Real‐Time Quantitative PCR Analysis of Mitochondrial DNA Content

Victor Venegas1, Jing Wang1, David Dimmock2, Lee‐Jun Wong1

1 Baylor College of Medicine, Houston, Texas, 2 Medical College of Wisconsin, Milwaukee, Wisconsin
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 19.7
DOI:  10.1002/0471142905.hg1907s68
Online Posting Date:  January, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Mitochondrial disorders are a group of complex and heterogeneous diseases that may be caused by molecular defects in the nuclear or mitochondrial genome. The biosynthesis and integrity of the small 16.6‐kb mitochondrial genome require a group of nuclear encoded genes. The mitochondrial DNA (mtDNA) depletion syndromes (MDDSs) are autosomal recessive disorders caused by molecular defects in nuclear genes, and characterized by a reduction in mtDNA content. To date, mutations in at least nine genes (POLG, DGUOK, TK2, TYMP, MPV17, SUCLA2, SUCLG1, RRM2B, and C10orf2) have been reported to cause various forms of MDDSs. In the clinical setting, a simple method to determine mtDNA depletion would be useful prior to undertaking gene sequence analysis. This unit outlines the real‐time quantitative polymerase chain reaction (qPCR) analysis of mtDNA content in tissues. MtDNA content varies among different tissues and at different ages in the same individual. Detailed protocols for the selection of nuclear genes for normalization, PCR set up, validation procedures, tissue and age matched controls, and sensitivity and specificity in various tissues, as well as interpretation of results are discussed. Curr. Protoc. Hum. Genet. 68:19.7.1‐19.7.12 © 2011 by John Wiley & Sons, Inc.

Keywords: mtDNA copy number; mtDNA content; mtDNA qPCR; quantification of mtDNA content; mtDNA depletion

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Real‐Time Quantitative PCR for the Quantification of mtDNA Content
  • Support Protocol 1: Generation of mtDNA Age‐Matched Controls
  • Support Protocol 2: Preparation and Quantification of DNA Samples
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Real‐Time Quantitative PCR for the Quantification of mtDNA Content

  Materials
  • Genomic DNA samples (see protocol 4)
  • qPCR primers for mitochondrial tRNALeu(UUR) gene, alternate primers for mtDNA 16S rRNA gene and nuclear β‐2‐microglobulin (β2M) gene (Table 19.7.2), 5 µM working concentration diluted in water
  • iTaq SYBR Green SuperMix with ROX (Bio‐Rad, cat. no. 170‐8852)
  • Tissue‐ and age‐matched pooled controls (see protocol 3)
  • PCR hood
  • 96‐well thin‐walled PCR plates
  • Adhesive plate sealer
  • ABI Prism 7900HT sequence detector system (Applied Biosystems)
  • Data analysis software: SDS software (version 2.2)
    Table 9.7.2   MaterialsqPCR Primer Sequences and Conditions

    Gene Primer name Primer sequence (5′ to 3′) Amplicon size (bp) Annealing temperature (°C)
    mtDNA tRNALeu(UUR) tRNA F3212 CACCCAAGAACAGGGTTTGT 107 62
    tRNA R3319 TGGCCATGGGTATGTTGTTA
    nDNA β2‐microglobulin β2M F594 TGCTGTCTCCATGTTTGATGTATCT 86 62
    β2M R679 TCTCTGCTCCCCACCTCTAAGT
    Alternate primers:mtDNA 16S rRNA mtF3163 GCCTTCCCCCGTAAATGATA 97 62
    mtR3260 TTATGCGATTACCGGGCTCT

Support Protocol 1: Generation of mtDNA Age‐Matched Controls

  Materials
  • Tissues
  • Puregene kit (Gentra Systems, cat. no. D50K1) including:
    • Red cell lysis solution
    • Cell lysis solution
    • DNA hydration solution
    • Protein precipitation solution
  • 100% isopropanol
  • 70% ethanol
  • Rapid hair digestion buffer: 10 mM Tris⋅Cl (pH 8.0), 1.0% Brij 58, 35 mM DTT, 1 mM CaCl 2
  • Calf thymus DNA standards (type XV; Sigma, cat. no. D4522)
  • NanoDrop ND‐1000 UV‐Vis spectrophotometer
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Antonicka, H., Mattman, A., Mattman, A., Carlson, C.G., Glerum, D.M., Hoffbuhr, K.C., Leary, S.C., Kennaway, N.G., and Shoubridge, E.A. 2003. Mutations in COX15 produce a defect in the mitochondrial heme biosynthetic pathway, causing early‐onset fatal hypertrophic cardiomyopathy. Am. J. Hum. Genet. 72:101‐114.
   Bai, R.K. and Wong, L.J. 2004. Detection and quantification of heteroplasmic mutant mitochondrial DNA by real‐time amplification refractory mutation system quantitative PCR analysis: A single‐step approach. Clin. Chem. 50:996‐1001.
   Bai, R.K. and Wong, L.J. 2005. Simultaneous detection and quantification of mitochondrial DNA deletion(s), depletion, and over‐replication in patients with mitochondrial disease. J. Mol. Diagn. 7:613‐622.
   Bourdon, A., Minai, L., Serre, V., Jais, J.P., Sarzi, E., Aubert, S., Chrétien, D., de Lonlay, P., Paquis‐Flucklinger, V., Arakawa, H., Nakamura, Y., Munnich, A., and Rötig, A. 2007. Mutation of RRM2B, encoding p53‐controlled ribonucleotide reductase (p53R2), causes severe mitochondrial DNA depletion. Nat. Genet. 39:776‐780.
   Carrozzo, R., Dionisi‐Vici, C., Steuerwald, U., Lucioli, S., Deodato, F., Di Giandomenico, S., Bertini, E., Franke, B., Kluijtmans, L.A., Meschini, M.C., Rizzo, C., Piemonte, F., Rodenburg, R., Santer, R., Santorelli, F.M., van Rooij, A., Vermunt‐de Koning, D., Morava, E., and Wevers, R.A. 2007. SUCLA2 mutations are associated with mild methylmalonic aciduria, Leigh‐like encephalomyopathy, dystonia and deafness. Brain 130:862‐874.
   Dimmock, D.P., Zhang, Q., Dionisi‐Vici, C., Carrozzo, R., Shieh, J., Tang, L.Y., Truong, C., Schmitt, E., Sifry‐Platt, M., Lucioli, S., Santorelli, F.M., Ficicioglu, C.H., Rodriguez, M., Wierenga, K., Enns, G.M., Longo, N., Lipson, M.H., Vallance, H., Craigen, W.J., Scaglia, F., and Wong, L.J. 2008. Clinical and molecular features of mitochondrial DNA depletion due to mutations in deoxyguanosine kinase. Hum. Mutat. 29:330‐331.
   Dimmock, D., Tang, L.Y., Schmitt, E.S., and Wong, L.J. 2010. A quantitative evaluation of the mitochondrial DNA depletion syndrome. Clin. Chem. 56:1119‐1127.
   Elpeleg, O., Miller, C., Hershkovitz, E., Bitner‐Glindzicz, M., Bondi‐Rubinstein, G., Rahman, S., Pagnamenta, A., Eshhar, S., and Saada, A. 2005. Deficiency of the ADP‐forming succinyl‐CoA synthase activity is associated with encephalomyopathy and mitochondrial DNA depletion. Am. J. Hum. Genet. 76:1081‐1086.
   Galbiati, S., Bordoni, A., Papadimitriou, D., Toscano, A., Rodolico, C., Katsarou, E., Sciacco, M., Garufi, A., Prelle, A., Aguennouz, M., Bonsignore, M., Crimi, M., Martinuzzi, A., Bresolin, N., Papadimitriou, A., and Comi, G.P. 2006. New mutations in TK2 gene associated with mitochondrial DNA depletion. Pediatr. Neurol. 34:177‐185.
   Hakonen, A.H., Isohanni, P., Paetau, A., Herva, R., Suomalainen, A., and Lönnqvist, T. 2007. Recessive TWINKLE mutations in early onset encephalopathy with mtDNA depletion. Brain 130:3032‐3040.
   Lee, N.C., Dimmock, D., Hwu, W.L., Tang, L.Y., Huang, W.C., Chinault, A.C., and Wong, L.J. 2009. Simultaneous detection of mitochondrial DNA depletion and single‐exon deletion in the deoxyguanosine gene using array‐based comparative genomic hybridisation. Arch. Dis. Child 94:55‐58.
   Nishino, I., Spinazzola, A., and Hirano, M. 1999. Thymidine phosphorylase gene mutations in MNGIE, a human mitochondrial disorder. Science 283:689‐692.
   Ostergaard, E., Hansen, F.J., Sorensen, N., Duno, M., Vissing, J., Larsen, P.L., Faeroe, O., Thorgrimsson, S., Wibrand, F., Christensen, E., and Schwartz, M. 2007a. Mitochondrial encephalomyopathy with elevated methylmalonic acid is caused by SUCLA2 mutations. Brain 130:853‐861.
   Ostergaard, E., Christensen, E., Kristensen, E., Mogensen, B., Duno, M., Shoubridge, E.A., and Wibrand, F. 2007b. Deficiency of the alpha subunit of succinate‐coenzyme A ligase causes fatal infantile lactic acidosis with mitochondrial DNA depletion. Am. J. Hum. Genet. 81:383‐387.
   Pontarin, G., Fijolek, A., Pizzo, P., Ferraro, P., Rampazzo, C., Pozzan, T., Thelander, L., Reichard, P.A., and Bianchi, V. 2008. Ribonucleotide reduction is a cytosolic process in mammalian cells independently of DNA damage. Proc. Natl. Acad. Sci. U.S.A. 105:17801‐17806.
   Sarzi, E., Goffart, S., Serre, V., Chrétien, D., Slama, A., Munnich, A., Spelbrink, J.N., and Rötig, A. 2007. TWINKLE helicase (PEO1) gene mutation causes mitochondrial DNA depletion. Ann. Neurol. 62:579‐587.
   Shaibani, A., Shchelochkov, O.A., Zhang, S., Katsonis, P., Lichtarge, O., Wong, L.J., and Shinawi, M. 2009. Mitochondrial neurogastrointestinal encephalopathy due to mutations in RRM2B. Arch. Neurol. 66:1028‐1032.
   Shanske, S. and Wong, L.J. 2004. Molecular analysis for mitochondrial DNA disorders. Mitochondrion 4:403‐415.
   Spinazzola, A. and Zeviani, M. 2007. Disorders of nuclear‐mitochondrial intergenomic communication. Biosci. Rep. 27:39‐51.
   Spinazzola, A. and Zeviani, M. 2009. Disorders from perturbations of nuclear‐mitochondrial intergenomic cross‐talk. J. Intern. Med. 265:174‐192.
   Tay, S.K., Shanske, S., Kaplan, P., and DiMauro, S. 2004. Association of mutations in SCO2, a cytochrome c oxidase assembly gene, with early fetal lethality. Arch. Neurol. 61:950‐952.
   Wong, L.J., Brunetti‐Pierri, N., Zhang, Q., Yazigi, N., Bove, K.E., Dahms, B.B., Puchowicz, M.A., Gonzalez‐Gomez, I., Schmitt, E.S., Truong, C.K., Hoppel, C.L., Chou, P.C., Wang, J., Baldwin, E.E., Adams, D., Leslie, N., Boles, R.G., Kerr, D.S., and Craigen, W.J. 2007. Mutations in the MPV17 gene are responsible for rapidly progressive liver failure in infancy. Hepatology 46:1218‐1227.
   Wong, L.J., Naviaux, R.K., Brunetti‐Pierri, N., Zhang, Q., Schmitt, E.S., Truong, C., Milone, M., Cohen, B.H., Wical, B., Ganesh, J., Basinger, A.A., Burton, B.K., Swoboda, K., Gilbert, D.L., Vanderver, A., Saneto, R.P., Maranda, B., Arnold, G., Abdenur, J.E., Waters, P.J., and Copeland, W.C. 2008. Molecular and clinical genetics of mitochondrial diseases due to POLG mutations. Hum. Mutat. 29:E150‐E172.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library