Comprehensive High‐Throughput Arrays for Relative Methylation (CHARM)

Christine Ladd‐Acosta1, Martin J. Aryee1, Jared M. Ordway2, Andrew P. Feinberg1

1 Center for Epigenetics and Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland, 2 Orion Genomics, LLC, St. Louis, Missouri
Publication Name:  Current Protocols in Human Genetics
Unit Number:  Unit 20.1
DOI:  10.1002/0471142905.hg2001s65
Online Posting Date:  April, 2010
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

DNA methylation (DNAm) is a term used to describe the heritable covalent addition of a methyl group to cytosines at CpG dinucleotides in mammals. While methods for examining DNAm status at specific loci have existed for several years, recent technological advances have begun to enable the examination of DNAm across the genome. In this unit, we describe comprehensive high‐throughput arrays for relative methylation (CHARM), a highly sensitive and specific approach to measure DNA methylation across the genome. This method makes no assumptions about where functionally important DNAm occurs, i.e., CpG island or promoter regions, and includes lower‐CpG‐density regions of the genome. In addition, it uses a novel genome‐weighted smoothing algorithm to correct for CpG density and fragment biases present in methyl‐enrichment or methyl‐depletion DNA‐fractionation methods. It can be applied to studying epigenomic changes in DNAm for normal and diseased samples. Curr. Protoc. Hum. Genet. 65:20.0.1‐20.0.19. © 2010 by John Wiley & Sons, Inc.

Keywords: DNA methylation; CHARM; epigenome; methylome

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: CHARM Array Hybridization and Analysis
  • Support Protocol 1: Fractionation of Genomic DNA by Random Shearing
  • Support Protocol 2: Methyl‐Dependent Fractionation of Genomic DNA Using McrBC
  • Support Protocol 3: Whole‐Genome Amplification
  • Support Protocol 4: Determining McrBC Specificity and Unmethylated DNA Enrichment
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: CHARM Array Hybridization and Analysis

  Materials
  • NimbleGen Array User's Guide downloaded from the Roche NimbleGen Web site (http://www.nimblegen.com/products/lit/methylation_userguide_v6p0.pdf)
  • NimbleScan Software User's Guide downloaded from the Roche NimbleGen Web site (http://www.nimblegen.com/products/lit/NimbleScan_v2p5_UsersGuide.pdf)
  • Bioconductor software (http://www.bioconductor.org), with the packages:
    • oligo (http://bioconductor.org/packages/bioc/html/oligo.html)
    • qvalue (http://bioconductor.org/packages/bioc/html/qvalue.html)
  • CHARM microarray annotation package: pd.feinberg.hg18.me.hx1 (http://rafalab.jhsph.edu/software.html)
  • NimbleScan feature extraction software (Roche NimbleGen)
  • 3.5 µg untreated DNA sample (obtained using Support Protocols protocol 21, protocol 32, and protocol 43), analyzed by quantitative real‐time PCR to evaluate the specificity of McrBC in the digestion reaction ( protocol 5)
  • 3.5 µg methyl‐depleted DNA sample (obtained using Support Protocols protocol 21, protocol 32, and protocol 43), analyzed by quantitative real‐time PCR to evaluate the specificity of McrBC in the digestion reaction ( protocol 5)
  • CHARM HD2 microarrays and supplies for HD2 array hybridization and processing (NimbleGen): see the NimbleGen Array User's Guide at the URL above
  • R Software (http://www.r‐project.org)

Support Protocol 1: Fractionation of Genomic DNA by Random Shearing

  Materials
  • 5 µg of high‐quality, high‐molecular‐weight, genomic DNA in 1× TE buffer ( appendix 3B)
  • 1× TE buffer, pH 7.4 (Quality Biological), filtered prior to use to avoid clogging of the shearing assembly
  • 0.2 M hydrochloric acid (wash solution I), filtered prior to use to avoid clogging of the shearing assembly
  • 0.2 M sodium hydroxide (wash solution II), filtered prior to use to avoid clogging of the shearing assembly
  • 50‐ml conical tubes (BD Falcon)
  • HydroShear device, equipped with a standard shearing assembly and syringe (DigiLab; http://www.digilabglobal.com/)

Support Protocol 2: Methyl‐Dependent Fractionation of Genomic DNA Using McrBC

  Materials
  • Two 50‐µl aliquots of sheared genomic DNA: one labeled UT and the other labeled MD, ( protocol 2)
  • 10× NEBuffer2 (NEB2; New England Biolabs)
  • 100 µg/ml (100×) bovine serum albumin (100× BSA)
  • 100 mM (100×) guanosine triphosphate (GTP; store in single‐use aliquots at −80°C)
  • 10 U/µL McrBC (New England Biolabs): test each new lot on a standard gDNA sample, using the digestion reaction and conditions provided below, to ensure complete digestion prior to use on any experimental samples
  • 50% (w/v) glycerol
  • 50 mg/ml proteinase K
  • SeaPlaque GTG Agarose (low melting point)
  • 1× Tris‐acetate‐EDTA (TAE) buffer (see appendix 2D for 50×)
  • 10 mg/ml ethidium bromide stock ( appendix 2D)
  • 1 Kb Plus DNA Ladder (Invitrogen)
  • PhiDye (see recipe)
  • Qiagen Gel Extraction Kit including:
    • Isopropanol
    • Buffer QG
    • Buffer PE
    • Buffer EB
  • 50° and 65°C water bath
  • 500‐ml Erlenmeyer flask
  • Microwave oven
  • Clean 12‐in. × 14‐in. gel box with casting tray (USA Scientific)
  • Clean 8‐well, 1.5‐mm wide‐tooth combs for the 12‐in. × 14‐in. gel box (USA Scientific)
  • Kimwipes
  • Heat‐protective glove (“Hotglove”)
  • Gel imager (e.g., AlphaImager HP; Alpha Innotech, http://www.alphainnotech.com)
  • Razor blades
  • Additional reagents and equipment for ethanol precipitation of DNA ( appendix 3C; use ammonium acetate as the monovalent cation) and agarose gel electrophoresis (see Ordway et al., , and unit 2.7 in this manual)

Support Protocol 3: Whole‐Genome Amplification

  Materials
  • 30 ng of excised, purified DNA from step 17 of protocol 3 for both MD and UT fractions
  • GenomePlex Complete Whole Genome Amplification (WGA2) kit (Sigma) including:
    • 10× fragmentation buffer
    • 1× library preparation buffer
    • Library stabilization solution
    • Library preparation enzyme
    • 10× amplification master mix
    • WGA DNA polymerase
    • Nuclease‐free water
  • QiaQuick PCR Purification Kit including:
    • Buffer PB
    • Buffer PE
    • Buffer EB
  • Additional reagents and equipment for spectrophotometrically quantitating DNA ( appendix 3D)

Support Protocol 4: Determining McrBC Specificity and Unmethylated DNA Enrichment

  Materials
  • For each sample, 60 ng of untreated DNA (UT fraction) obtained after whole‐genome amplification ( protocol 4), at a concentration of 5 ng/µl
  • For each sample, 60 ng of McrBC‐treated DNA (MD fraction) obtained after whole‐genome amplification ( protocol 4), at a concentration of 5 ng/µl
  • Fast SYBR Green Master Mix (Applied Biosystems)
  • Quantitative real‐time PCR primers for the human genome (Ordway et al., ):
    • GAPDH forward primer: TCTTGAGGCCTGAGCTACGTG
    • GAPDH reverse primer: CCCGTCCTTGACTCCCTAGTGT
    • GAPDH target sequence (5′ to 3′): CCTGCTGCCCACAGTCCAGTCCTGGG‐ AACCAGCACCGATCACCTCCCATCGGGCCAATCTCAGTCCCTT‐ CCCCCCTACGTCGGGGCCCACACGCTCGGTGCGTGCCCAGTTGAA‐ CCAGGCGGCTGCGGAAAAAAAAAAGCGGGGAGAAAGTAGGG‐ CCCGGCTACTAGCGGTTTTACGGGCG
    • HIST1H2BA forward primer: AGTGCTGTGTAACCCTGGAAAA
    • HIST1H2BA reverse primer: ACTCTCCTTACGGGTCCTCTTG
    • HIST1H2BA target sequence: AGTGCTGTGTAACCCTGGAAAAGAACCGT‐ GTAACGCTGCAGAAGTGTGTGGTAGCTATGCCGGAGGTGTCAT‐ CTAAAGGTGCTACCATTTCCAAGAAGGGCTTTAAGAAAGCTGTCG‐ TTAAGACCCAGAAAAAGGAAGGCAAAAAGCGCAAGAGGACCCGTAAGGAGAGT
  • Milli‐Q water
  • 384‐ or 96‐well optical plates
  • Optical plate seals
  • ABI 7900 HT real‐time PCR machine
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Amir, R.E., Van den Veyver, I.B., Wan, M., Tran, C.Q., Francke, U., and Zoghbi, H.Y. 1999. Rett syndrome is caused by mutations in X‐linked MECP2, encoding methyl‐CpG‐binding protein 2. Nat. Genet. 23:185‐188.
   Barker, D.L., Hansen, M.S., Faruqi, A.F., Giannola, D., Irsula, O.R., Lasken, R.S., Latterich, M., Makarov, V., Oliphant, A., Pinter, J.H., Shen, R., Sleptsova, I., Ziehler, W., and Lai, E. 2004. Two methods of whole‐genome amplification enable accurate genotyping across a 2320‐SNP linkage panel. Genome Res. 14:901‐907.
   Buffart, T.E., van Grieken, N.C., Tijssen, M., Coffa, J., Ylstra, B., Grabsch, H.I., van de Velde, C.J., Carvalho, B., and Meijer, G.A. 2009. High resolution analysis of DNA copy‐number aberrations of chromosomes 8, 13, and 20 in gastric cancers. Virchows Arch. 455:213‐223.
   Callinan, P.A. and Feinberg, A.P. 2006. The emerging science of epigenomics. Hum. Mol. Genet. 15:R95‐R101.
   Choi, Y.C. and Chae, C.B. 1991. DNA hypomethylation and germ cell‐specific expression of testis‐specific H2B histone gene. J. Biol. Chem. 266:20504‐20511.
   Feinberg, A.P. 2009. Genome‐scale approaches to the epigenetics of common human disease. Virchows Arch. 456:13‐21.
   Feinberg, A.P. and Tycko, B. 2004. The history of cancer epigenetics. Nat. Rev. Cancer 4:143‐153.
   Gentleman, R.C., Carey, V.J., Bates, D.M., Bolstad, B., Dettling, M., Dudoit, S., Ellis, B., Gautier, L., Ge, Y., Gentry, J., Hornik, K., Hothorn, T., Huber, W., Iacus, S., Irizarry, R., Leisch, F., Li, C., Maechler, M., Rossini, A.J., Sawitzki, G., Smith, C., Smyth, G., Tierney, L., Yang, J.Y., and Zhang, J. 2004. Bioconductor: Open software development for computational biology and bioinformatics. Genome Biol. 5:R80.
   Gribble, S., Ng, B.L., Prigmore, E., Burford, D.C., and Carter, N.P. 2004. Chromosome paints from single copies of chromosomes. Chromosome Res. 12:143‐151.
   Irizarry, R.A., Ladd‐Acosta, C., Carvalho, B., Wu, H., Brandenburg, S.A., Jeddeloh, J.A., Wen, B., and Feinberg, A.P. 2008. Comprehensive high‐throughput arrays for relative methylation (CHARM). Genome Res. 18:780‐790.
   Irizarry, R.A., Ladd‐Acosta, C., Wen, B., Wu, Z., Montano, C., Onyango, P., Cui, H., Gabo, K., Rongione, M., Webster, M., Ji, H., Potash, J.B., Sabunciyan, S., and Feinberg, A.P. 2009. The human colon cancer methylome shows similar hypo‐ and hypermethylation at conserved tissue‐specific CpG island shores. Nat. Genet. 41:178‐186.
   Lippman, Z., Gendrel, A.V., Colot, V., and Martienssen, R. 2005. Profiling DNA methylation patterns using genomic tiling microarrays. Nat. Methods 2:219‐224.
   Livak, K.J. and Schmittgen, T.D. 2001. Analysis of relative gene expression data using real‐time quantitative PCR and the 2(‐Delta Delta C(T)) Method. Methods 25:402‐408.
   Mill, J., Tang, T., Kaminsky, Z., Khare, T., Yazdanpanah, S., Bouchard, L., Jia, P., Assadzadeh, A., Flanagan, J., Schumacher, A., Wang, S.C., and Petronis, A. 2008. Epigenomic profiling reveals DNA‐methylation changes associated with major psychosis. Am. J. Hum. Genet. 82:696‐711.
   Oefner, P.J., Hunicke‐Smith, S.P., Chiang, L., Dietrich, F., Mulligan, J., and Davis, R.W. 1996. Efficient random subcloning of DNA sheared in a recirculating point‐sink flow system. Nucleic Acids Res. 24:3879‐3886.
   Ordway, J.M., Bedell, J.A., Citek, R.W., Nunberg, A., Garrido, A., Kendall, R., Stevens, J.R., Cao, D., Doerge, R.W., Korshunova, Y., Holemon, H., McPherson, J.D., Lakey, N., Leon, J., Martienssen, R.A., and Jeddeloh, J.A. 2006. Comprehensive DNA methylation profiling in a human cancer genome identifies novel epigenetic targets. Carcinogenesis 27:2409‐2423.
   Ordway, J.M., Budiman, M.A., Korshunova, Y., Maloney, R.K., Bedell, J.A., Citek, R.W., Bacher, B., Peterson, S., Rohlfing, T., Hall, J., Brown, R., Lakey, N., Doerge, R.W., Martienssen, R.A., Leon, J., McPherson, J.D., and Jeddeloh, J.A. 2007. Identification of novel high‐frequency DNA methylation changes in breast cancer. PLoS One 2:e1314.
   Storey, J.D. 2003. The positive false discovery rate: A Bayesian interpretation and the q‐value. Ann. Stat. 31:2013‐2035.
   Sutherland, E., Coe, L., and Raleigh, E.A. 1992. McrBC: A multisubunit GTP‐dependent restriction endonuclease. J. Mol. Biol. 225:327‐348.
   Thorstenson, Y.R., Hunicke‐Smith, S.P., Oefner, P.J., and Davis, R.W. 1998. An automated hydrodynamic process for controlled, unbiased DNA shearing. Genome Res. 8:848‐855.
   Yang, Y.H., Dudoit, S., Luu, P., Lin, D.M., Peng, V., Ngai, J., and Speed, T.P. 2002. Normalization for cDNA microarray data: A robust composite method addressing single and multiple slide systematic variation. Nucleic Acids Res. 30:e15.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library