Preparation of Stable Single‐Chain Trimers Engineered with Peptide, β2 Microglobulin, and MHC Heavy Chain

Ted Hansen1, Y.Y. Lawrence Yu1, Daved H. Fremont1

1 Washington University School of Medicine, St. Louis, Missouri
Publication Name:  Current Protocols in Immunology
Unit Number:  Unit 17.5
DOI:  10.1002/0471142735.im1705s87
Online Posting Date:  November, 2009
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes a method for constructing a class I MHC molecule with a bound peptide as a single polypeptide chain, termed SCT, for single chain trimer. The component organization of the SCT appears to be widely applicable to different mouse or human MHC class I isotypes bound by different antigenic peptides. The enhanced peptide occupancy afforded by the SCT format makes these molecules effective reagents as DNA vaccines, multimeric staining reagents to enumerate CD8 T cells, and probes of lymphocyte biology. Curr. Protoc. Immunol. 87:17.5.1‐17.5.17. © 2009 by John Wiley & Sons, Inc.

Keywords: vaccines; tetramers; lymphocyte development; recombinant MHC/peptide complexes

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Strategic Planning
  • Basic Protocol 1: Construction of SCT for Mammalian Expression
  • Basic Protocol 2: Production of SCT Monomer and Tetramer
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Construction of SCT for Mammalian Expression

  Materials
  • β2mb cDNA and H‐2Kb cDNA
  • Expand High Fidelity PCR kit (Roche)
  • Sense oligo encoding a NotI site plus the start of the β2m signal peptide. (Oligo 1 in Table 17.5.2)
  • Antisense oligo encoding the end of the β2m coding sequence plus G4SG4SG linker (wherein the last two residues SG are encoded by the BspEI site or TCCGGA; Oligo 2 in Table 17.5.2)
  • Sense oligo encoding a SG4SG4S linker (wherein the first two residues SG are encoded by BspEI) plus the start of the Kb mature peptide (Oligo 3 in Table 17.5.2)
  • Antisense oligo encoding the end of the Kb coding sequence plus STOP codon plus a BamHI site (Oligo 4 in Table 17.5.2)
  • QIAquick PCR Purification Kit (Qiagen)
  • Restriction enzymes: NotI, BspEI, BamHI, DpnI, and NheI (New England Biolabs)
  • pIRESneo plasmid (BD Clontech)
  • Calf intestinal phosphatase (CIP; New England Biolabs)
  • Rapid DNA Ligation Kit (Roche)
  • XL‐2 Blue Ultracompetent E. coli (Stratagene)
  • LB agar plates (see recipe) containing 100 µg/ml ampicillin
  • LB liquid medium (see recipe) containing 100 µg/ml ampicillin
  • QIAprep Spin Miniprep Kit (Qiagen)
  • BigDye Terminator mix v. 3.1 (Perkin‐Elmer)
  • Antisense oligo that encodes the end of the β2m signal peptide plus SIINFEKL (ovalbumin derived Kb epitope) plus G3AS, wherein the last two residues AS are encoded by the NheI site or GCTAGC (Oligo 5 in Table 17.5.2)
  • Sense oligo that encodes ASG4SG4S plus the start of the β2m mature portion wherein the first two residues AS are encoded by the NheI site (Oligo 6 in Table 17.5.2)
  • QuikChange mutagenesis kit (Stratagene)
  • Mouse L cells (e.g., ATCC CRL‐2648) or other cell line easy to tranfect and transduce, e.g., mouse 3T3 (ATCC CCL‐163) cells, human 293 (ATCC CRL‐1573), or HeLa cells)
  • Complete RPMI medium/10% FBS ( appendix 2A)
  • Opti‐MEM serum‐free medium (Invitrogen)
  • Fugene transfection reagent (Roche)
  • Complete RPMI medium/10% FBS ( appendix 2A) supplemented with 1 mg/ml G418
  • Thermal cycler
  • 6‐well tissue culture plates
  • 5‐ml polystyrene tubes
  • Additional reagents and equipment for PCR (unit 10.20), agarose gel electrophoresis (unit 10.4& ), transformation of E. coli ( appendix 3N), and restriction mapping (Bloch, )
    Table 7.5.2   MaterialsOligonucleotides Used for PCR in This Unit

    Oligo no. Sequence (5′‐3′)
    1 tctgcggccgcgtcgacggaatttcgactctagaagcatggctcgctcggtgacc
    2 gcaacttccggaaccgcctccaccggaaccaccaccgcccatgtctcgatcccagtag
    3 gcaacttccggaggtggtggatccggtggtggtggtagtggcccacactcgctgagg
    4 gatggatcctcacgctttacaatctgggag
    5 gaggctagcacctcctccaagtttttcgaaattaatgatactagcatacaaaccggtcagtg
    6 ggtgctagcggtggtggtggtagcggaggtggaggcagcatccagaaaacccctcaaatt

Basic Protocol 2: Production of SCT Monomer and Tetramer

  Materials
  • SCT DNA in pIRESneo vector ( protocol 1)
  • Expand High Fidelity PCR Kit (Roche)
  • pET21a plasmid (Novagen)
  • BL21‐CodonPlus (DE3)‐RIL competent E. coli cells (Stratagene)
  • LB liquid medium (see recipe) containing 100 µg/ml carbenicillin
  • Sodium deoxycholate
  • Guanidinium⋅HCl–based solubilization buffer: 6 M guanidine hydrochloride/20 mM Tris⋅Cl, pH 8.0; add 2‐mercaptoethanol to 20 mM final just before use
  • Size exclusion chromatography buffer: 20 mM HEPES, pH 7.5, 150 mM NaCl, and 0.01% NaN 3
  • Ion‐exchange buffer: 25 mM Tris⋅Cl, pH 7.5 ( appendix 2A)
  • NaCl
  • BirA ligase (Avidity; http://www.avidity.com/)
  • PE‐labeled streptavidin (BD Pharmingen)
  • Thermal cycler
  • 250‐ml Erlenmeyer flask
  • 37°C incubator with shaker
  • Millipore Stirred Ultrafiltration Cell Model 8400 with 30‐KDa MWCO membrane
  • Millex‐GV low‐protein‐binding syringe filter (Millipore)
  • ÄKTA FPLC system (GE Healthcare Life Sciences) including:
    • Superdex 75 size‐exclusion column
    • Superdex 200 size‐exclusion column
    • Mono Q 5/50 GL ion‐exchange column
  • Amicon Ultra centrifugal filter unit (Millipore) with 30‐kDa MWCO membrane
  • Avanti J‐26 XP Series High‐Performance Centrifuge with JLA 8.1000 and JLA 16.250 rotors (Beckman Coulter)
  • 0.2‐µm bottle‐top filtration unit with 0.2‐µm pore‐size PES membrane (Nalgene)
  • Spectrophotometer
  • Additional reagents and equipment for cloning SCT into a plasmid ( protocol 1), oxidative refolding of protein (unit 17.3), SDS‐PAGE and staining of proteins in gels (unit 8.4), and immunoblotting (unit 8.10)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Bloch, K.D. 1995. Mapping by multiple endonuclease digestions. Curr. Protoc. Mol. Biol. 13:3.2.1‐3.2.5.
   Choudhuri, K., Wiseman, D., Brown, M.H., Gould, K., and van der Merwe, P.A. 2005. T‐cell receptor triggering is critically dependent on the dimensions of its peptide‐MHC ligand. Nature 436:578‐582.
   Crew, M.D., Cannon, M.J., Phanavanh, B., and Garcia‐Borges, C.N. 2005. An HLA‐E single chain trimer inhibits human NK cell reactivity towards porcine cells. Mol. Immunol. 42:1205‐1214.
   Fremont, D.H., Hendrickson, W.A., Marrack, P., and Kappler, J. 1996. Structures of an MHC class II molecule with covalently bound single peptides. Science 272:1001‐1004.
   Fremont, D.H., Stura, E.A., Matsumura, M., Peterson, P.A., and Wilson, I.A. 1995. Crystal structure of an H‐2Kb‐ovalbumin peptide complex reveals the interplay of primary and secondary anchor positions in the major histocompatibility complex binding groove. Proc. Natl. Acad. Sci. U.S.A. 92:2479‐2483.
   Greten, T.F., Korangy, F., Neumann, G., Wedemeyer, H., Schlote, K., Heller, A., Scheffer, S., Pardoll, D.M., Garbe, A.I., Schneck, J.P., and Manns, M.P. 2002. Peptide‐beta2‐microglobulin‐MHC fusion molecules bind antigen‐specific T cells and can be used for multivalent MHC‐Ig complexes. J. Immunol. Methods 271:125‐135.
   Hirel, P.H., Schmitter, M.J., Dessen, P., Fayat, G., and Blanquet, S. 1989. Extent of N‐terminal methionine excision from Escherichia coli proteins is governed by the side‐chain length of the penultimate amino acid. Proc. Natl. Acad. Sci. U.S.A. 86:8247‐8251.
   Huang, C.H., Peng, S., He, L., Tsai, Y.C., Boyd, D.A., Hansen, T.H., Wu, T.C., and Hung, C.F. 2005. Cancer immunotherapy using a DNA vaccine encoding a single‐chain trimer of MHC class I linked to an HPV‐16 E6 immunodominant CTL epitope. Gene Ther. 12:1180‐1186.
   Hudrisier, D., Riond, J., Garidou, L., Duthoit, C., and Joly, E. 2005. T cell activation correlates with an increased proportion of antigen among the materials acquired from target cells. Eur. J. Immunol. 35:2284‐2294.
   Hung, C.F., Calizo, R., Tsai, Y.C., He, L., and Wu, T.C. 2007. A DNA vaccine encoding a single‐chain trimer of HLA‐A2 linked to human mesothelin peptide generates anti‐tumor effects against human mesothelin‐expressing tumors. Vaccine 25:127‐135.
   Ignatowicz, L., Kappler, J., and Marrack, P. 1996. The repertoire of T cells shaped by a single MHC/peptide ligand. Cell 84:521‐529.
   Jaramillo, A., Narayanan, K., Campbell, L.G., Benshoff, N.D., Lybarger, L., Hansen, T.H., Fleming, T.P., Dietz, J.R., and Mohanakumar, T. 2004. Recognition of HLA‐A2‐restricted mammaglobin‐A‐derived epitopes. Breast Cancer Res. Treat. 88:29‐41.
   Kim, S., Poursine‐Laurent, J., Truscott, S.M., Lybarger, L., Song, Y.J., Yang, L., French, A.R., Sunwoo, J.B., Lemieux, S., Hansen, T.H., and Yokoyama, W.M. 2005. Licensing of natural killer cells by host major histocompatibility complex class I molecules. Nature 436:709‐713.
   Kozono, H., White, J., Clements, J., Marrack, P., and Kappler, J. 1994. Production of soluble MHC class II proteins with covalently bound single peptides. Nature 369:151‐154.
   Lybarger, L., Yu, Y.Y., Miley, M.J., Fremont, D.H., Myers, N., Primeau, T., Truscott, S.M., Connolly, J.M., and Hansen, T.H. 2003. Enhanced immune presentation of a single‐chain major histocompatibility complex class I molecule engineered to optimize linkage of a C‐terminally extended peptide. J. Biol. Chem. 278:27105‐27111.
   Mitaksov, V., Truscott, S.M., Lybarger, L., Connolly, J.M., Hansen, T.H., and Fremont, D.H. 2007. Structural engineering of pMHC reagents for T Cell vaccines and diagnostics. Chem. Biol. 14:909‐922.
   Mottez, E., Langlade‐Demoyen, P., Gournier, H., Martinon, F., Maryanski, J., Kourilsky, P., and Abastado, J.P. 1995. Cells expressing a major histocompatibility complex class I molecule with a single covalently bound peptide are highly immunogenic. J. Exp. Med. 181:493‐502.
   Otten, G.R., Bikoff, E., Ribaudo, R.K., Kozlowski, S., Margulies, D.H., and Germain, R.N. 1992. Peptide and beta 2‐microglobulin regulation of cell surface MHC class I conformation and expression. J. Immunol. 148:3723‐3732.
   Oved, K., Lev, A., Noy, R., Segal, D., and Reiter, Y. 2005. Antibody‐mediated targeting of human single‐chain class I MHC with covalently linked peptides induces efficient killing of tumor cells by tumor or viral‐specific cytotoxic T lymphocytes. Cancer Immunol. Immunother. 54:867‐879.
   Palmowski, M.J., Parker, M., Choudhuri, K., Chui, C., Callan, M.F.C., van der Merwe, P.A., Cerundolo, V., and Gould, K.G. 2009. A single chain H‐2Db molecule presenting an influenza virus epitope shows enhanced ability at stimulating CD8+ T cell responses in vivo. J. Immunol. 182:4565‐4571
   Porgador, A., Yewdell, J.W., Deng, Y., Bennink, J.R., and Germain, R.N. 1997. Localization, quantitation, and in situ detection of specific peptide‐MHC class I complexes using a monoclonal antibody. Immunity. 6:715‐726.
   Primeau, T., Myers, N.B., Yu, Y.Y., Lybarger, L., Wang, X., Truscott, S.M., Hansen, T.H., and Connolly, J.M. 2005. Applications of major histocompatibility complex class I molecules expressed as single chains. Immunol. Res. 32:109‐122.
   Truscott, S.M., Lybarger, L., Martinko, J.M., Mitaksov, V.E., Kranz, D.M., Connolly, J.M., Fremont, D.H., and Hansen, T.H. 2007. Disulfide bond engineering to trap peptides in the MHC class I binding groove. J. Immunol. 178:6280‐6289.
   Truscott, S.M., Wang, X., Lybarger, L., Biddison, W.E., McBerry, C., Martinko, J.M., Connolly, J.M., Linette, G.P., Fremont, D.H., Hansen, T.H., and Carreno, B.M. 2008. Human major histocompatibility complex (MHC) class I molecules with disulfide traps secure disease‐related antigenic peptides and exclude competitor peptides. J. Biol. Chem. 283:7480‐7490.
   Uger, R.A. and Barber, B.H. 1998. Creating CTL targets with epitope‐linked beta 2‐microglobulin constructs. J. Immunol. 160:1598‐1605.
   Vest, H.N., Ostergaard, P.L., Stryhn, A., and Buus, S. 2001. Phage display of peptide/major histocompatibility class I complexes. Eur. J. Immunol. 31:32‐38.
   White, J., Crawford, F., Fremont, D., Marrack, P., and Kappler, J. 1999. Soluble class I MHC with beta2‐microglobulin covalently linked peptides: Specific binding to a T cell hybridoma. J. Immunol. 162:2671‐2676.
   Yu, Y.Y., Netuschil, N., Lybarger, L., Connolly, J.M., and Hansen, T.H. 2002. Cutting edge: Single‐chain trimers of MHC class I molecules form stable structures that potently stimulate antigen‐specific T cells and B cells. J. Immunol. 168:3145‐3149.
   Zhang, Y., Li, S., Shan, M., Pan, X., Zhuang, K., He, L., Gould, K., and Tien, P. 2007. Hepatitis B virus core antigen epitopes presented by HLA‐A2 single‐chain trimers induce functional epitope‐specific CD8+ T‐cell responses in HLA‐A2.1/Kb transgenic mice. Immunology 121:105‐112.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library