Cloning, Expression, and Modification of Antibody V Regions

Sherie L. Morrison1

1 University of California, Los Angeles, California
Publication Name:  Current Protocols in Immunology
Unit Number:  Unit 2.12
DOI:  10.1002/0471142735.im0212s47
Online Posting Date:  May, 2002
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Cloned variable (V) regions of antibodies can be expressed joined to any constant (C) region, from either the same or a different species. The resulting antibodies will have the desired associated effector functions. Chimeric antibodies obtained by joining murine V regions to human C regions should have decreased immunogenicity in humans. The process of complementarity determining region (CDR) grafting, in which the CDRs from an antibody of one species are transferred to the framework regions of another species, constitutes a further modification of this approach. The protocols presented in this unit are designed to permit PCR‐based cloning of heavy and light chain V regions. This is an advanced molecular biology protocol and should be employed only by investigators who are sufficiently skilled and experienced.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Cloning and Expression of Immunoglobulin Variable Regions Using PCR with Redundant Primers
  • Support Protocol 1: Production of TA Vector
  • Basic Protocol 2: ELISA to Identify Transfectomas that Secrete Antibody Molecules
  • Basic Protocol 3: Characterization of Antibody Molecules Produced by Transfectomas
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Cloning and Expression of Immunoglobulin Variable Regions Using PCR with Redundant Primers

  Materials
  • 5 × 105 cells from antibody‐producing hybridoma cell line (units 2.1 & 2.5)
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • Guanidinium thiocyanate denaturing solution (unit 10.11)
  • 2 M sodium acetate, pH4 (unit 10.11)
  • Water‐saturated phenol (unit 10.11)
  • 49:1 (v/v) chloroform/isoamyl alcohol
  • 100% and 70% ethanol, −20°C
  • Diethylpyrocarbonate (DEPC)–treated H 2O (unit 10.11)
  • 1 mg/ml 3′ primer for cDNA synthesis (Table 2.12.1)
  • First‐strand cDNA buffer (see recipe)
  • 50 U/µl RNase inhibitor (RNasin, Promega)
  • 10 mM 4dNTP mix in H 2O (unit 10.9)
  • 9.5 U/µl avian myeloblastosis virus (AMV) reverse transcriptase (Promega), diluted 1/10 in reverse transcriptase dilution buffer (see recipe)
  • 20 µM leader primers for murine H and L chain V regions (Tables 2.12.2 and 2.12.3)
  • 2 U/µl Taq DNA polymerase
  • 1.25 mM 4dNTP mix in TE buffer, pH 7.5 (unit 10.20)
  • 10× PCR amplification buffer (see recipe)
  • Mineral oil
  • Chloroform
  • TA vector (see protocol 2Support Protocol; also available from Invitrogen)
  • 2× T4 DNA ligase buffer (unit 10.19)
  • 1 Weiss U/µl T4 DNA ligase (Life Technologies)
  • Competent E. coli cells ( appendix 3N)
  • 20 µM J region primers (Table 2.12.4)
  • Expression vector for H and L chain V regions cloned by PCR (Figs. and )
  • LB plates ( appendix 3N)
  • Microcentrifuge, room temperature and 4°C
  • 0.5‐ml microcentrifuge tubes
  • 16°, 42°, and 60°C water baths
  • Thermal cycler
  • Additional reagents and equipment for agarose gel electrophoresis (unit 10.4), alkaline lysis miniprep (unit 10.3), transforming E. coli ( appendix 3N), DNA sequencing (unit 10.25), restriction endonuclease digestion (unit 10.8), purification of DNA restriction fragments (unit 10.5), and transformation of eukaryotic cells (unit 10.17),NOTE: All instruments and containers utilized in steps to must be autoclaved and rinsed with DEPC‐treated water to avoid RNA degradation due to RNases. Gloves should be worn at all times. All water and salt solutions used in RNA preparation should be treated with DEPC. See unit 10.11 for additional information concerning DEPC treatment and the preparation and handling of RNA.
    Table 2.2.1   Materials3′ Primers for cDNA Synthesis and Amplification of Antibody Sequences5′ Sense Primers for Amplification of the Leader Region of Murine H Chain V Regions5′ Sense Primers for Amplification of Murine L Chain V RegionsJ Region Primers for Amplification and Cloning of Murine V Regions

    Immunoglobulin region PCR primer Primer sequence a
    L chain C region Oligo dT.R1.XBA.H3 5′‐GCCGGAATTCTAGAAGC(T) 17‐3′
    L chain C region MCκAS.XBA b 5′‐GCGTCTAGAACTGGATGGTGGGAGATGGA‐3′
    H chain V region MgC.C H1AS c 5′‐AGGTCTAGAA(C/T)CTCCACACACAGG(A/G)   (A/G)CCAGTGGATAGAC‐3′
    PCR primer d Primer sequence e
    MHALT1.RV 5′‐GGGGATATCCACCATGG(A/G)ATG(C/G)AGCTG(T/G)GT(C/A)AT(C/G)CTCTT‐3′
    MHALT2.RV 5′‐GGGGATATCCACCATG(A/G)ACTTCGGG(T/C)TGAGCT(T/G)GGTTTT‐3′
    MHALT3.RV 5′‐GGGGATATCCACCATGGCTGTCTTGGGGCTGCTCTTCT‐3′
    MHALT4.RV 5′‐GGGGATATCCACCATGG(A/G)CAG(G/A)CTTAC(T/A)T(C/T)(T/C)‐3′
    PCR primer f Primer sequence g
    MLALT1.RV 5′‐GGGGATATCCACCATGGAGACAGACACACTCCTGCTAT‐3′
    MLALT2.RV 5′‐GGGGATATCCACCATGGATTTTCAGGTGCAGATTTTCAG‐3′
    MLALT3.RV 5′‐GGGGATATCCACCATG(G/A)AGTCACA(G/T)AC(T/C)CAGGTCTT(T/C)(G/A)TA‐3′
    MLALT4.RV 5′‐GGGGATATCCACCATGAGG(G/T)CCCC(A/T)GCTCAG(C/T)T(C/T)CT(T/G)GG(G/A)‐3′
    MLALT5.RV 5′‐GGGGATATCCACCATGAAGTTGCCTGTTAGGCTGTTG‐3′
    MLALT6.RV 5′‐GGGGATATCCACCATGATGAGTCCTGCCCAGTTCC‐3′
    PCR primer Primer sequence h
    H chain J region j
    J H1 5′‐GGGGCTAGCTGAGGAGACGGTGACCGTGGT‐3′
    J H2 5′‐GGGGCTAGCTGAGGATACGGGAACCGTGGT‐3′
    J H3 5′‐GGGGCTAGCTGCAGAGACAGTGACCAGAGT‐3′
    J H4 5′‐GGGGCTAGCTGAGAAGACGGTGACTGAGGT‐3′
    J H5 5′‐GGGGCTAGC TGAGGAGACTGTGACCATG‐3′
    L chain J region
    VLJ 1,2,4 antisense k l 5′‐AGCGTCGACTTACGTTT(T/G)ATTTCCA(G/A)CTT(G/T)GTCCC‐3′
    VLJ 5 antisense l m 5′‐AGCGTCGACTTACGTTTCAGCTCCAGCTTGGTCCC‐3′
    VLJ 6 antisense 5′‐AGCGTCGACTTACGTTTCAATTCCAGCTTGGTG‐3′

     aDegeneracies are indicated by alternative nucleotides at a single position. XbaI cloning site is underlined.
     bDesigned to hybridize to sequences coding for amino acids 122 to 116 of the murine κ C region.
     cAntisense primer designed to hybridize to sequences coding for amino acids 130 to 120 in C H1 of all murine immunoglobulins except IgG3.
    Table 2.2.2   Materials3′ Primers for cDNA Synthesis and Amplification of Antibody Sequences5′ Sense Primers for Amplification of the Leader Region of Murine H Chain V Regions5′ Sense Primers for Amplification of Murine L Chain V RegionsJ Region Primers for Amplification and Cloning of Murine V Regions

    Immunoglobulin region PCR primer Primer sequence a
    L chain C region Oligo dT.R1.XBA.H3 5′‐GCCGGAATTCTAGAAGC(T) 17‐3′
    L chain C region MCκAS.XBA b 5′‐GCGTCTAGAACTGGATGGTGGGAGATGGA‐3′
    H chain V region MgC.C H1AS c 5′‐AGGTCTAGAA(C/T)CTCCACACACAGG(A/G)   (A/G)CCAGTGGATAGAC‐3′
    PCR primer d Primer sequence e
    MHALT1.RV 5′‐GGGGATATCCACCATGG(A/G)ATG(C/G)AGCTG(T/G)GT(C/A)AT(C/G)CTCTT‐3′
    MHALT2.RV 5′‐GGGGATATCCACCATG(A/G)ACTTCGGG(T/C)TGAGCT(T/G)GGTTTT‐3′
    MHALT3.RV 5′‐GGGGATATCCACCATGGCTGTCTTGGGGCTGCTCTTCT‐3′
    MHALT4.RV 5′‐GGGGATATCCACCATGG(A/G)CAG(G/A)CTTAC(T/A)T(C/T)(T/C)‐3′
    PCR primer f Primer sequence g
    MLALT1.RV 5′‐GGGGATATCCACCATGGAGACAGACACACTCCTGCTAT‐3′
    MLALT2.RV 5′‐GGGGATATCCACCATGGATTTTCAGGTGCAGATTTTCAG‐3′
    MLALT3.RV 5′‐GGGGATATCCACCATG(G/A)AGTCACA(G/T)AC(T/C)CAGGTCTT(T/C)(G/A)TA‐3′
    MLALT4.RV 5′‐GGGGATATCCACCATGAGG(G/T)CCCC(A/T)GCTCAG(C/T)T(C/T)CT(T/G)GG(G/A)‐3′
    MLALT5.RV 5′‐GGGGATATCCACCATGAAGTTGCCTGTTAGGCTGTTG‐3′
    MLALT6.RV 5′‐GGGGATATCCACCATGATGAGTCCTGCCCAGTTCC‐3′
    PCR primer Primer sequence h
    H chain J region j
    J H1 5′‐GGGGCTAGCTGAGGAGACGGTGACCGTGGT‐3′
    J H2 5′‐GGGGCTAGCTGAGGATACGGGAACCGTGGT‐3′
    J H3 5′‐GGGGCTAGCTGCAGAGACAGTGACCAGAGT‐3′
    J H4 5′‐GGGGCTAGCTGAGAAGACGGTGACTGAGGT‐3′
    J H5 5′‐GGGGCTAGC TGAGGAGACTGTGACCATG‐3′
    L chain J region
    VLJ 1,2,4 antisense k l 5′‐AGCGTCGACTTACGTTT(T/G)ATTTCCA(G/A)CTT(G/T)GTCCC‐3′
    VLJ 5 antisense l m 5′‐AGCGTCGACTTACGTTTCAGCTCCAGCTTGGTCCC‐3′
    VLJ 6 antisense 5′‐AGCGTCGACTTACGTTTCAATTCCAGCTTGGTG‐3′

     d3′primers designed to hybridize to the amino terminus of H chain leader sequences. All primers are used simultaneously to amplify unknown sequences.
     eEcoRV sites (underlined) are protected by the three 5′ Gs. Ribosome binding sites are indicated in bold. Degeneracies are indicated by alternative nucleotides at a single position.
    Table 2.2.3   Materials3′ Primers for cDNA Synthesis and Amplification of Antibody Sequences5′ Sense Primers for Amplification of the Leader Region of Murine H Chain V Regions5′ Sense Primers for Amplification of Murine L Chain V RegionsJ Region Primers for Amplification and Cloning of Murine V Regions

    Immunoglobulin region PCR primer Primer sequence a
    L chain C region Oligo dT.R1.XBA.H3 5′‐GCCGGAATTCTAGAAGC(T) 17‐3′
    L chain C region MCκAS.XBA b 5′‐GCGTCTAGAACTGGATGGTGGGAGATGGA‐3′
    H chain V region MgC.C H1AS c 5′‐AGGTCTAGAA(C/T)CTCCACACACAGG(A/G)   (A/G)CCAGTGGATAGAC‐3′
    PCR primer d Primer sequence e
    MHALT1.RV 5′‐GGGGATATCCACCATGG(A/G)ATG(C/G)AGCTG(T/G)GT(C/A)AT(C/G)CTCTT‐3′
    MHALT2.RV 5′‐GGGGATATCCACCATG(A/G)ACTTCGGG(T/C)TGAGCT(T/G)GGTTTT‐3′
    MHALT3.RV 5′‐GGGGATATCCACCATGGCTGTCTTGGGGCTGCTCTTCT‐3′
    MHALT4.RV 5′‐GGGGATATCCACCATGG(A/G)CAG(G/A)CTTAC(T/A)T(C/T)(T/C)‐3′
    PCR primer f Primer sequence g
    MLALT1.RV 5′‐GGGGATATCCACCATGGAGACAGACACACTCCTGCTAT‐3′
    MLALT2.RV 5′‐GGGGATATCCACCATGGATTTTCAGGTGCAGATTTTCAG‐3′
    MLALT3.RV 5′‐GGGGATATCCACCATG(G/A)AGTCACA(G/T)AC(T/C)CAGGTCTT(T/C)(G/A)TA‐3′
    MLALT4.RV 5′‐GGGGATATCCACCATGAGG(G/T)CCCC(A/T)GCTCAG(C/T)T(C/T)CT(T/G)GG(G/A)‐3′
    MLALT5.RV 5′‐GGGGATATCCACCATGAAGTTGCCTGTTAGGCTGTTG‐3′
    MLALT6.RV 5′‐GGGGATATCCACCATGATGAGTCCTGCCCAGTTCC‐3′
    PCR primer Primer sequence h
    H chain J region j
    J H1 5′‐GGGGCTAGCTGAGGAGACGGTGACCGTGGT‐3′
    J H2 5′‐GGGGCTAGCTGAGGATACGGGAACCGTGGT‐3′
    J H3 5′‐GGGGCTAGCTGCAGAGACAGTGACCAGAGT‐3′
    J H4 5′‐GGGGCTAGCTGAGAAGACGGTGACTGAGGT‐3′
    J H5 5′‐GGGGCTAGC TGAGGAGACTGTGACCATG‐3′
    L chain J region
    VLJ 1,2,4 antisense k l 5′‐AGCGTCGACTTACGTTT(T/G)ATTTCCA(G/A)CTT(G/T)GTCCC‐3′
    VLJ 5 antisense l m 5′‐AGCGTCGACTTACGTTTCAGCTCCAGCTTGGTCCC‐3′
    VLJ 6 antisense 5′‐AGCGTCGACTTACGTTTCAATTCCAGCTTGGTG‐3′

     fFive primers designed to hybridize to the amino terminus of murine L chain leader sequences. All primers are used simultaneously to amplify unknown sequences.
     gEcoRV sites (underlined) are protected by the three 5′ Gs. Ribosome binding sites are indicated in bold. Degeneracies are indicated by alternative nucleotides at a single position.
    Table 2.2.4   Materials3′ Primers for cDNA Synthesis and Amplification of Antibody Sequences5′ Sense Primers for Amplification of the Leader Region of Murine H Chain V Regions5′ Sense Primers for Amplification of Murine L Chain V RegionsJ Region Primers for Amplification and Cloning of Murine V Regions

    Immunoglobulin region PCR primer Primer sequence a
    L chain C region Oligo dT.R1.XBA.H3 5′‐GCCGGAATTCTAGAAGC(T) 17‐3′
    L chain C region MCκAS.XBA b 5′‐GCGTCTAGAACTGGATGGTGGGAGATGGA‐3′
    H chain V region MgC.C H1AS c 5′‐AGGTCTAGAA(C/T)CTCCACACACAGG(A/G)   (A/G)CCAGTGGATAGAC‐3′
    PCR primer d Primer sequence e
    MHALT1.RV 5′‐GGGGATATCCACCATGG(A/G)ATG(C/G)AGCTG(T/G)GT(C/A)AT(C/G)CTCTT‐3′
    MHALT2.RV 5′‐GGGGATATCCACCATG(A/G)ACTTCGGG(T/C)TGAGCT(T/G)GGTTTT‐3′
    MHALT3.RV 5′‐GGGGATATCCACCATGGCTGTCTTGGGGCTGCTCTTCT‐3′
    MHALT4.RV 5′‐GGGGATATCCACCATGG(A/G)CAG(G/A)CTTAC(T/A)T(C/T)(T/C)‐3′
    PCR primer f Primer sequence g
    MLALT1.RV 5′‐GGGGATATCCACCATGGAGACAGACACACTCCTGCTAT‐3′
    MLALT2.RV 5′‐GGGGATATCCACCATGGATTTTCAGGTGCAGATTTTCAG‐3′
    MLALT3.RV 5′‐GGGGATATCCACCATG(G/A)AGTCACA(G/T)AC(T/C)CAGGTCTT(T/C)(G/A)TA‐3′
    MLALT4.RV 5′‐GGGGATATCCACCATGAGG(G/T)CCCC(A/T)GCTCAG(C/T)T(C/T)CT(T/G)GG(G/A)‐3′
    MLALT5.RV 5′‐GGGGATATCCACCATGAAGTTGCCTGTTAGGCTGTTG‐3′
    MLALT6.RV 5′‐GGGGATATCCACCATGATGAGTCCTGCCCAGTTCC‐3′
    PCR primer Primer sequence h
    H chain J region j
    J H1 5′‐GGGGCTAGCTGAGGAGACGGTGACCGTGGT‐3′
    J H2 5′‐GGGGCTAGCTGAGGATACGGGAACCGTGGT‐3′
    J H3 5′‐GGGGCTAGCTGCAGAGACAGTGACCAGAGT‐3′
    J H4 5′‐GGGGCTAGCTGAGAAGACGGTGACTGAGGT‐3′
    J H5 5′‐GGGGCTAGC TGAGGAGACTGTGACCATG‐3′
    L chain J region
    VLJ 1,2,4 antisense k l 5′‐AGCGTCGACTTACGTTT(T/G)ATTTCCA(G/A)CTT(G/T)GTCCC‐3′
    VLJ 5 antisense l m 5′‐AGCGTCGACTTACGTTTCAGCTCCAGCTTGGTCCC‐3′
    VLJ 6 antisense 5′‐AGCGTCGACTTACGTTTCAATTCCAGCTTGGTG‐3′

     hDegeneracies are indicated by alternative nucleotides at a single position.
     JNheI sites (underlined) are used for cloning into the expression vectors.
     kPrimer for J κ1, 2, and 4; will not introduce amino acid changes.
     lSalI sites (underlined) are used for cloning into the expression vectors.
     mPrimer for J κ5; J κ3 is a pseudogene.

Support Protocol 1: Production of TA Vector

  Materials
  • Plasmid with a blunt‐end restriction site (e.g., pBluescript from Statagene or pUC)
  • Appropriate restriction endonuclease (e.g., EcoRV or SmaI)
  • 1:1 (v/v) phenol/chloroform
  • 100% ethanol, −20°C
  • 70% ethanol/3 M sodium acetate, pH 4.8
  • recipe5× terminal transferase (TdT) buffer (see recipe)
  • 25 mM cobalt chloride (CoCl 2)
  • 5 mM 3′,5′‐dideoxy‐thymidine‐5′triphosphate (ddTTP)
  • 25 U/µl terminal transferase
  • 3 M sodium acetate, pH 4.8 ( appendix 2A)
  • TE buffer, pH 7.5 ( appendix 2A)
  • 0.5‐ml microcentrifuge tubes
  • Additional reagents and equipment for restriction endonuclease digestion (unit 10.8) and agarose gel electrophoresis (unit 10.4)

Basic Protocol 2: ELISA to Identify Transfectomas that Secrete Antibody Molecules

  Materials
  • 5 to 10 µg/ml goat anti‐human Ig (or other appropriate antigen or antiserum) in 0.2 M carbonate buffer, pH 9.6 (do not store ≥2 weeks)
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • Blocking buffer: 3% (w/v) bovine serum albumin (BSA) in PBS
  • Supernatant from growing transfectomas of interest (unit 10.17)
  • Goat anti‐human or λ chain antibody conjugated with alkaline phosphatase
  • Substrate: 0.6 mg/ml p‐nitrophenyl phosphate in 0.9 M diethanolamine/0.24 mM MgCl 2, pH 9.8
  • 96‐well ELISA plate (e.g., Immunlon 2, Dynatech Laboratories)
  • Microtiter plate reader

Basic Protocol 3: Characterization of Antibody Molecules Produced by Transfectomas

  Materials
  • 1 × 106 exponentially growing transfectoma cells (unit 10.17)
  • Labeling medium: high‐glucose Dulbeccos minimum essential medium (DMEM) deficient in methionine (Irvine Scientific)
  • 0.01 mCi/µl [35S]methionine (>1000 Ci/mmol)
  • recipeNDET solution (see recipe)
  • Polyclonal anti‐Ig (e.g., rabbit anti‐Ig)
  • IgG Sorb (The Enzyme Center)
  • Sucrose pad: 30% (w/v) sucrose/0.3% (w/v) sodium dodecyl sulfate (SDS) in recipeNDET solution (see recipe; optional)
  • 0.3% (w/v) SDS in recipeNDET solution (see recipe)
  • recipeSDS‐PAGE sample buffer (see recipe)
  • 0.15 M 2‐mercaptoethanol (2‐ME)
  • 12% Tris‐glycine (Laemmli) minigels (unit 8.4)
  • Tris‐glycine gel running buffer (unit 8.4)
  • recipeStaining solution (see recipe)
  • Destain solution: 7% (v/v) glacial acetic acid/5% (v/v) methanol (store at room temperature)
  • 1 M salicylate
  • recipe5% phosphate gel (see recipe)
  • recipePhosphate gel running buffer (see recipe)
  • 15‐ml polystyrene tubes, sterile
  • IEC centrifuge (or equivalent), 4°C
  • Boiling water bath
  • Whatman 3MM filter paper
  • Additional reagents and equipment for polyacrylamide gel electrophoresis (unit 8.4) and autoradiography ( appendix 3A)
CAUTION: This procedure should be performed only by personnel trained in the proper use of 35S isotope and in NRC‐licensed sites. Standard precautions to prevent excessive exposure and radioactive contamination of personnel and equipment should be followed at all times (refer to Safety Precautions for Radioisotopes, appendix 1Q).
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Ausubel, F.A., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (eds.) 1994. Current Protocols in Molecular Biology. John Wiley & Sons, New York.
   Carroll, W.L., Mendel, E., and Levy, S. 1988. Hybridoma fusion cell lines contain an aberrant kappa transcript. Mol. Immunol. 25:991‐995
   Coloma, M.J., Larrick, J.W., Ayala, M., and Gavilondo‐Cowley, J.V. 1991. Primer design for the cloning of immunoglobulin heavy‐chain leader‐variable regions from mouse hybridoma cells using the PCR. BioTechniques 11:152‐154.
   Coloma, M.J., Hastings, A., Wims, L.A., and Morrison, S.L. 1992. Novel vectors for the expression of antibody molecules using variable regions generated by PCR. J. Immunol. Methods 152:89‐104.
   Holton, T.A. and Graham, M.W. 1990. A simple and efficient method for direct cloning of PCR products using ddT‐tailed vectors. Nucl. Acids Res. 19:1156.
   Kabat, E.A., Wu, T.T., Perry, H.M., Gottesman, K.S., and Foeller, C. 1991. Sequences of Proteins of Immunological Interest, 5th ed. U.S. Department of Health and Human Services, Washington,D.C.
   Larrick, J.W., Danielsson, L., Brenner, C.A., Abrahamson, M., Fry, K.E., and Borrebaeck, C.A.K. 1989. Rapid cloning of rearranged immunoglobulin genes from human hybridoma cells using mixed primers and the polymerase chain reaction. Biochem. Biophys. Res. Commun. 160:1250‐1256.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library