Improved Protocols for Illumina Sequencing

Iraad F. Bronner1, Michael A. Quail1, Daniel J. Turner2, Harold Swerdlow1

1 Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, United Kingdom, 2 Oxford Nanopore Technologies, Oxford, United Kingdom
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 18.2
DOI:  10.1002/0471142905.hg1802s80
Online Posting Date:  January, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

In this unit, we describe a set of improvements that have been made to the standard Illumina protocols to make the sequencing process more reliable in a high‐throughput environment, reduce amplification bias, narrow the distribution of insert sizes, and reliably obtain high yields of data. Curr. Protoc. Hum. Genet. 80:18.2.1‐18.2.42. © 2014 by John Wiley & Sons, Inc.

Keywords: Illumina; next‐generation; sequencer; protocols

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Fragmentation
  • Basic Protocol 2: DNA Cleanup Using Columns (Low‐Throughput)
  • Alternate Protocol 1: DNA Cleanup Using Ampure XP Beads (Automation Friendly)
  • Alternate Protocol 2: Ampure Bead Double DNA Size Selection
  • Alternate Protocol 3: Gel Size Selection
  • Basic Protocol 3: Preparation of the Adapter‐Ligated DNA Library
  • Support Protocol 1: Verification of Adapter Ligation of the Library
  • Basic Protocol 4: PCR Amplification of the Library
  • Alternate Protocol 4: Direct Sequencing of Short Amplicons
  • Alternate Protocol 5: Direct Sequencing of Low Amounts of DNA Using Illumina's Nextera Kit
  • Alternate Protocol 6: Sequencing Without PCR
  • Basic Protocol 5: Quantification Using SYBR Green
  • Basic Protocol 6: Denaturation of Templates
  • Support Protocol 2: Amplification Quality Control
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Fragmentation

  Materials
  • DNA sample
  • EB buffer (from QIAquick PCR purification kit; Qiagen, cat. no. 28104)
  • Covaris S2 or equivalent with chiller unit
  • Qubit Fluorometer (Life Technologies, cat. no. Q32866) and Qubit Assay Kit, e.g., dsDNA BR Assay (Life Technologies, cat. no. Q32850) or other fluorometric‐based method (e.g. using PicoGreen dye)
  • 6‐mm × 16‐mm AFA fiber vials (Covaris, cat. no. 520045)
  • Crimp caps (Covaris, cat no. 520028)

Basic Protocol 2: DNA Cleanup Using Columns (Low‐Throughput)

  Materials
  • Sheared DNA sample ( protocol 1)
  • Qiagen QIAquick PCR purification kit (cat. no. 28104) containing:
    • PB buffer
    • PE buffer
    • EB buffer
    • Columns

Alternate Protocol 1: DNA Cleanup Using Ampure XP Beads (Automation Friendly)

  Additional Materials (also see protocol 1)
  • Agencourt AMPure XP beads (Beckman Coulter Genomics, cat. no. A63881)
  • 80% ethanol
  • Magnetic stand; e.g., DynaMag Spin Magnet (Life Technologies, cat. no. 12320D)

Alternate Protocol 2: Ampure Bead Double DNA Size Selection

  Additional Materials (also see protocol 1)
  • Agencourt AMPure XP (Beckman Coulter Genomics: A63881)
  • 80% ethanol
  • Magnetic stand e.g., DynaMag Spin Magnet (Life Technologies, cat. no. 12320D)

Alternate Protocol 3: Gel Size Selection

  Additional Materials (also see protocol 1)
  • 2% Ultra‐pure agarose (Life Technologies, cat. no. 16500100)
  • 5× TBE buffer (Severn Biotech, cat. no. 20‐6005‐10, http://www.severnbiotech.com/)
  • 10 mg/ml ethidium bromide solution (Sigma, cat. no. E1510)
  • 5× loading dye (e.g., Qiagen, cat. no. 239901)
  • Low‐molecular‐weight size standard ladder (e.g., New England Biolabs, cat. no. N3233S)
  • Qiagen QIAquick gel extraction kit (cat. no. 28706) containing:
    • Chaotropic buffer (QG buffer)
    • PE buffer
    • EB buffer
    • Spin columns
  • Dark reader (Clare Chemical Research, cat. no. DR46, http://www.clarechemical.com/)
  • Scalpel or razor blade
  • Additional reagents and equipment for agarose gel electrophoresis (unit )

Basic Protocol 3: Preparation of the Adapter‐Ligated DNA Library

  Materials
  • Purified fragmented DNA sample (see protocol 2 and Alternate Protocols protocol 31 to protocol 53)
  • NEBnext Illumina Library prep kit (New England Biolabs, cat. E6040S) containing:
    • 10× T4 DNA ligase buffer (+10 mM ATP)
    • 10 mM dNTP mix
    • T4 DNA polymerase
    • Klenow DNA polymerase
    • T4 polynucleotide kinase
    • 10× Klenow buffer
    • dATP
    • Klenow DNA polymerase (3′→5′ exo‐)
    • 2× Quick ligation reaction buffer
    • Quick T4 DNA ligase
  • QIAquick PCR purification kit (Qiagen, cat. no. 28104) containing:
    • PB buffer
    • PE buffer
    • EB buffer
    • Column
  • Agencourt AMPure XP beads (Beckman Coulter Genomics, cat. no. A63881)
  • Paired‐end adapters (Integrated DNA Technologies):
    • PE_top_adapter primer:
    • 5′‐ACACTCTTTCCCTACACGACGCTCTTCCGATC*T (*indicates phosphorothioate; Bentley et al., )
    • PE_bottom_adapter primer:
    • 5′ P‐GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG (P‐ indicates phosphate; Bentley et al., )
  • QIAquick MinElute column (included with the QIAquick MinElute kit; Qiagen, cat no. 28004)
  • Additional reagents and equipment for purification of DNA using QIAquick PCR purification kit (see protocol 2) or AMPure XP beads ( protocol 3)

Support Protocol 1: Verification of Adapter Ligation of the Library

  Materials
  • Agilent High Sensitivity DNA kit (cat. no. 5067‐46264626) containing:
    • DNA dye concentrate (blue‐capped vial)
    • Gel matrix (red‐capped vial)
    • DNA marker (green‐capped vial)
    • DNA ladder (yellow‐capped vial)
    • Spin filters
    • DNA chips
    • Syringe
  • Adapter ligated DNA library (see protocol 6)
  • Vortexer (supplied with the Bioanalyzer)
  • Agilent Bioanalyzer 2100

Basic Protocol 4: PCR Amplification of the Library

  Materials
  • Adapter‐ligated DNA library (see protocol 6)
  • Kapa HiFi HotStart ReadyMix (Kapa Biosystems, cat. no KK2601)
  • Paired‐end PCR primers at 100 µM:
    • PCR_F
    • 5′‐AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTC CGATC*T 3′ (*indicates phosphorothioate; Bentley et al., )
    • PCR_R
    • 5′ CAAGCAGAAGACGGCATACGAGATXXXXXXXXCGGTCTCGGCATTCCTGC TGAACCGCTCTTCCGATC*T 3′ (*indicates phosphorothioate; Bentley et al., ; XXXXXXXX can be used to insert index tags)
  • Agencourt AMPure XP beads (Beckman Coulter Genomics, cat. no A63881)
  • 80% ethanol
  • EB buffer (from QIAquick PCR purification kit; Qiagen, cat. no. 28104)
  • Thermal cycler
  • Magnetic separator (e.g., DynaMag‐Spin Life Technologies cat. no. 12320D)

Alternate Protocol 4: Direct Sequencing of Short Amplicons

  Materials
  • Genomic DNA template
  • Thermal cycler
  • Gene‐specific primers (please see below)

Alternate Protocol 5: Direct Sequencing of Low Amounts of DNA Using Illumina's Nextera Kit

  Materials
  • Library quantification kit (e.g., Illumina/Universal Library Quantification Kit; Kapa Biosystems, cat. no. K4824): this kit contains a range of libraries of standard concentrations and the primers required (see below) to amplify Illumina libraries—if an alternative kit is used, then the user may have to supply the following PCR primers at 10 µM:
    • Syb_FP5 (desalted): ATGATACGGCGACCACCGAG
    • Syb_RP7 (desalted): CAAGCAGAAGACGGCATACGAG
  • Template DNAs of unknown concentration (from protocol 8)
  • 96‐well qPCR plates (Life Technologies, cat. no. 4346906)
  • Adhesive plate sealers (Life Technologies, cat. no. 4311971)
  • Life Technologies StepOne Quantitative PCR machine (or equivalent)

Alternate Protocol 6: Sequencing Without PCR

  Materials
  • 1 M NaOH
  • UltraPure water
  • Hybridization buffer (Illumina)
  • EB buffer (from QIAquick PCR purification kit; Qiagen, cat. no. 28104)
  • DNA library (see protocol 6); concentration determined in protocol 12
  • 200‐µl tubes
  • Sequencer: MiSeq, HiSeq, or Genome Analyzer (Illumina)

Basic Protocol 5: Quantification Using SYBR Green

  Materials
  • 0.1 M Tris·Cl pH 8.0 ( )
  • Sodium ascorbate (Sigma, cat. no. A4034)
  • 10,000× SYBR Green I (Life Technologies, cat. no. S‐7567)
  • PR2 buffer (Illumina, supplied with sequencing kits)
  • Flowcell (Illumina; supplied with sequencing kits)
  • 15‐ml Falcon tubes
  • 0.2‐µm syringe filter
  • 0.2‐ml 8‐strip PCR tubes (e.g., Starlab, cat. no. I1402‐3500; http:/www.starlab.de)
  • cBot (Illumina)
  • Fluorescence microscope, set up to detect SYBR Green I
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Bentley, D.R. , Balasubramanian, S. , Swerdlow, H.P. , Smith, G.P. , Milton, J. , Brown, C.G. , Hall, K.P. , Evers, D.J. , Barnes, C.L. , Bignell, H.R. , Boutell, J.M. , Bryant, J. , Carter, R.J. , Keira Cheetham, R. , Cox, A.J. , Ellis, D.J. , Flatbush, M.R. , Gormley, N.A. , Humphray, S.J. , Irving, L.J. , Karbelashvili, M.S. , Kirk, S.M. , Li, H. , Liu, X. , Maisinger, K.S. , Murray, L.J. , Obradovic, B. , Ost, T. , Parkinson, M.L. , Pratt, M.R. , Rasolonjatovo, I.M. , Reed, M.T. , Rigatti, R. , Rodighiero, C. , Ross, M.T. , Sabot, A. , Sankar, S.V. , Scally, A. , Schroth, G.P. , Smith, M.E. , Smith, V.P. , Spiridou, A. , Torrance, P.E. , Tzonev, S.S. , Vermaas, E.H. , Walter, K. , Wu, X. , Zhang, L. , Alam, M.D. , Anastasi, C. , Aniebo, I.C. , Bailey, D.M. , Bancarz, I.R. , Banerjee, S. , Barbour, S.G. , Baybayan, P.A. , Benoit, V.A. , Benson, K.F. , Bevis, C. , Black, P.J. , Boodhun, A. , Brennan, J.S. , Bridgham, J.A. , Brown, R.C. , Brown, A.A. , Buermann, D.H. , Bundu, A.A. , Burrows, J.C. , Carter, N.P. , Castillo, N. , Chiara, E.C.M. , Chang, S. , Neil Cooley, R. , Crake, N.R. , Dada, O.O. , Diakoumakos, K.D. , Dominguez‐Fernandez, B. , Earnshaw, D.J. , Egbujor, U.C. , Elmore, D.W. , Etchin, S.S. , Ewan, M.R. , Fedurco, M. , Fraser, L.J. , Fuentes Fajardo, K.V. , Scott Furey, W. , George, D. , Gietzen, K.J. , Goddard, C.P. , Golda, G.S. , Granieri, P.A. , Green, D.E. , Gustafson, D.L. , Hansen, N.F. , Harnish, K. , Haudenschild, C.D. , Heyer, N.I. , Hims, M.M. , Ho, J.T. , Horgan, A.M. , Hoschler, K. , Hurwitz, S. , Ivanov, D.V. , Johnson, M.Q. , James, T. , Huw Jones, T.A. , Kang, G.D. , Kerelska, T.H. , Kersey, A.D. , Khrebtukova, I. , Kindwall, A.P. , Kingsbury, Z. , Kokko‐Gonzales, P.I. , Kumar, A. , Laurent, M.A. , Lawley, C.T. , Lee, S.E. , Lee, X. , Liao, A.K. , Loch, J.A. , Lok, M. , Luo, S. , Mammen, R.M. , Martin, J.W. , McCauley, P.G. , McNitt, P. , Mehta, P. , Moon, K.W. , Mullens, J.W. , Newington, T. , Ning, Z. , Ling Ng, B. , Novo, S.M. , O'Neill, M.J. , Osborne, M.A. , Osnowski, A. , Ostadan, O. , Paraschos, L.L. , Pickering, L. , Pike, A.C. , Chris Pinkard, D. , Pliskin, D.P. , Podhasky, J. , Quijano, V.J. , Raczy, C. , Rae, V.H. , Rawlings, S.R. , Chiva Rodriguez, A. , Roe, P.M. , Rogers, J. , Rogert Bacigalupo, M.C. , Romanov, N. , Romieu, A. , Roth, R.K. , Rourke, N.J. , Ruediger, S.T. , Rusman, E. , Sanches‐Kuiper, R.M. , Schenker, M.R. , Seoane, J.M. , Shaw, R.J. , Shiver, M.K. , Short, S.W. , Sizto, N.L. , Sluis, J.P. , Smith, M.A. , Ernest Sohna Sohna, J. , Spence, E.J. , Stevens, K. , Sutton, N. , Szajkowski, L. , Tregidgo, C.L. , Turcatti, G. , Vandevondele, S. , Verhovsky, Y. , Virk, S.M. , Wakelin, S. , Walcott, G.C. , Wang, J. , Worsley, G.J. , Yan, J. , Yau, L. , Zuerlein, M. , Mullikin, J.C. , Hurles, M.E. , McCooke, N.J. , West, J.S. , Oaks, F.L. , Lundberg, P.L. , Klenerman, D. , Durbin, R. , and Smith, A.J. 2008. Accurate whole human genome sequencing using reversible terminator chemistry. Nature 456:53‐59.
   Borgstrom, E. , Lundin, S. , and Lundeberg, J. 2011. Large scale library generation for high throughput sequencing. PLoS One 6:e19119.
   DeAngelis, M.M. , Wang, D.G. , and Hawkins, T.L. 1995. Solid‐phase reversible immobilization for the isolation of PCR products. Nucleic Acids Res. 23:4742‐4743.
   Hawkins, T.L. , O'Connor‐Morin, T. , Roy, A. , and Santillan, C. 1994. DNA purification and isolation using a solid‐phase. Nucleic Acids Res. 22:4543‐4544.
   International Human Genome Sequencing Consortium. 2004. Finishing the euchromatic sequence of the human genome. Nature 431:931‐945.
   Kozarewa, I. , Ning, Z. , Quail, M.A. , Sanders, M.J. , Berriman, M. , and Turner, D.J. 2009. Amplification‐free Illumina sequencing‐library preparation facilitates improved mapping and assembly of (G+C)‐biased genomes. Nat. Methods 6:291‐295.
   Lundin, S. , Stranneheim, H. , Pettersson, E. , Klevebring, D. , and Lundeberg, J. 2010. Increased throughput by parallelization of library preparation for massive sequencing. PLoS One 5:e10029.
   Mandel, M. and Marmur, J. 1968. Use of ultraviolet absorbance‐temperature profile for determining the guanine plus cytosine content of DNA. Meth. Enzymol. 12:195‐206.
   Mardis, E.R. 2008. The impact of next‐generation sequencing technology on genetics. Trends Genet 24:133‐141.
   Margulies, M. , Egholm, M. , Altman, W.E. , Attiya, S. , Bader, J.S. , Bemben, L.A. , Berka, J. , Braverman, M.S. , Chen, Y.J. , Chen, Z. , Dewell, S.B. , Du, L. , Fierro, J.M. , Gomes, X.V. , Godwin, B.C. , He, W. , Helgesen, S. , Ho, C.H. , Irzyk, G.P. , Jando, S.C. , Alenquer, M.L. , Jarvie, T.P. , Jirage, K.B. , Kim, J.B. , Knight, J.R. , Lanza, J.R. , Leamon, J.H. , Lefkowitz, S.M. , Lei, M. , Li, J. , Lohman, K.L. , Lu, H. , Makhijani, V.B. , McDade, K.E. , McKenna, M.P. , Myers, E.W. , Nickerson, E. , Nobile, J.R. , Plant, R. , Puc, B.P. , Ronan, M.T. , Roth, G.T. , Sarkis, G.J. , Simons, J.F. , Simpson, J.W. , Srinivasan, M. , Tartaro, K.R. , Tomasz, A. , Vogt, K.A. , Volkmer, G.A. , Wang, S.H. , Wang, Y. , Weiner, M.P. , Yu, P. , Begley, R.F. , and Rothberg, J.M. 2005. Genome sequencing in microfabricated high‐density picolitre reactors. Nature 437:376‐380.
   Maxam, A.M. and Gilbert, W. 1977. A new method for sequencing DNA. Proc. Natl. Acad. Sci. U.S.A. 74:560‐564.
   Meyer, M. , Briggs, A.W. , Maricic, T. , Hober, B. , Hoffner, B. , Krause, J. , Weihmann, A. , Paabo, S. , and Hofreiter, M. 2008. From micrograms to picograms: Quantitative PCR reduces the material demands of high‐throughput sequencing. Nucleic Acids Res 36:e5.
   Quail, M.A. , Kozarewa, I. , Smith, F. , Scally, A. , Stephens, P.J. , Durbin, R. , Swerdlow, H. , and Turner, D.J. 2008. A large genome center's improvements to the Illumina sequencing system. Nat. Methods 5:1005‐1010.
   Quail, M.A. , Gu, Y. , Swerdlow, H. , and Mayho, M. 2012a. Evaluation and optimisation of preparative semi‐automated electrophoresis systems for Illumina library preparation. Electrophoresis 33:3521‐3528.
   Quail, M.A. , Otto, T.D. , Gu, Y. , Harris, S.R. , Skelly, T.F. , McQuillan, J.A. , Swerdlow, H.P. , and Oyola, S.O. 2012b. Optimal enzymes for amplifying sequencing libraries. Nat. Methods 9:10‐11.
   Quail, M.A. , Smith, M. , Coupland, P. , Otto, T.D. , Harris, S.R. , Connor, T.R. , Bertoni, A. , Swerdlow, H.P. , and Gu, Y. 2012c. A tale of three next generation sequencing platforms: Comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers. BMC Genomics 13:341.
   Riley, J. , Butler, R. , Ogilvie, D. , Finniear, R. , Jenner, D. , Powell, S. , Anand, R. , Smith, J.C. , and Markham, A.F. 1990. A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18:2887‐2890.
   Ronaghi, M. , Uhlen, M. , and Nyren, P. 1998. A sequencing method based on real‐time pyrophosphate. Science 281:363‐365.
   Sambrook, J. , Fritsch, E.F. , and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
   Sanger, F. and Coulson, A.R. 1975. A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J. Mol. Biol. 94:441‐448.
   Sanger, F. , Nicklen, S. , and Coulson, A.R. 1977. DNA sequencing with chain‐terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74:5463‐5467.
   Smith, D. and Malek, J. 2007. Asymmetrical adapters and methods of use thereof. United States Patent Office Application no. 20070172839.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library