The K/BxN Arthritis Model

Paul A. Monach1, Diane Mathis1, Christophe Benoist1

1 Joslin Diabetes Center, Harvard Medical School, Boston, Massachusetts
Publication Name:  Current Protocols in Immunology
Unit Number:  Unit 15.22
DOI:  10.1002/0471142735.im1522s81
Online Posting Date:  May, 2008
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Mice expressing both the T cell receptor (TCR) transgene KRN and the MHC class II molecule Ag7 (K/BxN mice) develop severe inflammatory arthritis, and serum from these mice causes a similar arthritis in a wide range of mouse strains, due to autoantibodies recognizing glucose‐6‐phosphate isomerase (GPI). K/BxN transgenic mice have been useful for investigating the development of autoimmunity, and the serum transfer model has been particularly valuable in eliciting mechanisms by which anti‐GPI autoantibodies induce joint‐specific inflammation. This unit describes detailed methods for the maintenance of a K/BxN colony, induction of arthritis by serum transfer, clinical evaluation of arthritis, and measurement of anti‐GPI antibodies. Curr. Protoc. Immunol. 81:15.22.1‐15.22.12. © 2008 by John Wiley & Sons, Inc.

Keywords: arthritis; rheumatoid arthritis; glucose‐6‐phosphate isomerase; GPI; anti‐GPI; serum transfer; autoantibodies; mouse model; KRN; K/BxN

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Screening for KRN+ Mice by Flow Cytometry
  • Alternate Protocol 1: Screening for KRN+ Mice by PCR
  • Basic Protocol 2: Production of Arthritic K/BxN Mice and Arthritogenic Serum
  • Basic Protocol 3: Induction and Evaluation of Arthritis by Serum Transfer
  • Support Protocol 1: Measurement of Anti‐GPI Antibody Titers
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Screening for KRN+ Mice by Flow Cytometry

  Materials
  • Male mice to be screened for KRN expression on the C57Bl/6 or B10.BR background (see Figure )
  • FACS wash buffer (see recipe)
  • Heparin
  • RBC lysis buffer (see recipe)
  • Fluorescein‐conjugated anti‐mouse Vβ6 TCR (e.g., Pharmingen 01364C)
  • PE‐conjugated anti‐mouse CD4 (e.g., Caltag RM2504‐3)
  • 1% (w/v) paraformaldehyde in phosphate‐buffered saline (PBS; appendix 2A)
  • Chamber to immobilize mouse
  • Heat lamp (optional)
  • Razor blade
  • 1.5‐ml plastic tubes
  • Flow cytometer capable of two‐color analysis

Alternate Protocol 1: Screening for KRN+ Mice by PCR

  Materials
  • Male mice to be screened for KRN expression on the C57Bl/6 or B10.BR background (see Figure )
  • PK digestion buffer (see recipe)
  • 20 mg/ml proteinase K (e.g., Sigma): prepare solution with water and store up to 1 year at −20°C
  • 10× Taq polymerase buffer: 0.1 M Tris·Cl, pH 8.3 ( appendix 2A)/0.5 M KCl; store indefinitely at −20°C
  • 50 mM magnesium chloride (MgCl 2)
  • 5 M betaine: store up to 1 year at room temperature
  • 10 mM PCR primers (5′ to 3′):
    • TCRαF: aggtccacagctccttctga
    • TCRαR: gtattggaaggggccagag
    • TCRβF: gggcaaaaactgaccttgaa
    • TCRβR: gagcctggttgtttgtggat
  • 10 mM (each) dNTPs
  • 5000 U/ml Taq polymerase (e.g., New England Biolabs)
  • Ear punch or scissors, sterile
  • 50°C and 95°C water baths or heating block
  • Micropipettors and sterile filter tips
  • Tubes for thermal cycler
  • Thermal cycler
  • Additional reagents and equipment for performing agarose gel electrophoresis and staining and visualizing gels (unit 10.4)

Basic Protocol 2: Production of Arthritic K/BxN Mice and Arthritogenic Serum

  Materials
  • KRN+ (on the C5B1/6 or B10.BR background) male mice, 7 to 10 months old (not commercially available; may request with MTA from authors)
  • NOD/Lt female mice, >6 weeks old (e.g., The Jackson Laboratory)
  • Breeding cages
  • 1.5‐ml plastic tubes and microcentrifuge
  • Additional reagents and equipment for identifying arthritic mice ( protocol 4) and euthanizing (unit 1.8) and exsanguinating (unit 1.7) mice

Basic Protocol 3: Induction and Evaluation of Arthritis by Serum Transfer

  Materials
  • K/BxN serum ( protocol 3)
  • 5‐ to 7‐week‐old male mice or 6‐week‐old female mice (see )
  • 0.5‐ to 1‐ml syringe and 25‐ to 27‐G needle
  • Precision caliper (e.g., Kafer dial thickness gauge with flat anvils, Long Island Indicator)

Support Protocol 1: Measurement of Anti‐GPI Antibody Titers

  Materials
  • E. coli containing plasmid expressing mouse GPI as a fusion protein (e.g., mouse GPI in pGEX‐4T‐3; Amersham/Pharmacia)
  • 2× YT medium (see recipe)
  • Isopropyl‐β‐D‐thiogalactopyranoside (IPTG)
  • Phosphate‐buffered saline (PBS; appendix 2A), 4°C
  • Triton X‐100
  • 50% slurry of glutathione Sepharose 4B (Amersham/Pharmacia) in PBS ( appendix 2A)
  • Elution buffer (0.154 g reduced glutathione per 50 ml of 50 mM Tris·Cl, pH 8.0)
  • Blocking buffer: PBS with 1% bovine serum albumin (BSA)
  • Mouse sera to be tested (see protocol 3)
  • Alkaline phosphatase‐conjugated goat‐anti‐mouse‐IgG: e.g., F(ab′) 2 fragments (Jackson Immunoresearch)
  • Phosphatase substrate (e.g., pellets from Sigma)
  • Phosphatase buffer (e.g., 8% diethanolamine/2.4 mM MgCl 2, pH 9.8)
  • Shaking incubators, 30°C and 37°C
  • UV/visible light spectrophotometer with appropriate cells for measuring bacterial cultures and protein concentrations
  • 100‐ to 500‐ml centrifuge bottles and 15‐ to 50‐ml centrifuge tubes
  • Refrigerated centrifuge equipped with regular rotors and rotor adapted for 96‐well plates
  • Probe sonicator
  • Test tube rotator
  • Dialysis tubing, 10,000 mol. wt. cutoff (e.g., Slide‐a‐Lyzer, Pierce)
  • Flat‐bottom 96‐well plates
  • Micropipettors including multichannel pipettor
  • Microplate spectrophotometer
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Akilesh, S., Petkova, S., Sproule, T.J., Shaffer, D.J., Christianson, G J., and Roopenian, D. 2004. The MHC class I‐like Fc receptor promotes humorally mediated autoimmune disease. J. Clin. Invest. 113: 1328‐1333.
   Binstadt, B.A., Patel, P.R., Alencar, H., Nigrovic, P.A., Lee, D.M., Mahmood, U., Weissleder, R., Mathis, D., and Benoist, C. 2006. Particularities of the vasculature can promote the organ specificity of autoimmune attack. Nat. Immunol. 7: 284‐292.
   Bruhns, P., Samuelsson, A., Pollard, J.W., and Ravetch, J.V. 2003. Colony‐stimulating factor‐1‐dependent macrophages are responsible for IVIG protection in antibody‐induced autoimmune disease. Immunity 18: 573‐581.
   Chen, M., Lam, B.K., Kanaoka, Y., Nigrovic, P.A., Audoly, L.P., Austen, K.F., and Lee, D.M. 2006. Neutrophil‐derived leukotriene B4 is required for inflammatory arthritis. J. Exp. Med. 203: 837‐842.
   Courtenay, J.S., Dallman, M.J., Dayan, A.D., Martin, A., and Mosedale, B. 1980. Immunisation against heterologous type II collagen induces arthritis in mice. Nature 283: 666‐668.
   Edwards, J.C., Szczepanski, L., Szechinski, J., Filipowicz‐Sosnowska, A., Emery, P., Close, D.R., Stevens, R.M., and Shaw, T. 2004. Efficacy of B cell–targeted therapy with rituximab in patients with rheumatoid arthritis. N. Engl. J. Med. 350: 2572‐2581.
   Ji, H., Gauguier, D., Ohmura, K., Gonzalez, A., Duchatelle, V., Danoy, P., Garchon, H.J., Degott, C., Lathrop, M., Benoist, C., and Mathis, D. 2001. Genetic influences on the end‐stage effector phase of arthritis. J. Exp. Med. 194: 321‐330.
   Ji, H., Ohmura, K., Mahmood, U., Lee, D.M., Hofhuis, F.M., Boackle, S.A., Takahashi, K., Holers, V.M., Walport, M., Gerard, C., Ezekowitz, A., Carroll, M.C., Brenner, M., Weissleder, R., Verbeek, J.S., Duchatelle, V., Degott, C., Benoist, C., and Mathis, D. 2002a. Arthritis critically dependent on innate immune system players. Immunity 16: 157‐168.
   Ji, H., Pettit, A., Ohmura, K., Ortiz‐Lopez, A., Duchatelle, V., Degott, C., Gravallese, E., Mathis, D., and Benoist, C. 2002b. Critical roles for interleukin 1 and tumor necrosis factor alpha in antibody‐induced arthritis. J. Exp. Med. 196: 77‐85.
   Kagari, T., Doi, H., and Shimozato, T. 2002. The importance of IL‐1 beta and TNF‐alpha, and the noninvolvement of IL‐6, in the development of monoclonal antibody‐induced arthritis. J. Immunol. 169: 1459‐1466.
   Kim, N.D., Chou, R.C., Seung, E., Tager, A.M., and Luster, A.D. 2006. A unique requirement for the leukotriene B4 receptor BLT1 for neutrophil recruitment in inflammatory arthritis. J. Exp. Med. 203: 829‐835.
   Korganow, A.S., Ji, H., Mangialaio, S., Duchatelle, V., Pelanda, R., Martin, T., Degott, C., Kikutani, H., Rajewsky, K., Pasquali, J L., Benoist, C., and Mathis, D. 1999. From systemic T cell self‐reactivity to organ‐specific autoimmune disease via immunoglobulins. Immunity 10: 451‐461.
   Kouskoff, V., Korganow, A.S., Duchatelle, V., Degott, C., Benoist, C., and Mathis, D. 1996. Organ‐specific disease provoked by systemic autoimmunity. Cell 87: 811‐822.
   Lee, D.M., Friend, D.S., Gurish, M.F., Benoist, C., Mathis, D., and Brenner, M.B. 2002. Mast cells: A cellular link between autoantibodies and inflammatory arthritis. Science 297: 1689‐1692.
   Maccioni, M., Zeder‐Lutz, G., Huang, H., Ebel, C., Gerber, P., Hergueux, J., Marchal, P., Duchatelle, V., Degott, C., van Regenmortel, M., Benoist, C., and Mathis, D. 2002. Arthritogenic monoclonal antibodies from K/BxN mice. J. Exp. Med. 195: 1071‐1077.
   Matsumoto, I., Staub, A., Benoist, C., and Mathis, D. 1999. Arthritis provoked by linked T and B cell recognition of a glycolytic enzyme. Science 286: 1732‐1735.
   Monach, P.A., Benoist, C., and Mathis, D. 2004. The role of antibodies in mouse models of rheumatoid arthritis, and relevance to human disease. Adv Immunol. 82: 217‐248.
   Ohmura, K., Johnsen, A., Ortiz‐Lopez, A., Desany, P., Roy, M., Besse, W., Rogus, J., Bogue, M., Puech, A., Lathrop, M., Mathis, D., and Benoist, C. 2005. Variation in IL‐1beta gene expression is a major determinant of genetic differences in arthritis aggressivity in mice. Proc. Natl. Acad. Sci. U.S.A. 102: 12489‐12494.
   Watts, G.M., Beurskens, F.J., Martin‐Padura, I., Ballantyne, C.M., Klickstein, L.B., Brenner, M.B., and Lee, D.M. 2005. Manifestations of inflammatory arthritis are critically dependent on LFA‐1. J. Immunol. 174: 3668‐3675.
   Wipke, B.T. and Allen, P.M. 2001. Essential role of neutrophils in the initiation and progression of a murine model of rheumatoid arthritis. J. Immunol. 167: 1601‐1608.
   Wipke, B.T., Wang, Z., Nagengast, W., Reichert, D.E., and Allen, P.M. 2004. Staging the initiation of autoantibody‐induced arthritis: A critical role for immune complexes. J. Immunol. 172: 7694‐7702.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library