex16L acccactgcttactggcttatcGTTCAGCATTGGCAGAGGAG 667
    MNKex16R gaggggcaaacaacagatggcTGTCAACAGGAGTTATCTGTGTG
    17 MNKex17L acccactgcttactggcttatcATCAAAATCCACTGTCAAGTAGG 534
    MNKex17R gaggggcaaacaacagatggcGGCATAGGGTATTGACTTGAGG
    18 MNKex18L acccactgcttactggcttatcACAATGTAGTGACTGTGCAAGG 403
    MNKex18R gaggggcaaacaacagatggcTTCAAGATGCTTTTGAATAACCC
    19 MNKex19L acccactgcttactggcttatcTTAAGTTAAGCCATGCCCTG 460
    MNKex19R gaggggcaaacaacagatggcAAGCATGGTAAATTTTCTTGAAGG
    20 MNKex20L acccactgcttactggcttatcATGTGGACATCTTGTGGGTG 467
    MNKex20R gaggggcaaacaacagatggcAATGGCTGATAGCATGGAAC
    21 MNKex21L acccactgcttactggcttatcGCTGAGTCTAAGTTTTAGCATTATCTG 450
    MNKex21R gaggggcaaacaacagatggcAACATTACCTCTCACCATACCAG
    22 MNKex22L acccactgcttactggcttatcCCACCAAGAGGATAAATGCTG 373
    MNKex22R gaggggcaaacaacagatggcAATGGTTTGGGCTTATCATTG
    23 MNKex23L acccactgcttactggcttatcCCACACAATTCGTTTCAAGC 629
    MNKex23R gaggggcaaacaacagatggcTGCCAACAGATAAACGCAAC

     aAll forward primers are tagged with the sequence acccactgcttactggcttatc (pS) and all reverse primers with the sequence gaggggcaaacaacagatggc (pC) respectively. Because exon 3 and exon 4 are very large they are amplified in overlapping Fragments 3a, 3b and 4a, 4b, 4c respectively.
     bL:forward; R:reverse.
     cLowercase letters:universal tags; uppercase letters:gene‐specific tags.

Alternate Protocol 1: Multiplex Ligation‐Dependent Probe Amplification (MLPA) to Detect ATP7A Deletions and Duplications

  • SALSA MLPA kit P104, Menkes disease (MRC‐Holland; http://www.mrc‐holland.com)
  • Formamide
  • ROX500 standard (Applied Biosystems, cat. no. 401734)
  • ABI 3130XL Genetic Analyzer (Applied Biosystems)
  • Gene Marker software (SoftGenetics, http://www.softgenetics.com)

Basic Protocol 5: PCR and Sequencing for ATP7B Mutation Analysis

  Materials
  • ATP7B primers for exon PCR amplification (Table 17.9.2)
  • Additional reagents and equipment for PCR and sequencing of ATP7A ( protocol 4)
    Table 7.9.2   MaterialsPrimers for PCR Amplification, ATP7B Gene

    Exon Primer d Sequence e Expected fragment size (bp)
    1 WNDex1L acccactgcttactggcttatcGCAACTTTGAATCATCCGTG 381
    WNDex1R gaggggcaaacaacagatggcAACGCGGGGAGGAAAATC
    2 WNDex2aL acccactgcttactggcttatcCACCAGTGGCATTGTTTTCC 508
    WNDex2aR gaggggcaaacaacagatggcAAGGACCTTGAGGGCCAG
    WNDex2bL acccactgcttactggcttatcTGTGAAATATGTGCCATCGG 463
    WNDex2bR gaggggcaaacaacagatggcGCAGAAGATAAAGGTCTCTTTGG
    WNDex2cL acccactgcttactggcttatcAGCTGCCATCAAGAGCAAAG 459
    WNDex2cR gaggggcaaacaacagatggcGGGAATGAGAACTGGAAGACC
    WNDex2dL acccactgcttactggcttatcTCTGCAGAGGGCTATCGAG 514
    WNDex2dR gaggggcaaacaacagatggcCCACTGTTGACATGGGAGG
    3 WNDex3L acccactgcttactggcttatcCGGGACAATGAACCCTCAC 512
    WNDex3R gaggggcaaacaacagatggcTGCTACCTGGTTATCAGGGC
    4 WNDex4L acccactgcttactggcttatcTTTGAAAACTGCTGTTCTAGAGG 435
    WNDex4R gaggggcaaacaacagatggcACCAGACACGTCCAAGATGG
    5 WNDex5L acccactgcttactggcttatcGGAAAGGCTCTTGGCTGC 435
    WNDex5R gaggggcaaacaacagatggcTTCCATGGGAAAAGTTGAAG
    6 WNDex6L acccactgcttactggcttatcCCCACAAAGTCTACTGAGGC 350
    WNDex6R gaggggcaaacaacagatggcAAGGCACCATGGGAAGAC
    7 WNDex7L acccactgcttactggcttatcTCCCAGACATGTGACAAAGG 443
    WNDex7R gaggggcaaacaacagatggcAAAGTGCCATTTAAACCAAGC
    8 WNDex8L acccactgcttactggcttatcATAAACGCCCATCACAGAGG 567
    WNDex8R gaggggcaaacaacagatggcGCACCTTAATTATATGGAGGTTTCC
    9 WNDex9L acccactgcttactggcttatcGCTGTTTCTCTCGCACCAG 359
    WNDex9R gaggggcaaacaacagatggcTCTCTGCCCACACTCACAAG
    10 WNDex10L acccactgcttactggcttatcAACAGATCAAATGAATACTGTTGC 444
    WNDex10R gaggggcaaacaacagatggcTGCTTCCGGGTTTCTTAGTG
    11 WNDex11L acccactgcttactggcttatcATGGCTTGTTTCATGTTCCC 453
    WNDex11R gaggggcaaacaacagatggcCAAGCATGGATAAAGATTGGG
    12 WNDex12L acccactgcttactggcttatcTGTGAAGAGTTCTGGGAAATCAG 487
    WNDex12R gaggggcaaacaacagatggcGGCTTAGATTTTGCTGTCAATAAG
    13 WNDex13L acccactgcttactggcttatcGGATAGCTGGGATGTGGAGA 521
    WNDex13R gaggggcaaacaacagatggcTGAGTGGCTCTCAGGCTTTT
    14 WNDex14L acccactgcttactggcttatcTGCAGGTGTCTTGTTTCCTG 456
    WNDex14R gaggggcaaacaacagatggcTGGTTTTCCAGACCACACAG
    15 WNDex15L acccactgcttactggcttatcCTCTCTTGCCACCTTCACCC 432
    WNDex15R gaggggcaaacaacagatggcCCTTAGCCATGAACCGTCTG
    16 WNDex16L acccactgcttactggcttatcTGCTGTCACAAGAGGTGCTTAC 456
    WNDex16R gaggggcaaacaacagatggcCAGGCCTGAAATTAAGAGAGG
    17 WNDex17L acccactgcttactggcttatcGACTTTTGTGTACATCCGTAAATG 529
    WNDex17R gaggggcaaacaacagatggcGCAACACTACATGGCCACAG
    18 WNDex18L acccactgcttactggcttatcCAACATCACTGACTGGACCC 477
    WNDex18R gaggggcaaacaacagatggcTGAATGCTAGCCACCACATC
    19 WNDex19L acccactgcttactggcttatcAGCCGACGTCGTCCTTATC 378
    WNDex19R gaggggcaaacaacagatggcCTAAAACGCCTCTAGCCAGC
    20 WNDex20L acccactgcttactggcttatcCACGCCAGGTGGAGACC 375
    WNDex20R gaggggcaaacaacagatggcTTGTCCCAGGTGAATGAATG
    21 WNDex21L acccactgcttactggcttatAAAAGCCTTGTTTCTAGAAT 476
    WNDex21R gaggggcaaacaacagatggcAGTCCCCAAAGCTGGAGG

     dL:forward; R:reverse.
     eLowercase letters:universal tags; uppercase letters:genespecific tags.

Alternate Protocol 2: MLPA Test for ATP7B

  Materials
  • ∼300 ng/µl genomic DNA (isolated from whole blood using Wizard Genomic DNA Purification Kit from Promega)
  • 10 µM ceruloplasmin oligonucleotide primers (5′ to 3′):
    • Exon 1 Forward: CTGCCCTCCTGGAATTTACACAATG
    • Exon 1 Reverse: TGTCTTGGGTTTCAAGCCCACA
    • Exon 2 Forward: CAGGCAAACATTCAATGTGATGTGC
    • Exon 2 Reverse: GGAAATTCCAGCTACATGAGCTG
    • Exon 3 Forward: ACTTTGCACCTTCATTGCATGTTGC
    • Exon 3 Reverse: ACAAACTGCCCTGCCCCTGT
    • Exon 4 Forward: AACAGGAGTGACTGGTCCAGACTT
    • Exon 4 Reverse: AAGGACCACAGACTAGACACACAGT
    • Exon 5 Forward: AGGGGGCAAGAATACCAGCATGT
    • Exon 5 Reverse: CCCAGTAACCACCTTTTTCAGCTGA
    • Exon 6 Forward: CCCGAGCAGTGTTTACAGGGC
    • Exon 6 Reverse: CCTTTGTGCGGGGGAGAGCAT
    • Exon 7 Forward: GTCAAGGGGTTGAAGGGGCCCT
    • Exon 7 Reverse: CCCATGGGAAGAGTAAACCAGCCA
    • Exon 8 Forward: GGGACAAATGACACACCTCCAGCC
    • Exon 8 Reverse: CGGTTTCCTTGGGAGTTCCTGCC
    • Exon 9 Forward: AGGTGCTAGGGACATTCCCGGAA
    • Exon 9 Reverse: ATGTTGGGGACCCCTGTGTTAAATG
    • Exon 10 Forward: TCCCTGATTTCCAGCACAGACCCA
    • Exon 10 Reverse: TGAGCCTGTCATTTTTGAGCCAAAA
    • Exon 11 Forward: AGCCAGCGGCTGCTCTGAAATG
    • Exon 11 Reverse: AGGGCACTTCAGAGGCTTGGGGA
    • Exon 12 Forward: GGAGAGCCCCAGAGGGCACTAG
    • Exon 12 Reverse: GCACATGAATGTGAGAAGACACTCC
    • Exon 13 Forward: GCCAGGACTCAGATGGCTGCAC
    • Exon 13 Reverse: TTGACGGTTACTGCAGGTAGCATCA
    • Exon 14 Forward: ACCACAAACCCATGGGGGAGAGAA
    • Exon 14 Reverse: AGACACCTCCTTGCATCCCCTCT
    • Exon 15 Forward: TGACATTTCCAGTTCCTGGGTCCT
    • Exon 15 Reverse: GTCTTGTGTGTCATAGGTAGCAGCA
    • Exon 16 Forward: TTCCTGAGGCCCTGGGTGCA
    • Exon 16 Reverse: ACCTGACATACAAAGTGAGGCAGAA
    • Exon 17 Forward: ACCACTTCTGCCTCACTTTGTATGT
    • Exon 17 Reverse: TGTGTCAATTGAAATTGCTGTGCCT
    • Exon 18 Forward: CACACCCACTTGATGTGGATACCA
    • Exon 18 Reverse: AGGGCAGCAGATTCACAAATGCT
    • Exon 19 Forward: CGG ATC ATG TAC TGC ATT GTT GCC
    • Exon 19 Reverse: GGTGTGATGTCAACAGCATGTT
  • 10× High Fidelity PCR Buffer (Invitrogen)
  • 10 mM dNTP mix (Invitrogen)
  • 50 mM MgSO 4
  • 5 U/µl Platinum Taq DNA Polymerase High Fidelity (Invitrogen)
  • PCR‐grade water
  • NuSieve agarose (Lonza)
  • 1× TBE Buffer
  • 10 mg/ml ethidium bromide (Invitrogen)
  • 6× gel loading buffer ( appendix 2D)
  • GeneRuler DNA Ladder Mix (Fermentas)
  • QIAquick PCR Purification Kit (Qiagen)
  • PCR tubes
  • Thermal cycler
  • 10 × 15–cm gel tray
  • Gel combs for 20‐µl wells
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7)

Basic Protocol 6: Ceruloplasmin (CP) Gene Mutation Analysis

  Materials
  • ∼250 ng/µl genomic DNA (isolated from whole blood; appendix 3B)
  • 5 pmol/µl CCS oligonucleotide primers (5′ to 3′):
    • Exon 1 Forward: CCA GGA ACA GAA AGC CG
    • Exon 1 Reverse: CCC AAC CCA AGT GCC C
    • Exon 2 Forward: GGC TTG TTC CCA GAC CCT TG
    • Exon 2 Reverse: GCC TTT CAC TCT CTG GGG TTC
    • Exon 3‐4 Forward: GAG GCT TAC TCA GGG TTA CAC AG
    • Exon 3‐4 Reverse: GGT TGT GCC TGT GTG TAT GTG C
    • Exon 5 Forward: GTC TGA TTC TTC TCG GTG CCC
    • Exon 5 Reverse: CCA CCA AAA AGG AAT CAC ACT G
    • Exon 6‐7 Forward: CAC TTT CCA CTT CCA GAC AGG GC
    • Exon 6‐7 Reverse: CAG AAG AAT GTG TGG TCA GGG GTG GG
    • Exon 7‐8 Forward: CAT CAT CTG AAG CTG TCG TCT CCC
    • Exon 7‐8 Reverse: GGC TCC AAT GCT AAG GGG TG
    • Exon 3seq Reverse: CCT CAA AGC CAC TCC AAC CC
    • Exon 4seq Forward: GGG TTG GAG TGG CTT TGA GG
  • 10× PCR buffer
  • 3.75 mM dNTP mix (Peqlab, http://www.peqlab.com)
  • 5 U/µl Taq DNA Polymerase (Qiagen)
  • PCR‐grade water
  • Agarose (Bioline)
  • 1× TAE buffer ( appendix 2D)
  • 10 mg/ml ethidium bromide (Invitrogen) or 0.5% (v/v] GelRed Nucleic Acid Stain (Biotrend)
  • 1× gel loading buffer ( appendix 2D)
  • GeneRuler DNA Ladder Mix (Fermentas)
  • High Pure PCR Product Purification Kit (Roche)
  • DNA Dye Terminator Cycle Sequencing Kit (Applied Biosystems)
  • ABI 377 semi‐automated sequencer (Applied Biosystems)
  • DNASTAR 5.07 software (http://www.dnastar.com)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7)

Basic Protocol 7: CCS Gene Mutation Analysis

  Materials
  • ∼300 ng/µl genomic DNA (isolated from whole blood using Wizard Genomic DNA Purification Kit from Promega)
  • CTR1 oligonucleotide primers at 10 µM (5′ to 3′):
    • Exon 1 Forward: TTGCAGGGATTGGTCGGTAATGC
    • Exon 1 Reverse: ACAGGGGTGCGAAAGAGGG
    • Exon 2 Forward: CTGATCAGTAGTGGGATCATGCC
    • Exon 2 Reverse: TACCCAAGTGGGTGGGAAAG
    • Exon 3 Forward: GGTGCCTGTGGTGGTAACGCT
    • Exon 3 Reverse: AGAAAGAGGTGCTGGACTTC
    • Exon 4 Forward: CAGCACATTGGCTAATGATT
    • Exon 4 Reverse: AAGAAGAGGGCTGCTGCTGATTC
    • Exon 5 Forward: TGCAGAGAATCTAGGAGTCC
    • Exon 5 Reverse: GCTCTAGAACTGCAATCGATAAGGCCACGA
  • 10× High Fidelity PCR Buffer (Invitrogen)
  • 10 mM dNTP mix (Invitrogen)
  • 50 mM MgSO 4
  • 5 U/µl Platinum Taq DNA Polymerase High Fidelity (Invitrogen)
  • PCR‐grade H 2O
  • NuSieve agarose (Lonza)
  • 1× TBE buffer ( appendix 2D)
  • 10 mg/ml ethidium bromide (Invitrogen)
  • 6× gel loading buffer ( appendix 2D)
  • GeneRuler DNA Ladder Mix (Fermentas)
  • QIAquick PCR Purification Kit (Qiagen)
  • Appropriate gel‐casting tray and combs
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7)

Basic Protocol 8: CTR1 Gene Mutation Analysis

  Materials
  • ∼300 ng/µl genomic DNA (isolated from whole blood using Wizard Genomic DNA Purification Kit from Promega)
  • ATOX1 oligonucleotide primers at 10 µM (5′ – 3′):
    • Exon 1 Forward: AGGCGCTGCTGACACCGCCG
    • Exon 1 Reverse: TTCAAGATCAGCATCCGGTC
    • Exon 2 Forward: AGGCTTCTGATGAGTCTGATGC
    • Exon 2 Reverse: TCTGCATGCATCTGAACATG
    • Exon 3 Forward: TGAGTAGTAATTTAGAGCCTG
    • Exon 3 Reverse: AGGTGTTCGCTCTGATGAGAG
  • 10× High Fidelity PCR Buffer (Invitrogen)
  • 10 mM dNTP mix (Invitrogen)
  • 50 mM MgSO 4
  • 5 U/µl Taq DNA Polymerase High Fidelity (Invitrogen)
  • PCR‐grade water
  • NuSieve agarose (Lonza)
  • 1× TBE buffer ( appendix 2D)
  • 10 mg/ml ethidium bromide (Invitrogen)
  • 6× gel loading buffer ( appendix 2D)
  • GeneRuler DNA Ladder Mix (Fermentas)
  • QIAquick PCR Purification Kit (Qiagen)
  • Appropriate gel‐casting tray and combs
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Desai, V., Donsante, A., Swoboda, K.J., Martensen, M., Thompson, J., and Kaler, S.G. 2011. Favorably skewed X‐inactivation accounts for neurological sparing in female carriers of Menkes disease. Clin. Genet. 79:176‐182.
   Goldstein, D.S., Holmes, C.S., and Kaler, S.G. 2009. Relative efficiencies of plasma catechol levels and ratios for neonatal diagnosis of Menkes disease. Neurochem. Res. 34:1464‐1468.
   Hahn, S.H., Brantley, M.L., Oliver, C., Adamson, M., Kaler S.G., and Gahl, W.A. 1994. Metallothionein synthesis and degradation in Indian childhood cirrhosis fibroblasts. Pediatr. Res. 35:197‐204.
   Harris, Z.L., Klomp, L.W., and Gitlin, J.D. 1998. Aceruloplasminemia: An inherited neurodegenerative disease with impairment of iron homeostasis. Am. J. Clin. Nutr. 67:972S‐977S.
   Heydorn, K., Damsgaard, E., and Horn, N. 1999. Accumulated experience with prenatal diagnosis of Menkes disease by neutron activation analysis of chorionic villi specimens. Biol. Trace Elem. Res. 71‐72:551‐561.
   Holmes, C., Eisenhofer, G., and Goldstein, D.S. 1994. Improved assay for plasma dihydroxyphenylacetic acid and other catechols using high‐performance liquid chromatography with electrochemical detection. J. Chromatog. Biomed. Applic. 653:131‐138.
   Huppke, P., Brendel, C., Korenke, C., Marquart, I., Elpeleg, O., Moller, L.B., Christodoulou, J., Kaler, S., and Gartner, J. 2010. Mutation in CCS, the copper chaperone for superoxide dismutase (SOD1), implies a novel disorder of human copper metabolism. American Society of Human Genetics Annual Meeting. Abstract #207.
   Kaler, S.G. 2010 Wilson disease. In Cecil's Textbook of Medicine. 24th edition (L. Goldman, D. Ausiello, W. Arend, J.O. Armitage, D. Clemmons, J. Drazen, R. Griggs, N. LaRusso, J. Newman, and E. Foster, eds.). Saunders, Philadelphia.
   Kaler, S.G. 2011 The neurology of ATP7A copper transporter disease: emerging concepts and future trends. Nat. Rev. Neurol. 7:15‐29.
   Kaler, S.G. and Tümer, Z. 1998. Invited commentary: The prenatal diagnosis of Menkes disease. Prenatal Diagn. 18:287‐289.
   Kaler, S.G., Goldstein, D.S., Holmes, C., Salerno, J.A., and Gahl, W.A. 1993a. Plasma and cerebrospinal fluid neurochemical pattern in Menkes disease. Ann. Neurol. 33:171‐175.
   Kaler, S.G., Westman, J.A., Bernes, S.M., Elsayed, A.M., Bowe, C.M., Freeman, K.L.B., Wu, C.D., and Wallach, M.T. 1993b. Gastrointestinal hemorrhage associated with gastric polyps in Menkes disease. J. Pediatr. 122:93‐95.
   Kaler, S.G., Holmes, C.S., Goldstein, D.S., Tang, J., Godwin, S.C., Donsante, A., Liew, C.J., Sato, S., and Patronas, N. 2008. Neonatal diagnosis and treatment of Menkes disease. N. Engl. J. Med. 358:605‐614.
   Liu, P‐C, McAndrew, P.E., and Kaler, S.G. 2002. Rapid and robust screening of the Menkes disease/occipital horn syndrome gene. Genet.Testing 6:255‐260.
   Liu, P.C., Chen, Y.W., Centano, J., Quesado, M., Lem, K.E., and Kaler, S.G. 2005. Downregulation of myelination, energy, and translational genes in Menkes disease brain. Molec. Genet. Metab. 85:291‐300.
   Møller, L.B., Mogensen, M., and Horn, N. 2009 Molecular diagnosis of Menkes disease: Genotype‐phenotype correlation. Biochimie 91:1273‐1277
   Schacterle, G.P. and Pollack, R.L. 1973. A simplified method for quantitative assay of small amount of protein in biological material. Anal. Chem. 51:654.
   Schilsky, M.L. 2009. Wilson disease: Current status and the future. Biochimie 91:1278‐1281.
   Schouten, J.P., McElgunn, C.J., Waaijer, R., Zwijnenburg, D., Diepyens, F., and Pals, G. 2002. Relative quantification of 40 nuclei acid sequences by multiplex ligation‐dependent probe amplification. Nucleic Acids Res. 30:57.
   Tønnesen, T. and Horn, N. 1989. Prenatal and postnatal diagnosis of Menkes disease an inherited disorder of copper metabolism. J. Inher. Metab. Dis. 12:207‐214.
   Tümer, Z. and Møller, L.B. 2010. Menkes disease. Eur. J. Hum. Genet. 18:511‐518.
   White, S.R., Reese, K., Sato, S., and Kaler, S.G. 1993. Spectrum of EEG findings in Menkes disease. Electroenceph. Clin. Neurophysiol. 87:57‐61.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library