Epitope Mapping Using Gram‐Positive Surface Display

Johan Rockberg1, John Löfblom1, Barbara Hjelm1, Stefan Ståhl1, Mathias Uhlén1

1 School of Biotechnology, Royal Institute of Technology (KTH), AlbaNova University Center, Stockholm, Sweden
Publication Name:  Current Protocols in Immunology
Unit Number:  Unit 9.9
DOI:  10.1002/0471142735.im0909s90
Online Posting Date:  August, 2010
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Antibodies have proven to be invaluable tools for a vast number of applications during the last decades, including protein purification and characterization, medical diagnosis and imaging, and treatment using therapeutic antibodies. No matter what the aims of the application are, the antibody's binding characteristics will still be the main features determining the assay's reliability. Here, we describe a protocol for determination of antibody‐binding epitopes using an antigen‐focused, library‐based approach where library members are generated by fragmentation of antigen DNA and presented as cloned peptides on the cell surface of the Gram‐positive bacterium Staphylococcus carnosus. The rigid cell structure of this organism allows for multivalent expression and permits rapid library analysis and sorting of antibody‐binding cells using flow‐sorting devices. Epitopes are determined by DNA sequencing of the sorted cells and alignment back to the antigen sequence. The protocol described here has been shown useful for mapping of both monoclonal and polyclonal binders with varying epitope lengths. Curr. Protoc. Immunol. 90:9.9.1‐9.9.17. © 2010 by John Wiley & Sons, Inc.

Keywords: epitope; cell surface; Staphylococcus carnosus; epitope mapping; Gram‐positive; antibody

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Generation of Target‐Specific DNA Library
  • Support Protocol 1: PCR Protocol for Amplifying DNA Used to Prepare Display Library
  • Support Protocol 2: Preparation of Display Vector pSCEM2 in E. coli
  • Basic Protocol 2: Generation of an Antigen‐Specific Library for S. carnosus Expression
  • Basic Protocol 3: Generation of Antigen‐Expressing S. carnosus Used for Epitope Mapping of Antibodies
  • Support Protocol 3: Preparation of Electrocompetent S. carnosus
  • Basic Protocol 4: Antibody Labeling and Analysis of S. carnosus Antigen Library
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Generation of Target‐Specific DNA Library

  Materials
  • 5 g vector DNA containing the antigen gene as template
  • 1% agarose gel (unit 10.4)
  • Low DNA Mass Ladder (Invitrogen)
  • T4 DNA polymerase (Promega)
  • T4 polynucleotide kinase (PNK) and 10× PNK buffer (New England Biolabs)
  • 10 mM dNTP mix (10 mM each dNTP; New England Biolabs)
  • Display vector pSCEM2 (see protocol 3)
  • T4 DNA ligase and 10× ligation buffer (Fermentas)
  • 10× PEG (Fermentas)
  • 25:24:1 phenol:chloroform:isoamyl alcohol (VWR Scientific)
  • 96% and 70% ethanol, ice cold
  • 3 M sodium acetate, pH 5.5 ( appendix 2A)
  • Buffer EB (Qiagen)
  • 15‐ml conical polypropylene tubes (BD Falcon)
  • Sonicator with 6‐mm micro tip (Vibra cell 750 W; Sonics and Materials, http://www.sonicsandmaterials.com/)
  • Amicon Ultra‐15 centrifugal concentrators (MWCO 10 kDa; Millipore)
  • Centrifuge with swinging‐bucket rotor
  • Additional reagents and equipment for PCR to amplify DNA used to prepare display library ( protocol 2), and agarose gel electrophoresis (unit 10.4)

Support Protocol 1: PCR Protocol for Amplifying DNA Used to Prepare Display Library

  Materials
  • 10× PCR buffer (Promega)
  • Forward and reverse primers
  • 10 mM dNTP (Promega)
  • Taq DNA polymerase (Promega)
  • Template (e.g., dispersed colony or diluted vector containing the antigen DNA)
  • Thermal cycler

Support Protocol 2: Preparation of Display Vector pSCEM2 in E. coli

  Materials
  • Electrocompetent Escherichia coli XL1‐Blue (Stratagene)
  • pSCEM2 vector (modified PSCEM1; Rockberg et al., ); this vector is not commercially available but may be obtained by contacting Prof. Ståhl, School of Biotechnology, Royal Institute of Technology (KTH), 10691, Stockholm, Sweden
  • TSB+Y medium (see recipe) containing 100 µg/ml ampicillin (VWR Scientific)
  • JETSTAR Maxiprep kit (Genomed; http://www.genomed‐dna.com/)
  • 1% agarose gel (unit 10.4)
  • High DNA Mass Ladder (Invitrogen)
  • EcoRV restriction endonuclease (New England Biolabs)
  • 10× NEBuffer 3 (New England Biolabs)
  • 100× BSA (New England Biolabs)
  • Antarctic Phosphatase and buffer (New England Biolabs)
  • QIAquick PCR Purification Kit (Qiagen)
  • 5‐liter Erlenmeyer flask
  • Additional reagents and equipment for transforming E. coli ( protocol 4) and agarose gel electrophoresis (unit 10.4)

Basic Protocol 2: Generation of an Antigen‐Specific Library for S. carnosus Expression

  Materials
  • DNA library ( protocol 1)
  • Electrocompetent E. coli, (e.g., XL1‐Blue; Stratagene)
  • SOC medium (see recipe)
  • Tryptose blood agar base (TBAB) plates (see recipe) with 100 µg/ml ampicillin
  • PCR primers:
    • SAPA23: 5′‐GGCTCCTAAAGAAAATACAACGGC‐3′
    • SAPA24: 5′‐TGTTGAATTCTTTAAGGGCATCTGC‐3′
  • TSB+Y medium (see recipe) with and without 100 µg/ml ampicillin (VWR Scientific)
  • JETSTAR Maxiprep kit (Genomed; http://www.genomed‐dna.com/)
  • Buffer EB (Qiagen)
  • 2‐mm electroporation cuvettes
  • Sterile pipet tips with aerosol‐barrier filters
  • 15‐ml round‐bottom tubes (BD Falcon)
  • Electroporation instrument (e.g., MicroPulser, BioRad)
  • Shaking incubator
  • 1‐liter Erlenmeyer flask
  • Additional reagents and equipment for determining vector concentration ( protocol 3)

Basic Protocol 3: Generation of Antigen‐Expressing S. carnosus Used for Epitope Mapping of Antibodies

  Materials
  • Electrocompetent S. carnosus (see protocol 6)
  • Plasmid containing target‐specific DNA library at >1 µg/µl (see protocol 4)
  • 0.5 M sucrose/10% (w/v) glycerol, aqueous
  • B2 medium (see recipe)
  • Tryptose blood agar base (TBAB) plates (see recipe) containing 10 µg/ml chloramphenicol
  • TSB+Y medium (see recipe)
  • 87% glycerol, sterile (VWR Scientific)
  • Heat block
  • 1‐mm electroporation cuvettes (1 mm)
  • Electroporation instrument (e.g., MicroPulser, BioRad)
  • Shaking incubator
  • 15‐ml round‐bottom tubes (BD Falcon)

Support Protocol 3: Preparation of Electrocompetent S. carnosus

  Materials
  • S. carnosus TM 300 cells (may be obtained from Prof. S. Götz, University of Tübingen, 72076, Tübingen, Germany)
  • Tryptose blood agar base (TBAB) plates (see recipe)
  • B2 medium (see recipe)
  • 10% (v/v) glycerol
  • 1 liter and 100‐ml Erlenmeyer flasks covered with foil and plugged with cotton
  • SS‐34 centrifuge tubes (Sorvall) covered with foil
  • Aerosol‐barrier pipet tips
  • Sorvall centrifuge with SS‐34 rotor
  • Spectrophotometer and cuvettes
  • 5‐ml Stripette serological pipets (Corning)
  • PipetBoy pipetting aid (Integra Biosciences; http://www.pipetboy.info/)

Basic Protocol 4: Antibody Labeling and Analysis of S. carnosus Antigen Library

  Materials
  • Antigen‐expressing S. carnosus (see protocol 5)
  • TSB+Y medium (see recipe) containing 10 µg/ml chloramphenicol
  • PBSP (see recipe)
  • Primary antibodies
  • Alexa 488–labeled secondary antibody appropriate for detecting primary antibody
  • Alexa 647–labeled human serum albumin (see recipe)
  • Tryptose blood agar base (TBAB) plates (see recipe) containing 10 µg/ml chloramphenicol
  • Standard PCR mix ( protocol 2)
  • PCR primers:
    • SAPA23: 5′‐biotin‐GGCTCCTAAAGAAAATACAACGGC‐3′
    • SAPA24: 5′‐biotin‐TGTTGAATTCTTTAAGGGCATCTGC‐3′
  • Oligonucleotides for pyrosequencing:
    • Pyrofor: 5′‐CAGGATCCAGCGGCCGCG‐3′
    • Pyrorev: 5′‐GCGCCCGGGTTTAAACGA‐3′
  • 1‐liter Erlenmeyer flasks
  • Refrigerated centrifuge
  • End‐over‐end rotator
  • Flow cytometer (e.g., FACSVantage SE, BD Biosciences; also see Chapter 5) with flow cytometer tubes
  • 96‐well PCR plate
  • Pyrosequencing Vacuum Prep Workstation (Qiagen)
  • Pyrosequencing PSQ 96 HS instrument (Qiagen)
  • Additional reagents and equipment for flow cytometry (Chapter 5) and PCR ( protocol 2)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Augustin, J. and Götz, F. 1990. Transformation of Staphylococcus epidermidis and other staphylococcal species with plasmid DNA by electroporation. FEMS Microbiol. Lett. 54:203‐207.
   Chao, G., Cochran, J.R., and Wittrup, K.D. 2004. Fine epitope mapping of anti‐epidermal growth factor receptor antibodies through random mutagenesis and yeast surface display. J. Mol. Biol. 342:539‐550.
   Fack, F., Hugle‐Dorr, B., Song, D., Queitsch, I., Petersen, G., and Bautz, E.K. 1997. Epitope mapping by phage display. Random versus gene‐fragment libraries. J. Immunol. Methods 206:43‐52.
   Harvey, B.R., Georgiou, G., Hayhurst, A., Jeong, K.J., Iverson, B.L., and Rogers, G.K. 2004. Anchored periplasmic expression, a versatile technology for the isolation of high‐affinity antibodies from Escherichia coli–expressed libraries. Proc. Natl. Acad. Sci. U.S.A. 101:9193‐9198.
   Hilpert, K., Winkler, D.F., and Hancock, R.E. 2007. Peptide arrays on cellulose support: SPOT synthesis, a time and cost efficient method for synthesis of large numbers of peptides in a parallel and addressable fashion. Nat. Protoc. 2:1333‐1349.
   Kronqvist, N., Löfblom, J., Jonsson, A., Wernerus, H., and Ståhl, S. 2008. A novel affinity protein selection system based on staphylococcal cell surface display and flow cytometry. Protein Eng. Des. Sel. 21:247‐255.
   Löfblom, J., Kronqvist, N., Uhlen, M., Ståhl, S., and Wernerus, H. 2007. Optimization of electroporation‐mediated transformation: Staphylococcus carnosus as model organism. J. Appl. Microbiol. 102:736‐747.
   Rockberg, J., Löfblom, J., Hjelm, B., Uhlen, M., and Ståhl, S. 2008. Epitope mapping of antibodies using bacterial surface display. Nat. Methods 5:1039‐1045.
   van Zonneveld, A.J., van den Berg, B.M., van Meijer, M., and Pannekoek, H. 1995. Identification of functional interaction sites on proteins using bacteriophage‐displayed random epitope libraries. Gene 167:49‐52.
Key Reference
   Rockberg et al., 2008. See above.
  Describes method for epitope mapping of antibodies using S. carnosus cell surface display including results with mapping of 15 monoclonal and polyclonal antibodies.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library