Unbiased Molecular Analysis of T Cell Receptor Expression Using Template‐Switch Anchored RT‐PCR

Máire F. Quigley1, Jorge R. Almeida1, David A. Price1,2, Daniel C. Douek1

1 Vaccine Research Center, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland, 2 Department of Infection, Immunity, and Biochemistry, Cardiff University School of Medicine, Heath Park, Cardiff, United Kingdom
Publication Name:  Current Protocols in Immunology
Unit Number:  Unit 10.33
DOI:  10.1002/0471142735.im1033s94
Online Posting Date:  August, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

A detailed knowledge of the principles that guide clonal selection within the memory and effector T cell pools is essential to further our understanding of the factors that influence effective T cell‐mediated immunity and has direct implications for the rational design of vaccines and immunotherapies. This unit provides methods for the unbiased quantification and characterization of all expressed T cell receptor (TCR) gene products within any defined T cell population. The approach is based on a template‐switch anchored reverse transcription–polymerase chain reaction (RT‐PCR) and is optimized for the analysis of antigen‐specific T cells isolated directly ex vivo. Curr. Protoc. Immunol. 94:10.33.1‐10.33.16. © 2011 by John Wiley & Sons, Inc.

Keywords: T cell receptor; polymerase chain reaction; antigen‐specific T cell

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Isolation of Antigen‐Specific T Cell Populations for Analysis of TCR Gene Expression
  • Basic Protocol 2: Extraction of mRNA from Isolated T Cells
  • Basic Protocol 3: Synthesis of Anchor Sequence‐Containing cDNA
  • Basic Protocol 4: cDNA Clean‐Up Using Nucleospin Extract II Columns
  • Basic Protocol 5: PCR Amplification of Rearranged TCR Products
  • Support Protocol: Remedy for Unsuccessful PCR Amplification
  • Basic Protocol 6: Gel Extraction and Purification of Amplicons
  • Basic Protocol 7: Amplicon Ligation into TA Cloning Vector
  • Basic Protocol 8: Vector Transformation into Competent E. coli
  • Basic Protocol 9: Colony PCR and Sequencing
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Isolation of Antigen‐Specific T Cell Populations for Analysis of TCR Gene Expression

 Materials
  • Single cell suspension of live T cells defined with an appropriate staining procedure
  • RNAlater (Applied Biosystems)
  • 1.5‐ml polypropylene O‐ring microcentrifuge tubes (Sarstedt)
  • Vortex, optional
  • Microcentrifuge
  • Flow‐cytometric cell sorter

Basic Protocol 2: Extraction of mRNA from Isolated T Cells

 Materials
  • Oligotex Direct mRNA Mini kit (Qiagen) containing:
    • Buffer OL1 (lysis buffer)
    • Buffer ODB (dilution buffer)
    • Buffer OW1 (wash buffer 1)
    • Buffer OW2 (wash buffer 2)
    • Buffer OEB (elution buffer; incubate at 70°C)
    • Oligotex suspension (incubate at 37°C)
  • 2‐mercaptoethanol (2‐ME; Sigma‐Aldrich)
  • Frozen vial of sorted cells in RNAlater (see Basic Protocol 1)
  • Two heating blocks or thermomixers (37°C, 70°C)
  • Vortex
  • Microcentrifuge
  • QIAshredders with spin columns (Qiagen)
  • 2‐ml collection tubes
  • 1.5‐ml polypropylene O‐ring microcentrifuge tubes (Sarstedt)
  • Spin columns
  • −80°C freezer

Basic Protocol 3: Synthesis of Anchor Sequence‐Containing cDNA

 Materials
  • SMARTer PCR cDNA Synthesis kit (Clontech) containing:
    • SMART II anchor oligo (12 µM): 5′‐AAGCAGTGGTATCAACGCAGAGTACGCGGG‐3′ containing three G ribonucleotides (not dG) at the end
  • 5′ CDS oligo(dT) primer (12 µM): 5′‐(T)25VN‐3′ (V = A, C, G; N = A, C, G, T)
  • PolyA+ mRNA (see Basic Protocol 2)
  • 5× RT buffer: 250 mM Tris⋅Cl (pH 8.3), 375 mM KCl and 30 mM MgCl2
  • Dithiothreitol (DTT, 20 mM; Invitrogen)
  • RNaseOUT (RNase inhibitor; Invitrogen)
  • dNTP mix (10 mM; Invitrogen)
  • Superscript II RNase H Reverse Transcriptase (RT; 200 U/µl; Invitrogen)
  • Tricine buffer: 10 mM Tricine‐KOH (pH 8.5), 1 mM EDTA
  • Two heating blocks (42°C, 70°C)
  • 1.5‐ml polypropylene O‐ring microcentrifuge tubes (Sarstedt)
  • −20°C freezer
  • Microcentrifuge
  • Pipets

NOTE: The SMARTer PCR cDNA Synthesis Kit (Clontech) contains several components required for cDNA synthesis, including a proprietary modified SMART oligo, which can be successfully used with this method. However, the 5′ CDS oligo(dT) should be synthesized as described in the materials list. The 5′ PCR primer II A from the SMARTer PCR cDNA Synthesis Kit (Clontech) can be used as an alternative to the Universal Primer Mix in Basic Protocol 5.

Basic Protocol 4: cDNA Clean‐Up Using Nucleospin Extract II Columns

 Materials
  • cDNA (see Basic Protocol 3)
  • NucleoSpin Extract II kit (Clontech) containing:
    • Buffer NT
    • Buffer NT3 (requires addition of 24 ml ethanol)
    • Buffer NE
    • NucleoSpin Extract II Column with clear collection tube
  • DNase/RNase‐free water, molecular biology grade (Sigma)
  • ≥99.5% ethanol
  • Microcentrifuge
  • 1.5‐ml polypropylene O‐ring microcentrifuge tubes (Sarstedt)

Basic Protocol 5: PCR Amplification of Rearranged TCR Products

 Materials
  • cDNA (stored at −80°C; see Basic Protocol 4)
  • Advantage 2 PCR Kit (Clontech) containing:
    • 10× PCR buffer
    • AdvanTaq2 (a mixture of two enzymes, polymerase and proofreading)
    • PCR‐grade water
    • dNTP mix (10 mM)
  • 10× UPM (Universal Primer Mix); the 10× UPM can be prepared by mixing the following primers at the indicated concentrations:
    • Long (0.4 µM): 5′‐CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
    • Short (2 µM): 5′‐CTAATACGACTCACTATAGGGC
  • MBC2 primer [25 µM; custom‐synthesized commercially (e.g., Invitrogen)]
  • 100‐bp DNA ladder
  • 1% agarose gel made with 1× TAE buffer (unit 10.4)
  • SYBR Gold (Invitrogen)
  • 1.5‐ml polypropylene O‐ring microcentrifuge tubes (Sarstedt)
  • 0.2‐ml PCR tubes
  • Microcentrifuge
  • Thermal cycler
  • Gel box/thick combs/power source
  • UV illuminator or blue light transilluminator
  • Disposable scalpel or disposable genecatcher (The Gel Company)
  • Additional reagents and equipment for running the product on a 1% agarose gel (unit 10.4)

NOTE: The Advantage 2 PCR Kit contains all necessary reagents except the TCR‐specific primer and the 10× UPM.

Support Protocol: Remedy for Unsuccessful PCR Amplification

 Materials
  • mRNA (see Basic Protocol 2)
  • DNase/RNase‐free water, molecular biology grade (Sigma)
  • Amicon Ultra 0.5‐ml centrifugal filters (Millipore)
  • Collection tubes
  • Microcentrifuge

Basic Protocol 6: Gel Extraction and Purification of Amplicons

 Materials
  • Gel‐bound PCR product (see Basic Protocol 5)
  • NucleoSpin Extract II kit (Clontech) containing:
    • Buffer NT
    • Buffer NT3 (requires addition of 24 ml ethanol)
    • Buffer NE
    • NucleoSpin Extract II Column with clear collection tube
  • ≥99.5% ethanol
  • Scale
  • 1.5‐ml polypropylene O‐ring microcentrifuge tubes (Sarstedt)
  • Thermomixer (50°C)
  • Microcentrifuge
  • Vortex

Basic Protocol 7: Amplicon Ligation into TA Cloning Vector

 Materials
  • Gel‐extracted PCR product (see Basic Protocol 6)
  • pGEM‐T Easy Vector System I kit (Promega) containing:
    • pGEM‐T easy vector
    • T4 DNA ligase
    • 2× ligation buffer #1
    • Control insert
  • DNase/RNase‐free water, molecular biology grade (Sigma)
  • 1.5‐ml polypropylene O‐ring microcentrifuge tubes (Sarstedt)
  • Vortex
  • Microcentrifuge
  • 4°C incubator

Basic Protocol 8: Vector Transformation into Competent E. coli

 Materials
  • Ligation product (see Basic Protocol 7)
  • Transformation‐competent, ampicillin‐sensitive E. coli cells (e.g., Max Efficiency DH5α Competent Cells; Invitrogen)
  • Ice
  • SOC medium (Invitrogen)
  • Beaker containing ethanol
  • LB agar plates containing 100 µg/ml ampicillin, 50 µg/ml isopropyl β‐d‐1‐thiogalactopyranoside (IPTG), and 50 µg/ml X‐galactosidase (X‐gal)
  • 1.5‐ml polypropylene O‐ring microcentrifuge tubes (Sarstedt)
  • Heating block (42°C)
  • Thermomixer (37°C)
  • Bunsen burner
  • Plate spinner
  • Glass spreader
  • 37°C incubator

Basic Protocol 9: Colony PCR and Sequencing

 Materials
  • Transformation plates (see Basic Protocol 8)
  • Platinum Taq DNA Polymerase High Fidelity (HiFi; Invitrogen) with 10× HiFi buffer and MgSO4 (50 mM)
  • dNTP mix (10 mM; Invitrogen)
  • M13F and M13R primers, 5 µM each (M13F: 5′‐TTTTCCCAGTCACGAC‐3′; M13R: 5′‐CAGGAAACAGCTATGAC‐3′)
  • DNase/RNase‐free water, molecular biology grade (Sigma)
  • LB agar plates containing 100 µg/ml ampicillin, 50 µg/ml isopropyl β‐d‐1‐thiogalactopyranoside (IPTG), and 50 µg/ml X‐galactosidase (X‐gal)
  • Ice
  • 15‐ml polypropylene tubes (Falcon)
  • Skirted 96‐well PCR plate (AB1000, Applied Biosystems)
  • Sterile plastic disposable reservoir enabling multichannel pipet access (Costar, Corning)
  • Multichannel pipets
  • Sterile toothpicks
  • 37°C incubator
  • Snap caps (MicroAmp 8‐strip cap; Applied Biosystems)
  • Cap installing tool (Applied Biosystems)
  • Vortex
  • Benchtop centrifuge
  • Thermal cycler
  • Aluminum foil seals (Seal & Sample; Beckman Coulter)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •  FigureFigure 10.33.1 Schematic representation of the 5′‐SMART‐RACE PCR. During cDNA synthesis, an anchor of known sequence is incorporated into the 5′ end of full‐length mRNA transcripts. PolyA+ RNA is reverse transcribed from a modified oligo(dT) primer. When the RT reaches the 5′ end of the RNA, its terminal transferase activity adds a short deoxycytidine (dC) sequence. This dC sequence then hybridizes to the G ribonucleotide sequence at the 3′ end of the SMART oligonucleotide. The RT then switches strand to transcribe the 5′ portion of the SMART oligonucleotide. As the addition of deoxycytidine nucleotides is more efficient for full‐length cDNA‐RNA hybrids, full‐length products are selectively enriched. PCR is then performed on the single‐stranded cDNA using primers complementary to TCR genes of interest and the SMART oligonucleotide.
  •  FigureFigure 10.33.2 Outline of well selection for checking colony PCR efficiency. From each of the highlighted wells, 5 µl of diluted PCR product is run on a 1% agarose gel with a 1‐kb ladder. Bands should be visible at ∼800 bp, while the bottom right well (blue colony input) should yield a band at ∼300 bp.

Videos

Literature Cited

Literature Cited
    Appay, V., Douek, D.C., and Price, D.A. 2008. CD8+ T cell efficacy in vaccination and disease. Nat. Med. 14:623‐628.
    Arstila, T.P., Casrouge, A., Baron, V., Even, J., Kanellopoulos, J., and Kourilsky, P. 1999. A direct estimate of the human alphabeta T cell receptor diversity. Science 286:958‐961.
    Casazza, J.P., Betts, M.R., Price, D.A., Precopio, M.L., Ruff, L.E., Brenchley, J.M., Hill, B.J., Roederer, M., Douek, D.C., and Koup, R.A. 2006. Acquisition of direct antiviral effector functions by CMV‐specific CD4+ T lymphocytes with cellular maturation. J. Exp. Med. 203:2865‐2877.
    Casrouge, A., Beaudoing, E., Dalle, S., Pannetier, C., Kanellopoulos, J., and Kourilsky, P. 2000. Size estimate of the alpha beta TCR repertoire of naive mouse splenocytes. J. Immunol. 164:5782‐5787.
    Chattopadhyay, P.K., Melenhorst, J.J., Ladell, K., Gostick, E., Scheinberg, P., Barrett, A.J., Wooldridge, L., Roederer, M., Sewell, A.K., and Price, D.A. 2008. Techniques to improve the direct ex vivo detection of low frequency antigen‐specific CD8+ T cells with peptide‐major histocompatibility complex class I tetramers. Cytometry A 73:1001‐1009.
    Chenchik, A., Zhu, Y., Diatchenko, L., Li, R., Hill, J., and Siebert, P. 1998. "Generation and use of high‐quality cDNA from small amounts of total RNA by SMART PCR". In RT‐PCR Methods for Gene Cloning and Analysis, pp. 305‐319. BioTechniques Books, Natick, Mass.
    Davenport, M.P., Price, D.A., and McMichael, A.J. 2007. The T cell repertoire in infection and vaccination: Implications for control of persistent viruses. Curr. Opin. Immunol. 19:294‐300.
    Douek, D.C., Betts, M.R., Brenchley, J.M., Hill, B.J., Ambrozak, D.R., Ngai, K.L., Karandikar, N.J., Casazza, J.P., and Koup, R.A. 2002. A novel approach to the analysis of specificity, clonality, and frequency of HIV‐specific T cell responses reveals a potential mechanism for control of viral escape. J. Immunol. 168:3099‐3104.
    Haney, D., Quigley, M.F., Asher, T.E., Ambrozak, D.R., Gostick, E., Price, D.A., Douek, D.C., Betts, M.R. 2011. Isolation of viable antigen‐specific CD8(+) T cells based on membrane‐bound tumor necrosis factor (TNF)‐α expression. J. Immunol. Methods 369:33‐41.
    Mason, D. 1998. A very high level of crossreactivity is an essential feature of the T‐cell receptor. Immunol Today 19:395‐404.
    Matz, M., Shagin, D., Bogdanova, E., Britanova, O., Lukyanov, S., Diatchenko, L., and Chenchik, A. 1999. Amplification of cDNA ends based on template‐switching effect and step‐out PCR. Nucleic Acids Res. 27:1558‐1560.
    Nikolich‐Zugich, J., Slifka, M.K., and Messaoudi, I. 2004. The many important facets of T‐cell repertoire diversity. Nat. Rev. Immunol. 4:123‐132.
    Price, D.A., Bitmansour, A.D., Edgar, J.B., Walker, J.M., Axthelm, M.K., Douek, D.C., and Picker, L.J. 2008. Induction and evolution of cytomegalovirus‐specific CD4+ T cell clonotypes in rhesus macaques. J. Immunol. 180:269‐280.
    Price, D.A., Asher, T.E., Wilson, N.A., Nason, M.C., Brenchley, J.M., Metzler, I.S., Venturi, V., Gostick, E., Chattopadhyay, P.K., Roederer, M., Davenport, M.P., Watkins, D.I., and Douek, D.C. 2009. Public clonotype usage identifies protective Gag‐specific CD8+ T cell responses in SIV infection. J. Exp. Med. 206:923‐936.
    Price, D.A., West, S.M., Betts, M.R., Ruff, L.E., Brenchley, J.M., Ambrozak, D.R., Edghill‐Smith, Y., Kuroda, M.J., Bogdan, D., Kunstman, K., Letvin, N.L., Franchini, G., Wolinsky, S.M., Koup, R.A., and Douek, D.C. 2004. T cell receptor recognition motifs govern immune escape patterns in acute SIV infection. Immunity 21:793‐803.
    Rufer, N. 2005. Molecular tracking of antigen‐specific T‐cell clones during immune responses. Curr. Opin. Immunol. 17:441‐447.
    van Bockel, D., Price, D.A., Asher, T.E., Venturi, V., Suzuki, K., Warton, K., Davenport, M.P., Cooper, D.A., Douek, D.C., and Kelleher, A.D. 2007. Validation of RNA‐based molecular clonotype analysis for virus‐specific CD8+ T‐cells in formaldehyde‐fixed specimens isolated from peripheral blood. J. Immunol. Methods 326:127‐138.
    Venturi, V., Kedzierska, K., Turner, S.J., Doherty, P.C., and Davenport, M.P. 2007. Methods for comparing the diversity of samples of the T cell receptor repertoire. J. Immunol. Methods 321:182‐195.
    Venturi, V., Kedzierska, K., Tanaka, M.M., Turner, S.J., Doherty, P.C., and Davenport, M.P. 2008a. Method for assessing the similarity between subsets of the T cell receptor repertoire. J. Immunol. Methods 329:67‐80.
    Venturi, V., Price, D.A., Douek, D.C., and Davenport, M.P. 2008b. The molecular basis for public T‐cell responses? Nat. Rev. Immunol. 8:231‐238.
    Wooldridge, L., Lissina, A., Cole, D.K., van den Berg, H.A., Price, D.A., and Sewell, A.K. 2009. Tricks with tetramers: How to get the most from multimeric peptide‐MHC. Immunology 126:147‐164.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library