T Cell Mediated Autoimmune Glomerular Disease in Mice

Joshua D. Ooi1, Poh‐Yi Gan1, Dragana Odobasic1, Stephen R. Holdsworth2, A. Richard Kitching3

1 Centre for Inflammatory Diseases, Monash University Department of Medicine, Clayton, 2 Department of Nephrology, Monash Health, Clayton, 3 Department of Paediatric Nephrology, Monash Health, Clayton
Publication Name:  Current Protocols in Immunology
Unit Number:  Unit 15.27
DOI:  10.1002/0471142735.im1527s107
Online Posting Date:  November, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Many forms of glomerulonephritis are mediated by autoimmunity. While autoantibodies are often pathogenic, cell‐mediated immunity plays an important role in a number of forms of rapidly progressive glomerulonephritis. This unit describes the induction of cell‐mediated autoimmune glomerular disease in mice. One disease model, experimental anti‐glomerular basement membrane (GBM) disease, features autoreactivity to a well‐defined component of type IV collagen found in the GBM, α3(IV)NC1. The other models the cell‐mediated effector response in forms of renal vasculitis, where autoantibodies to myeloperoxidase result in systemic neutrophil activation, resulting in their localization to the glomerulus and the subsequent deposition of myeloperoxidase within glomerular capillaries. There, myeloperoxidase acts as a “planted” autoantigen and is recognized by effector autoreactive myeloperoxidase‐specific T cells. These models are useful both in defining mechanisms germane to the development of autoimmunity to α3(IV)NC1 and myeloperoxidase, and in dissecting the role of cell‐mediated responses in effecting glomerular injury. © 2014 by John Wiley & Sons, Inc.

Keywords: glomerulonephritis; autoimmunity; cell‐mediated immunity; T lymphocytes

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Induction of Experimental Autoimmune Anti‐GBM Glomerulonephritis in C57BL/6 Mice
  • Basic Protocol 2: Induction of Experimental Autoimmune Anti‐MPO Glomerulonephritis in C57BL/6 Mice
  • Alternate Protocol 1: Induction of Experimental Autoimmune Anti‐GBM Glomerulonephritis in HLA‐DRA1*01:01 Transgenic, HLA‐DRB1*15:01 Transgenic, Mouse MHC Class II Deficient, FCγRIIB Deficient (DR15FcγRIIB−/−) Mice
  • Support Protocol 1: Production and Purification of Recombinant Mouse α3(IV)NC1
  • Support Protocol 2: Purification of Murine MPO From 32D Clone 3 (32DCL3) Cells
  • Support Protocol 3: Measuring MPO Activity
  • Support Protocol 4: Determining the Nephritogenic Threshold of Sheep Anti‐Mouse GBM Globulin to Trigger Anti‐MPO Glomerulonephritis
  • Reagents and Solutions
  • Commentary
  • Literature Cited
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Induction of Experimental Autoimmune Anti‐GBM Glomerulonephritis in C57BL/6 Mice

  Materials
  • rmα3(IV)NC1 (see protocol 4)
  • Complete Freund's adjuvant (CFA; Sigma‐Aldrich)
  • Incomplete Freund's adjuvant (IFA; Sigma‐Aldrich)
  • Phosphate‐buffered saline (PBS; )
  • Cell culture medium (see recipe)
  • 8‐week old C57BL/6 mice (Jackson Laboratory)
  • Optimum cutting temperature (OCT) compound
  • Sonifier B‐30 (Branson)
  • 5‐ml tubes
  • 26‐G needles
  • 30‐G needles
  • 1‐ml syringes
  • Surgical instruments (for removal of kidneys and lymphoid organs, unit )
  • Cryomold
  • Additional reagents and equipment for subcutaneous injection of mice (unit ), emulsification of antigens with complete/incomplete Freund's adjuvant (unit ), blood collection (unit ), mouse euthanasia (unit ), and removal of lymphoid organs (unit )

Basic Protocol 2: Induction of Experimental Autoimmune Anti‐MPO Glomerulonephritis in C57BL/6 Mice

  Materials
  • Eight 6‐ to 10‐week old male C57BL/6 mice (Jackson Laboratory)
  • Native murine MPO (nmMPO; see protocol 5)
  • PBS (see )
  • Sterile saline (0.9% w/v NaCl/H 2O)
  • Complete Freund's adjuvant (CFA; Sigma‐Aldrich)
  • Incomplete Freund's adjuvant (IFA; Sigma‐Aldrich)
  • Cell culture medium (see recipe)
  • Sheep anti‐mouse GBM globulin (see unit )
  • OCT compound
  • 5‐ml tubes
  • 1‐ml plastic syringes
  • 26‐G needles
  • 30‐G needles
  • Sonifier B‐30 (Branson)
  • Cryomold
  • Metabolic cages
  • Additional reagents and equipment for intraperitoneal, intravenous, footpad, and subcutaneous injection of mice (unit ), emulsification of antigens with complete/incomplete Freund's adjuvant (unit ), blood collection (unit ), mouse euthanasia (unit ), and removal of lymphoid organs (unit )

Alternate Protocol 1: Induction of Experimental Autoimmune Anti‐GBM Glomerulonephritis in HLA‐DRA1*01:01 Transgenic, HLA‐DRB1*15:01 Transgenic, Mouse MHC Class II Deficient, FCγRIIB Deficient (DR15FcγRIIB−/−) Mice

  Additional Materials (see protocol 1)
  • 6‐ to 8‐week old mice, deficient in mouse MHC II and transgenic for human HLA DRB1*15:01 and DRA1*01:01 (see Ooi et al., )
  • α3 136‐146 peptide, >98% purity (sequence: DWVSLWKGFSF, Mimotopes)
  • rmα3(IV)NC1 (see protocol 4)
  • PBS (see )
  • Cell culture medium
  • Sonifier B‐30 (Branson)
  • 5‐ml tubes
  • 26‐G needles
  • 30‐G needles
  • 1‐ml syringes
  • Metabolic cages
  • Additional reagents and equipment for cardiac puncture (unit )

Support Protocol 1: Production and Purification of Recombinant Mouse α3(IV)NC1

  Materials
  • Spodoptera frugiperda (Sf21) ovarian tissue (Life Technologies)
  • Grace's insect cell culture medium (Life Technologies)
  • Fetal bovine serum (FBS)
  • 100× antibiotic‐antimycotic (Life Technologies)
  • Human α3(IV)NC1 signal peptide cDNA (84 bp; NCBI Ref Seq: NM_000091.4, nucleotides 163‐246) spliced to mouse α3(IV)NC1 cDNA (699 bp; NCBI Ref Seq: AF169387.1, nucleotides: 4678‐5375; Miner and Sanes, ):
    • ATGAGCGCCCGGACCGCCCCCAGGCCGCAGGTGCTCCTGCTGCCGCTCCTGCTGGTGCTCCTGGCGGCGGCGCCCGCAGCCAGCGCCACTGGTACAAGAATGCGAGGCTTCATCTTCACCCGACACAGTCAAACCACGGCCATTCCTTCATGCCCTGAAGGAACACAGCCACTCTATAGTGGGTTTTCTCTTCTTTTTGTACAAGGAAACAAACGTGCACATGGACAAGACCTAGGTACTCTGGGCAGCTGCCTGCAGCGATTCACCACAATGCCGTTCTTATTCTGTAACATCAATAATGTATGTAACTTTGCATCACGAAATGATTATTCATACTGGCTGTCAACACCAGCTCTGATGCCAATGGACATGGCTCCAATTAGTGGCAGAGCTCTCGAACCCTATATTAGCAGATGCACCGTCTGTGAAGGTCCAGCAATGGCCATAGCTGTTCACAGTCAAACTACTGCTATCCCTCCGTGTCCCCAGGACTGGGTTTCTCTCTGGAAAGGTTTTTCTTTCATTATGTTCACAAGTGCAGGCTCTGAGGGTGCTGGACAAGCACTTGCCTCGCCTGGCTCCTGCCTGGAAGAATTCCGAGCCAGTCCATTTATAGAATGCCATGGACGAGGGACATGTAACTACTACTCAAACTCCTACAGTTTCTGGCTGGCTTCGCTGAACCCAGAAAGAATGTTCAGAAAACCTATTCCATCAACTGTGAAAGCTGGAGACTTAGAGAAAATCATAAGCCGCTGTCAGGTGTGCATGAAGAAAAGACAT (This sequence can be ordered through GeneArt or GenScript)
  • Platinum Taq DNA Polymerase High Fidelity (Life Technologies)
  • QIAquick Gel Extraction Kit (QIAGEN)
  • pBlueBac4.5/V5‐His TOPO TA Expression Kit (Life Technologies)
  • One Shot TOP10 Chemically Competent E. coli (Life Technologies)
  • Endofree plasmid kit (Qiagen)
  • Bac‐N‐Blue transfection kit (Life Technologies)
  • Cellfectin (Life Technologies)
  • Sea Plaque agarose
  • Neutral red solution (Sigma‐Aldrich)
  • Six‐well 35‐mm tissue culture plates
  • TALON Metal Affinity Resin (Clontech)
  • Spinner flasks (Techne)
  • Orbital mixer incubator

Support Protocol 2: Purification of Murine MPO From 32D Clone 3 (32DCL3) Cells

  Materials
  • 32D clone 3 cell line (ATCC #CRL‐11346)
  • IL‐3‐producing WEHI‐3 cell line (ATCC #TIB‐68) or IL‐3 culture supplement (BD Biosciences, cat. no. 354040)
  • Iscove's modified Dulbecco's medium (IMDM; Sigma‐Aldrich)
  • Heat‐inactivated FBS
  • L‐Glutamine
  • Penicillin/streptomycin
  • 2‐Mercaptoethanol (2‐ME)
  • WEHI‐3 conditioned medium
  • Recombinant mouse G‐CSF (Life Technologies) or recombinant human G‐CSF (Amgen)
  • PBS (see )
  • Calcium chloride (CaCl 2)
  • Magnesium chloride (MgCl 2)
  • Manganese chloride (MnCl 2)
  • Con A‐Sepharose (GE Healthcare)
  • Methyl α‐D‐mannopyranoside (Sigma‐Aldrich)
  • Cetyltrimethyl ammonium bromide (CTAB)
  • Polyethylene glycol (M w 20,000)
  • Buffer A (see recipe)
  • Buffer B (see recipe)
  • 50‐ml sterile tubes
  • 175‐cm2 cell culture flasks (BD Biosciences)
  • Cell scrapers
  • 20‐ml gravity flow chromatography columns (Bio‐Rad)
  • Spectrophotometer
  • UV cuvette

Support Protocol 3: Measuring MPO Activity

  Materials
  • o‐Dianisidine dihydrochloride (Sigma‐Aldrich)
  • H 2O 2 solution (30% w/w in H 2O; Sigma‐Aldrich)
  • 50 mM potassium phosphate buffer (pH 6.0)
  • 4‐ml cuvettes
  • Spectrophotometer

Support Protocol 4: Determining the Nephritogenic Threshold of Sheep Anti‐Mouse GBM Globulin to Trigger Anti‐MPO Glomerulonephritis

  Materials
  • Groups of four 6‐ to 8‐week old male C57BL/6J mice
  • Sheep anti‐mouse GBM globulin (see unit )
  • Sterile saline (0.9% w/v NaCl/H 2O)
  • 1‐ml syringe
  • 30‐G needle
  • Metabolic cages
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Aitman, T.J. , Dong, R. , Vyse, T.J. , Norsworthy, P.J. , Johnson, M.D. , Smith, J. , Mangion, J. , Roberton‐Lowe, C. , Marshall, A.J. , Petretto, E. , Hodges, M.D. , Bhangal, G. , Patel, S.G. , Sheehan‐Rooney, K. , Duda, M. , Cook, P.R. , Evans, D.J. , Domin, J. , Flint, J. , Boyle, J.J. , Pusey, C.D. , and Cook, H.T. 2006. Copy number polymorphism in Fcgr3 predisposes to glomerulonephritis in rats and humans. Nature 439:851‐855.
   Apostolopoulos, J. , Ooi, J.D. , Odobasic, D. , Holdsworth, S.R. , and Kitching, A.R. 2006. The isolation and purification of biologically active recombinant and native autoantigens for the study of autoimmune disease. J. Immunol. Methods 308:167‐178.
   Bolton, W.K. , Tucker, F.L. , and Sturgill, B.C. 1984. New avian model of experimental glomerulonephritis consistent with mediation by cellular immunity. Nonhumorally mediated glomerulonephritis in chickens. J. Clin. Invest. 73:1263‐1276.
   Bradley, P.P. , Priebat, D.A. , Christensen, R.D. , and Rothstein, G. 1982. Measurement of cutaneous inflammation: Estimation of neutrophil content with an enzyme marker. J. Invest. Dermatol. 78:206‐209.
   Couser, W.G. 1999. Glomerulonephritis. Lancet 353:1509‐1515.
   Cunningham, M.A. , Huang, X.R. , Dowling, J.P. , Tipping, P.G. , and Holdsworth, S.R. 1999. Prominence of cell‐mediated immunity effectors in “pauci‐immune” glomerulonephritis. J. Am. Soc. Nephrol. 10:499‐506.
   Dean, E.G. , Wilson, G.R. , Li, M. , Edgtton, K.L. , O'Sullivan, K.M. , Hudson, B.G. , Holdsworth, S.R. , and Kitching, A.R. 2005. Experimental autoimmune Goodpasture's disease: A pathogenetic role for both effector cells and antibody in injury. Kidney Int. 67:566‐575.
   Falk, R.J. and Jennette, J.C. 1988. Anti‐neutrophil cytoplasmic autoantibodies with specificity for myeloperoxidase in patients with systemic vasculitis and idiopathic necrotizing and crescentic glomerulonephritis. N. Engl. J. Med. 318:1651‐1657.
   Falk, R.J. , Terrell, R.S. , Charles, L.A. , and Jennette, J.C. 1990. Anti‐neutrophil cytoplasmic autoantibodies induce neutrophils to degranulate and produce oxygen radicals in vitro. Proc. Natl. Acad. Sci. U.S.A. 87:4115‐4119.
   Gan, P.Y. , Steinmetz, O.M. , Tan, D.S. , O'Sullivan, K.M. , Ooi, J.D. , Iwakura, Y. , Kitching, A.R. , and Holdsworth, S.R. 2010. Th17 cells promote autoimmune anti‐myeloperoxidase glomerulonephritis. J. Am. Soc. Nephrol. 21:925‐931.
   Gan, P.Y. , Summers, S.A. , Ooi, J.D. , O'Sullivan, K.M. , Tan, D.S. , Muljadi, R.C. , Odobasic, D. , Kitching, A.R. , and Holdsworth, S.R. 2012. Mast cells contribute to peripheral tolerance and attenuate autoimmune vasculitis. J. Am. Soc. Nephrol. 23:1955‐1966.
   Heeringa, P. , Brouwer, E. , Klok, P.A. , Huitema, M.G. , van den Born, J. , Weening, J.J. , and Kallenberg, C.G. 1996. Autoantibodies to myeloperoxidase aggravate mild anti‐glomerular‐basement‐membrane‐mediated glomerular injury in the rat. Am. J. Pathol. 149:1695‐1706.
   Hopfer, H. , Maron, R. , Butzmann, U. , Helmchen, U. , Weiner, H.L. , and Kalluri, R. 2003. The importance of cell‐mediated immunity in the course and severity of autoimmune anti‐glomerular basement membrane disease in mice. FASEB J. 17:860‐868.
   Hopfer, H. , Holzer, J. , Hunemorder, S. , Paust, H.J. , Sachs, M. , Meyer‐Schwesinger, C. , Turner, J.E. , Panzer, U. , and Mittrucker, H.W. 2012. Characterization of the renal CD4(+) T‐cell response in experimental autoimmune glomerulonephritis. Kidney Int. 82:60‐71.
   Jennette, J.C. and Falk, R.J. 1997. Small‐vessel vasculitis. N. Engl. J. Med. 337:1512‐1523.
   Kalluri, R. , Danoff, T.M. , Okada, H. , and Neilson, E.G. 1997. Susceptibility to anti‐glomerular basement membrane disease and Goodpasture syndrome is linked to MHC class II genes and the emergence of T cell‐mediated immunity in mice. J. Clin. Invest. 100:2263‐2275.
   Kessenbrock, K. , Krumbholz, M. , Schonermarck, U. , Back, W. , Gross, W.L. , Werb, Z. , Grone, H.J. , Brinkmann, V. , and Jenne, D.E. 2009. Netting neutrophils in autoimmune small‐vessel vasculitis. Nat. Med. 15:623‐625.
   Kettle, A.J. and Winterbourn, C.C. 1994. Assays for the chlorination activity of myeloperoxidase. In Methods in Enzymology, Vol. 233 ( L. Packer , ed.) pp. 502‐512. Academic Press, San Diego.
   Kitching, A.R. , Turner, A.L. , Semple, T. , Li, M. , Edgtton, K.L. , Wilson, G.R. , Timoshanko, J.R. , Hudson, B.G. , and Holdsworth, S.R. 2004. Experimental autoimmune anti‐glomerular basement membrane glomerulonephritis: A protective role for IFN‐gamma. J. Am. Soc. Nephrol. 15:1764‐1774.
   Miner, J.H. and Sanes, J.R. 1994. Collagen IV alpha 3, alpha 4, and alpha 5 chains in rodent basal laminae: sequence, distribution, association with laminins, and developmental switches. J. Cell Biol. 127:879‐891.
   Neale, T.J. , Tipping, P.G. , Carson, S.D. , and Holdsworth, S.R. 1988. Participation of cell‐mediated immunity in deposition of fibrin in glomerulonephritis. Lancet 2:421‐424.
   Ooi, J.D. , Phoon, R.K. , Holdsworth, S.R. , and Kitching, A.R. 2009. IL‐23, not IL‐12, directs autoimmunity to the Goodpasture antigen. J. Am. Soc. Nephrol. 20:980‐989.
   Ooi, J.D. , Chang, J. , Hickey, M.J. , Borza, D.B. , Fugger, L. , Holdsworth, S.R. , and Kitching, A.R. 2012. The immunodominant myeloperoxidase T‐cell epitope induces local cell‐mediated injury in antimyeloperoxidase glomerulonephritis. Proc. Natl. Acad. Sci. U.S.A. 109:E2615‐E2624.
   Ooi, J.D. , Chang, J. , O'Sullivan, K.M. , Pedchenko, V. , Hudson, B.G. , Vandenbark, A.A. , Fugger, L. , Holdsworth, S.R. , and Kitching, A.R. 2013. The HLA‐DRB1*15:01‐restricted Goodpasture's T cell epitope induces GN. J. Am. Soc. Nephrol. 24:419‐431.
   Reynolds, J. , Tam, F.W. , Chandraker, A. , Smith, J. , Karkar, A.M. , Cross, J. , Peach, R. , Sayegh, M.H. , and Pusey, C.D. 2000. CD28‐B7 blockade prevents the development of experimental autoimmune glomerulonephritis. J. Clin. Invest. 105:643‐651.
   Reynolds, J. , Khan, S.B. , Allen, A.R. , Benjamin, C.D. , and Pusey, C.D. 2004. Blockade of the CD154‐CD40 costimulatory pathway prevents the development of experimental autoimmune glomerulonephritis. Kidney Int. 66:1444‐1452.
   Reynolds, J. , Cook, P.R. , Behmoaras, J. , Smith, J. , Bhangal, G. , Tadros, S. , Tee, J. , Salama, A.D. , Evans, D.J. , Aitman, T.J. , Cook, H.T. , and Pusey, C.D. 2012. Genetic susceptibility to experimental autoimmune glomerulonephritis in the Wistar Kyoto rat. Am. J. Pathol. 180:1843‐1851.
   Ruth, A.J. , Kitching, A.R. , Kwan, R.Y. , Odobasic, D. , Ooi, J.D. , Timoshanko, J.R. , Hickey, M.J. , and Holdsworth, S.R. 2006. Anti‐neutrophil cytoplasmic antibodies and effector CD4+ cells play nonredundant roles in anti‐myeloperoxidase crescentic glomerulonephritis. J. Am. Soc. Nephrol. 17:1940‐1949.
   Sado, Y. , Naito, I. , and Okigaki, T. 1989. Transfer of anti‐glomerular basement membrane antibody‐induced glomerulonephritis in inbred rats with isologous antibodies from the urine of nephritic rats. J. Pathol. 158:325‐332.
   Steblay, R.W. 1962. Glomerulonephritis induced in sheep by injections of heterologous glomerular basement membrane and Freund's complete adjuvant. J. Exp. Med. 116:253‐272.
   Tan, D.S. , Gan, P.Y. , O'Sullivan, K.M. , Hammett, M.V. , Summers, S.A. , Ooi, J.D. , Lundgren, B.A. , Boyd, R.L. , Scott, H.S. , Kitching, A.R. , Chidgey, A.P. , and Holdsworth, S.R. 2013. Thymic deletion and regulatory T cells prevent antimyeloperoxidase GN. J. Am. Soc. Nephrol. 24:573‐585.
   Valtieri, M. , Tweardy, D.J. , Caracciolo, D. , Johnson, K. , Mavilio, F. , Altmann, S. , Santoli, D. , and Rovera, G. 1987. Cytokine‐dependent granulocytic differentiation. Regulation of proliferative and differentiative responses in a murine progenitor cell line. J. Immunol. 138:3829‐3835.
   Wu, J. , Hicks, J. , Borillo, J. , Glass, W.F., II , and Lou, Y.H. 2002. CD4(+) T cells specific to a glomerular basement membrane antigen mediate glomerulonephritis. J. Clin. Invest. 109:517‐524.
   Xiao, H. , Heeringa, P. , Hu, P. , Liu, Z. , Zhao, M. , Aratani, Y. , Maeda, N. , Falk, R.J. , and Jennette, J.C. 2002. Antineutrophil cytoplasmic autoantibodies specific for myeloperoxidase cause glomerulonephritis and vasculitis in mice. J. Clin. Invest. 110:955‐963.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library