Next Generation Sequencing to Characterize Mitochondrial Genomic DNA Heteroplasmy

Taosheng Huang1

1 Division of Human Genetics/Department of Pediatrics, Center for Molecular and Mitochondrial Medicine and Genetics, University of California, Irvine, Irvine, California
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 19.8
DOI:  10.1002/0471142905.hg1908s71
Online Posting Date:  October, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This protocol describes the methodology to characterize mitochondrial DNA (mtDNA) heteroplasmy by parallel sequencing. Mitochondria play an important role in essential cellular functions. Each eukaryotic cell contains hundreds of mitochondria with hundreds of mitochondria genomes. Mutant and wild‐type mtDNA may co‐exist as heteroplasmy, and cause human disease. The purpose of this protocol is to simultaneously determine mtDNA sequence and quantify the heteroplasmic level. This protocol includes a two‐fragment mitochondrial genome DNA PCR amplification. The PCR product is then mixed at an equimolar ratio. The samples are then barcoded and sequenced with high‐throughput, next‐generation sequencing technology. This technology is highly sensitive, specific, and accurate in determining mtDNA mutations and the level of heteroplasmy. Curr. Protoc. Hum. Genet. 71:19.8.1‐19.8.12 © 2011 by John Wiley & Sons, Inc.

Keywords: mitochondria; next‐generation sequencing; heteroplasmy

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: PCR Amplification of mtDNA for Illumina‐Paired End Sequencing
  • Basic Protocol 2: Analysis of Sequencing Data to Determine Degree of Heteroplasmy
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: PCR Amplification of mtDNA for Illumina‐Paired End Sequencing

  Materials
  • DNAse‐ and RNAse‐free, ulltra‐pure water (Gibco, cat. no. 10977‐015, Milli‐Q, or equivalent)
  • 10 µM primers:
    • hmtF1 569 (5′‐AACCAAACCCCAAAGACACC‐3′)
    • hmtR1 9819 (5′‐GCCAATAATGACGTGAAGTCC‐3′)
    • htmF2 9611 (5′‐TCCCACTCCTAAACACATCC‐3′)
    • hmtR2 626 (5′‐TTTATGGGGTGATGTGAGCC‐3′)
  • 100 mM 4dNTP mix (Roche; 25 mM each dNTP; also see appendix 2D)
  • 5 U/µl Takara Taq DNA polymerase (Takara)
  • 10× PCR amplification buffer containing 15 mM MgCl 2 (Roche)
  • Positive control DNA
  • Genomic DNA stored in TE buffer, pH 7.4 (total genomic DNA extracted from peripheral blood using QIAamp DNA extraction kit, QIAGEN)
  • Low‐melting agarose (e.g., Fisher)
  • 10× Tris/borate/EDTA (TBE) buffer
  • 10 mg/ml ethidium bromide
  • 5× gel loading dye (see recipe)
  • 1‐kb DNA ladder
  • Thermal cycler (Perkin Elmer, cat. no. N801‐0150)
  • Gel apparatus and power source
  • Gel documentation system
  • NanoDrop 2000 spectrophotometer (Thermo Scientific; see appendix 3D)
  • Illumina GA sequencer (Illumina, part no. 1005063, http://qb3.berkeley.edu/gsl/Protocols_files/Paired‐End_SamplePrep_Guide_1005063_B.pdf

Basic Protocol 2: Analysis of Sequencing Data to Determine Degree of Heteroplasmy

  Materials
  • Computer with minimum requirements of Windows 7, 64 bit, 8‐GB RAM, 2 CPUs
  • Illumina CASAVA software (ver 1.6.0, Illumina)
  • NextGene software V2.1 (Softgenetics) to align to the genome (≥6‐GB RAM to align to multiple mitochondrial genomes with 1 GB of data file; more is required for the assembly of larger data sets)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Andrews, R.M., Kubacka, I., Chinnery, P.F., Lightowlers, R.N., Turnbull, D.M., and Howell, N. 1999. Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat. Genet. 23:147.
   Bai, R.K. and Wong, L.J. 2004. Detection and quantification of heteroplasmic mutant mitochondrial DNA by real‐time amplification refractory mutation system quantitative PCR analysis: A single‐step approach. Clin. Chem. 50:996‐1001.
   Bannwarth, S., Procaccio, V., and Paquis‐Flucklinger, V. 2005. Surveyor nuclease: A new strategy for a rapid identification of heteroplasmic mitochondrial DNA mutations in patients with respiratory chain defects. Hum. Mutat. 25:575‐582.
   Bentley, D.R. 2006. Whole‐genome re‐sequencing. Curr. Opin. Genet. Dev. 16:545‐552.
   Coskun, P.E., Procaccio, V., and Paquis‐Flucklinger, V. 2004. Alzheimer's brains harbor somatic mtDNA control‐region mutations that suppress mitochondrial transcription and replication. Proc. Natl. Acad. Sci. U.S.A. 101:10726‐10731.
   Dobrowolski, S.F., Hendrickx, A.T., van den Bosch, B.J., Smeets, H.J., Gray, J., Miller, T., and Sears, M. 2009. Identifying sequence variants in the human mitochondrial genome using high‐resolution melt (HRM) profiling. Hum. Mutat. 30:891‐898.
   Fan, W., Waymire, K.G., Narula, N., Li, P., Rocher, C., Coskun, P.E., Vannan, M.A., Narula, J., Macgregor, G.R., and Wallace, D.C. 2008. A mouse model of mitochondrial disease reveals germline selection against severe mtDNA mutations. Science 319:958‐962.
   Green, R.E., Malaspinas, A.S., Krause, J., Briggs, A.W., Johnson, P.L., Uhler, C., Meyer, M., Good, J.M., Maricic, T., Stenzel, U., Prüfer, K., Siebauer, M., Burbano, H.A., Ronan, M., Rothberg, J.M., Egholm, M., Rudan, P., Brajković, D., Kućan, Z., Gusić, I., Wikström, M., Laakkonen, L., Kelso, J., Slatkin, M., and Pääbo, S. 2008. A complete Neanderthal mitochondrial genome sequence determined by high‐throughput sequencing. Cell 134:416‐426.
   Hartmann, A., Thieme, M., Nanduri, L.K., Stempfl, T., Moehle, C., Kivisild, T., and Oefner, P.J. 2009. Validation of microarray‐based resequencing of 93 worldwide mitochondrial genomes. Hum. Mutat. 30:115‐122.
   Holt, I.J., Harding, A.E., Petty, R.K., and Morgan‐Hughes, J.A. 1990. A new mitochondrial disease associated with mitochondrial DNA heteroplasmy. Am. J. Hum. Genet. 46:428‐433.
   Keeney, P.M., Xie, J., Capaldi, R.A., and Bennett, J.P. Jr. 2006. Parkinson's disease brain mitochondrial complex I has oxidatively damaged subunits and is functionally impaired and misassembled. J. Neurosci. 26:5256‐5264.
   Liang, M.H., Johnson, D.R., and Wong, L.J. 1998. Preparation and validation of PCR‐generated positive controls for diagnostic dot blotting. Clin. Chem. 44:1578‐1579.
   Meierhofer, D., Mayr, J.A., Ebner, S., Sperl, W., and Kofler, B. 2005. Rapid screening of the entire mitochondrial DNA for low‐level heteroplasmic mutations. Mitochondrion 5:282‐296.
   Park, J.S., Sharma, L.K., Li, H., Xiang, R., Holstein, D., Wu, J., Lechleiter, J., Naylor, S.L., Deng, J.J., Lu, J., and Bai, Y. 2009. A heteroplasmic, not homoplasmic, mitochondrial DNA mutation promotes tumorigenesis via alteration in reactive oxygen species generation and apoptosis. Hum. Mol. Genet. 18:1578‐1589.
   Tang, S. and Huang, T. 2010. Characterization of mitochondrial DNA heteroplasmy using a parallel sequencing system. Biotechniques 48:287‐296.
   Tang, S., Batra, A., Zhang, Y., Ebenroth, E.S., and Huang, T. 2010. Left ventricular noncompaction is associated with mutations in the mitochondrial genome. Mitochondrion 10:350‐357.
   Vasta, V., Ng, S.B., Turner, E.H., Shendure, J., and Hahn, S.H. 2009. Next generation sequence analysis for mitochondrial disorders. Genome Med. 1:100.
   Wallace, D.C. 1992a. Diseases of the mitochondrial DNA. Annu. Rev. Biochem. 61:1175‐1212.
   Wallace, D.C. 1992b. Mitochondrial genetics: A paradigm for aging and degenerative diseases? Science 256:628‐632.
   Wallace, D.C. 2005a. The mitochondrial genome in human adaptive radiation and disease: On the road to therapeutics and performance enhancement. Gene 354:169‐180.
   Wallace, D.C. 2005b. A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: A dawn for evolutionary medicine. Annu. Rev. Genet. 39:359‐407.
   Wallace, D.C. 2007. Why do we still have a maternally inherited mitochondrial DNA? Insights from evolutionary medicine. Annu. Rev. Biochem. 76:781‐821.
   Wallace, D.C. 2008. Mitochondria as chi. Genetics 179:727‐735.
   Wallace, D.C. 2010. Mitochondrial DNA mutations in disease and aging. Environ. Mol. Mutagen. 51:440‐450.
   Wang, S., Li, R., Fettermann, A., Li, Z., Qian, Y., Liu, Y., Wang, X., Zhou, A., Mo, J.Q., Yang, L., Jiang, P., Taschner, A., Rossmanith, W., and Guan, M.X. 2011. Maternally inherited essential hypertension is associated with the novel 4263A>G mutation in the mitochondrial tRNAIle gene in a large Han Chinese family. Circ. Res. 108:862‐870.
   White, H.E., Durston, V.J., Seller, A., Fratter, C., Harvey, J.F., and Cross, N.C. 2005. Accurate detection and quantitation of heteroplasmic mitochondrial point mutations by pyrosequencing. Genet. Test 9:190‐199.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library