Analysis of Telomere Length and Telomerase Activity

Karen S. Hathcock1, Richard J. Hodes2, Nan‐Ping Weng3

1 National Cancer Institute/NIH, Bethesda, MD, 2 National Institute on Aging and National Cancer Institute, Bethesda, MD, 3 National Institute on Aging, Baltimore, MD
Publication Name:  Current Protocols in Immunology
Unit Number:  Unit 10.30
DOI:  10.1002/0471142735.im1030s62
Online Posting Date:  September, 2004
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Telomeres are specialized DNA‐protein structures present at the ends of all linear chromosomes and are characterized by (TTAGGG)n hexanucleotide repeats and associated proteins. Telomere length has been implicated in cell survival and replicative capacity of dividing somatic cells. In the absence of an active compensatory mechanism, telomere lengths shorten as a consequence of proliferation, both in vitro and in vivo. However, this loss of telomeric repeats can be compensated and telomere length maintained by the enzyme telomerase, which is capable of adding (TTAGGG) repeat sequences to the ends of telomeres. This unit describes methods that are used for the measurement of telomere length and telomerase activity in human and murine cells.

Keywords: telomeres; telomerase; hexanucleotide repeates; cell senescence; lymphocytes

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Measurement of Telomere Length by Southern Hybridization of Terminal Telomeric DNA Restriction Fragments (TRF) Using Conventional GEL Electrophoresis
  • Alternate Protocol 1: Southern Hybridization on a Nylon Membrane
  • Support Protocol 1: End Labeling of Telomere or Other Oligonucleotide
  • Basic Protocol 2: Measurement of Telomere by Southern Hybridization of Terminal Telomeric DNA Restriction Fragments (TRF) Using Pulsed‐Field GEL Electrophoresis
  • Basic Protocol 3: Fluorescence in Situ Hybridization (FISH) and Flow Cytometric Analysis of Telomere Length: FLOW‐FISH
  • Basic Protocol 4: Quantitative Fluorescence in Situ Hybridization: Q Fish
  • Support Protocol 2: Preparation of Metaphase Chromosomes from Proliferating Lymphocytes
  • Basic Protocol 5: Measurement of Telomerase Activity
  • Alternate Protocol 2: Nonradioactive Trap Assay 1: Fluorescent Dye (SYBR I) Staining
  • Alternate Protocol 3: Nonradioactive Trap Assay 2: Fluorescent Dye Labeling (TAMRA‐Ts)
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Measurement of Telomere Length by Southern Hybridization of Terminal Telomeric DNA Restriction Fragments (TRF) Using Conventional GEL Electrophoresis

  Materials
  • Genomic DNA (isolated using commercial kits)
  • Hinf I and Ras I restriction endonuclease and reaction buffer
  • Agarose (DNA grade)
  • 10× TBE or TAE (see recipe)
  • 6× DNA loading buffer (see recipe)
  • 1‐kb extend DNA ladder (Invitrogen)
  • 10 mg/ml ethidium bromide
  • Denaturation solution (see recipe)
  • TE (see recipe)
  • Neutralization solution (see recipe)
  • QuickHyb hybridization solution (Stratagene)
  • γ32P‐(CCCTAA) 4 end‐labeled telomeric probe (see protocol 3)
  • 5× and 2× SSC/0.1% SDS (see recipe)
  • Tetramethyl ammonium chloride (TMACl; Sigma‐Aldrich)
  • Electrophoresis gel apparatus and power supply
  • UV light and camera
  • Razor blades
  • 3MM paper (Whatman)
  • Plastic wrap
  • Gel dryer (BioRad model 583) or other equivalent
  • Platform rocker
  • Glass hybridization tube
  • Hybridization oven or 43°C water bath
  • Phosphorimaging system (Typhoon or Storm) or other equivalent systems
  • Image analysis software (e.g., Imagequant)

Alternate Protocol 1: Southern Hybridization on a Nylon Membrane

  • Nylon membrane (e.g., Hybond N+, Amersham Biosciences or equivalent)
  • Alkaline transfer buffer (see recipe)
  • Capillary transfer system
  • UV irradiation or vacuum oven

Support Protocol 1: End Labeling of Telomere or Other Oligonucleotide

  Materials
  • 10 pmol/µl d(TTAGGG) 4 telomere oligonucleotide
  • 6000Ci/mmol [γ‐32P] ATP
  • Bacteriophage T4 polynucleotide kinase and 10× buffer
  • 200‐µl microcentrifuge tubes
  • Spin columns (e.g., Bio‐Spin 6, BioRad)
  • Scintillation counter

Basic Protocol 2: Measurement of Telomere by Southern Hybridization of Terminal Telomeric DNA Restriction Fragments (TRF) Using Pulsed‐Field GEL Electrophoresis

  Materials
  • Single cell suspension of lymphocytes
  • PBS ( appendix 2A)
  • Cell suspension buffer (see recipe)
  • 1.2% InCert agarose in 0.5× TBE (e.g., Cambrex), 45°C
  • Proteinase K buffer (see recipe)
  • Wash buffer I (see recipe)
  • Phenylmethylsulfonyl fluoride (PMSF; e.g., Sigma)
  • HinfI and RsaI restriction enzymes diluted in buffer A (e.g., Roche)
  • 0.5× TBE
  • 1% ultra‐pure agarose in 0.5× TBE (e.g., Life Technologies)
  • Low‐range PFG molecular weight markers (194 to 2 kb markers embedded in agarose; e.g., New England BioLabs or equivalent)
  • Ethidium bromide
  • Denaturation solution (e.g., Biofluids)
  • TE (see recipe)
  • Neutralization solution (e.g., Biofluids)
  • QuikHyb solution (Stratagene)
  • γ32P‐(CCCTAA) 4 end‐labeled telomeric probe (see protocol 3)
  • 5× SSC/0.1% SDS (see recipe)
  • 2× SSC‐0.1% SDS (see recipe)
  • 1.5‐ml microcentrifuge tubes, DNase‐free
  • Reusable plug molds (BioRad)
  • Tape
  • 15‐ml tubes
  • Hybridization oven or water bath
  • Platform shaker
  • Pulsed‐field gel electrophoresis system (BioRad CHEF Mapper XA or equivalent)
  • 3MM Whatman paper
  • Vacuum gel dryer (BioRad model 583 or equivalent)
  • Hybridization tubes
  • PhosphorImaging system (e.g., Storm or equivalent)
  • ImageQuant (or equivalent) analysis software
  • Additional reagents and equipment for counting cells ( appendix 3A) and trypan blue exclusion for determining cell viability ( appendix 3B)

Basic Protocol 3: Fluorescence in Situ Hybridization (FISH) and Flow Cytometric Analysis of Telomere Length: FLOW‐FISH

  Materials
  • Single cell suspension of lymphocytes
  • PBS ( appendix 2A)
  • Prewash buffer (see recipe)
  • Hybridization buffer I (see recipe)
  • (PNA) FITC ‐ (CCCTAA) 4 telomeric probe (Applied Biosystems; see recipe)
  • Wash buffer II (see recipe)
  • Wash buffer III (see recipe)
  • Resuspension buffer (see recipe)
  • Low‐intensity FITC Quantum24 calibration beads (Bangs Laboratories), optional
  • DNA dye (LDS 751, Exciton; propidium iodide, Sigma)
  • DNase‐free 1.5 ml microcentrifuge tubes
  • Thermomixer (e.g., Eppendorf), heat block, or water bath
  • 12 × 75–mm flow cytometer tubes
  • Nitex nylon mesh (Sefar America or equivalent), optional
  • FACScaliber or FACScan flow cytometer (e.g., Becton Dickinson Immunocytometry Systems)
  • Analysis software (CellQuest or equivalent)
  • Additional reagents and equipment for counting cells ( appendix 3A) and trypan blue exclusion for determining cell viability ( appendix 3B)

Basic Protocol 4: Quantitative Fluorescence in Situ Hybridization: Q Fish

  Materials
  • Metaphase spreads (see protocol 7)
  • PBS, pH 7.5 ( appendix 2A)
  • 4% formaldehyde (see recipe)
  • Pepsin (see recipe), 37°C
  • 70%, 90%, and 100% ethanol
  • PNA telomeric probe: (PNA) Cy3‐(CCCTAA) 3 (Applied Biosystems; see recipe)
  • Hybridization buffer II (see recipe)
  • Wash buffer IV (see recipe)
  • TBST buffer (see recipe)
  • TetraSpeck fluorescent microspheres sampler kit (Molecular Probes), optional
  • DAPI‐Vectashield (Vector Laboratories; see recipe)
  • 25 × 50–mm coverslips (e.g., Fisher)
  • Glass staining dishes (e.g., Fisher)
  • Platform shaker
  • Humidified slide holder covered with alumninum foil
  • Cardboard tray for flat slide storage (e.g., Fisher)
  • Wide‐field epifluorescence microscope (Zeiss Axioplan2, Carl Zeiss) equipped with:
    • HBO 100W mercury arc lamp
    • DAPI and Cy3‐specific filter sets (Chroma Technology)
    • 63× lens (N.A. 1.4) (Plan‐Apochromat 63×/1.4, Carl Zeiss)
    • ORCA ER cooled‐CCD digital camera (Hamamatsu Photonics K.K.)
    • Image acquisition software such as Slidebook (Intelligent Imaging Innovations) or MetaMorph (Universal Imaging)
    • TFL‐TELO software or equivalent
    • Spreadsheet program
NOTE: All of the following steps, except for pepsin treatment, are performed at room temperature on a shaking platform. For all washes, place slides in glass staining dishes and add sufficient amounts of the wash reagents to cover the slides. Wrap the staining dishes with aluminum foil after the slides are exposed to probe to protect from light.

Support Protocol 2: Preparation of Metaphase Chromosomes from Proliferating Lymphocytes

  Materials
  • Lymphocytes
  • Mitogenic stimuli
  • 10 µg/ml Colcemid (e.g., Roche)
  • 0.075 M KCl (see recipe), 37°C
  • 3:1 (v/v) methanol/acetic acid (see recipe)
  • 70%, 90%, and 100% ethanol
  • 50‐ml and 15‐ml conical tubes (e.g., Falcon)
  • Centrifuge (Sorvall model RT‐7) or equivalent
  • Vortex mixer
  • Parafilm
  • 25 × 75 × 1–mm microscope slides (Fisher)

Basic Protocol 5: Measurement of Telomerase Activity

  Materials
  • Cells of interest
  • PBS ( appendix 2A)
  • Wash buffer V (see recipe), ice cold
  • Lysis buffer (see recipe), ice cold
  • DEPC‐treated H 2O
  • 10× telomerase reaction buffer (see recipe)
  • 20 mM dATP, dGTP, and dTTP mixture
  • Primers used for telomere synthesis and PCR (see recipe)
  • 5 U/µl Taq polymerase and 10× reaction buffer
  • 1 mM dNTP
  • Anti‐Taq antibody (TaqStart, Clontech) or hot‐start Taq polymerase
  • NT (oligonucleotide primer: ATCGCTTCTCGGCCTTTT)
  • TSNT (DNA template: AATCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT)
  • 6× DNA loading buffer (see recipe)
  • 12% polyacrylamide nondenaturing gel
  • 10× TBE or TAE
  • 1.5‐ and 0.5‐ml microcentrifuge tubes
  • Homogenizer
  • Thermal cycler
  • Polyacrylamide gel electrophoresis apparatus
  • Gel dryer
  • PhosphorImaging system (Typhoon or Storm) or other equivalent systems
  • Analysis software (ImageQuant or other similar software)

Alternate Protocol 2: Nonradioactive Trap Assay 1: Fluorescent Dye (SYBR I) Staining

  • SYBR I (Molecular Probes)
  • Small tray
  • Platform rocker

Alternate Protocol 3: Nonradioactive Trap Assay 2: Fluorescent Dye Labeling (TAMRA‐Ts)

  • Modified 6× DNA loading buffer (loading buffer without dyes)
  • Emission filter (580 BP Cy3 TAMRA)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Bodnar, A.G., Ouellette, M., Frolkis, M., Holt, S.E., Chiu, C‐P., Morin, G.B., Harley, C.B., Shay, J.W., Lichtsteiner, S., and Wright, W.E. 1998. Extension of life‐span by introduction of telomerase into normal human cells. Science 279:349‐353.
   Egholm, M., Buchardt, O., Christensen, L., Behrens, C., Freier, S., Driver, D.A., Berg, R.H., Kim, S.K., Norden, B., and Nielsen, P.E. 1993. PNA hybridizes to complementary oligonucleotides obeying the Watson‐Crick hydrogen‐bonding rules. Nature 367:566‐568.
   Hathcock, K.S., Kaech, S.M., Ahmed, R., and Hodes, R.J. 2003. Induction of telomerase activity and maintenance of telomere length in virus‐specific effector and memory CD8+ T cells. J. Immunol. 170:147‐152.
   Hodes, R.J., Hathcock, K.S., and Weng, N. 2002. Telomeres in T and B cells. Nature Rev. Immunol. 2:706‐713.
   Harley, C.B., Futcher, A.B., and Greider, C.W. 1990. Telomeres shorten during aging of human fibroblasts. Nature 345:458‐460.
   Kim, N.W., Piatyszek, M.A., Prowse, K.R., Harley, C.B., West, M.D., Ho, P.L., Coviello, G.M., Wright, W.E., Weinrich, S.L., and Shay, J.W. 1994. Specific association of human telomerase activity with immortal cells and cancer. Science 266:2011‐2015.
   Lansdorp, P.M., Verwoerd, N.P., van de Rijke, F.M., Dragowska, V., Little, M‐T., Dirks, R.W., Raap, A.K., and Tanke, H.J. 1996. Heterogeneity in telomere length of human chromosomes. Hum. Mol. Genet. 5:685‐691.
   Poon, S.S.S., Martins, U.M., Ward, R.K., and Lansdorp, P.M. 1999. Telomere length measurement using digital fluorescence microscopy. Cytometry 36:267‐278.
   Rufer, N., Dragowska, W., Thornbury, G., Roosnek, E., and Lansdorp, P.M. 1998. Telomere length dynamics in human lymphocyte subpopulations measured by flow cytometry. Nat. Biotechnol. 16:743‐747.
   Weng, NP., Levine, B.L., June, C.J., and Hodes, R.J. 1995. Human naïve and memory T lymphocytes differ in telomeric length and replicative potential. Proc. Natl. Acad. Sci. U.S.A. 92:11091‐11094.
   Weng, N.P., Levine, B.L., June, C.J., and Hodes, R.J. 1996. Regulated expression of telomerase activity in human T lymphocyte development and activation. J. Exp. Med. 183:2471‐2479.
   Zhu, L., Hathcock, K.S., Hande, P., Lansdorp, P.M., Seldin, M.E., and Hodes, R.J. 1998. Telomere length regulation in mice is linked to a novel chromosome locus. Proc. Natl. Acad. Sci. U.S.A. 21:8648‐8653.
Key References
   Baerlocher, G.M., Mak, J., Tien, T., and Lansdorp, P.J. 2002. Telomere length measurements by fluorescence in situ hybridization and flow cytometry: Tips and pitfalls. Cytometry 47:89‐99.
  Excellent publication that analyzes various aspects of setting up Flow‐FISH in the laboratory.
   Brown, M.J. and Lawce, H.J. 1997. Peripheral Blood Cytogenetic Methods. In The AGT Cytogenetics Laboratory Manual. Third Edition (M.J. Barch, T. Knutsen, and J. Spurbeck, eds.) pp.77‐89. Lippincott‐Raven Publishers, New York.
  Helpful reference that describes theory and methodologies for making metaphase spreads.
   Egholm et al., 1993. See above.
  This reference describes the characteristics of PNA probes that make them such useful tools.
   Kim, N.W. and Wu, F. 1997. Advances in quantification and characterization of telomerse activity by the telomeric repeat amplification protocol (TRAP). Nucleic Acids Res. 25:2595‐2597.
  This paper describes modifications to the original TRAP assay that improve sensitivity, reliability and quantification. Most TRAP protocols that are currently in use, follow the modifications described in this paper.
   Poon et al., 1999. See above.
  Extremely useful reference describing the theory and validation of the dedicated computer program (TFL‐TELO) developed by the Lansdorp laboratory that is widely used for telomere length measurements using Q‐FISH.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library